ID: 965891250

View in Genome Browser
Species Human (GRCh38)
Location 3:173516515-173516537
Sequence AGGTGGAAGGAAAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 840
Summary {0: 1, 1: 0, 2: 7, 3: 75, 4: 757}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965891250 Original CRISPR AGGTGGAAGGAAAAGTTGGA AGG (reversed) Intronic
900917899 1:5651186-5651208 AGGAGGAAGGAGAAGCGGGAGGG + Intergenic
900996017 1:6124126-6124148 AGGTGGAAGGGAAAGAGGGAGGG + Intronic
901897294 1:12325072-12325094 AGGGGGAAAAAAAAGATGGAAGG - Intronic
901922619 1:12547840-12547862 AGGTGGATGGAATCCTTGGAGGG - Intergenic
902111531 1:14082836-14082858 AAGTGGGAGGTAAAGTGGGAGGG - Intergenic
902465415 1:16614388-16614410 AGATTCAAGGAAAATTTGGAAGG - Intergenic
902938523 1:19782594-19782616 AGAGGGAAGGAAAAGAAGGAGGG - Intronic
903170952 1:21553143-21553165 AGGTGGAAAAAAAAACTGGAAGG - Intronic
903964027 1:27074795-27074817 AGGAGGAAAGAAAGGCTGGAAGG - Intergenic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904387187 1:30151101-30151123 AGGAGGAAGAAAAAGATGGGTGG - Intergenic
904993241 1:34610839-34610861 AGATGAAAGGAAAAGTTTGAAGG + Intergenic
905056230 1:35096392-35096414 AGGTGGAAGGATCAGCTTGAGGG + Intronic
906105122 1:43286905-43286927 AGGAGGCAGGAAAGGTGGGAAGG - Intergenic
906470840 1:46129348-46129370 AGTTGGAAGCAAAAATTAGAGGG + Intronic
906921101 1:50065131-50065153 AGGTGAGAGGAAAAGGTGGGGGG - Intronic
907203337 1:52746914-52746936 AGATGGAGGGAAAGGATGGAGGG - Intronic
907234378 1:53031830-53031852 AGGTGGGAGGAGAAGTAGTAAGG + Intronic
907285780 1:53378615-53378637 GGGTGGAATGAATAGGTGGAAGG - Intergenic
908077420 1:60535692-60535714 ATGTGGAAGGAAAAGTAGCCTGG + Intergenic
908337414 1:63141277-63141299 GGGTGAGAGGAAATGTTGGAAGG + Intergenic
908708229 1:66984608-66984630 AAGAGGAAGTAAAAGTTGAAGGG + Exonic
909193699 1:72588413-72588435 AGGAGGAAGGGAAAGAGGGAAGG + Intergenic
909270423 1:73617213-73617235 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
909271361 1:73627418-73627440 AAGTGGAAGGAAGAGTGAGAAGG + Intergenic
910523308 1:88148538-88148560 AGGAGGAAGGAAGAGAGGGAGGG + Intergenic
911558498 1:99375578-99375600 AGGTGGGAGACAAAGTTGGAAGG - Intergenic
913994970 1:143644173-143644195 AGATTCAAGGAAAATTTGGAAGG - Intergenic
914341325 1:146762878-146762900 AGGAGGAAGAAAAAGTTTGCTGG + Intergenic
914361192 1:146937848-146937870 AGATTCAAGGAAAATTTGGAAGG + Intergenic
914416590 1:147489115-147489137 ATAAGGAAGGAAAGGTTGGAGGG - Intergenic
914491395 1:148152775-148152797 AGATTCAAGGAAAATTTGGAAGG - Intergenic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915326803 1:155084972-155084994 AGCTCGGAGGAAAAGTCGGAAGG + Intronic
915554733 1:156655057-156655079 AGGTGGATGGTAAAGTCTGAAGG + Intronic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916027462 1:160846202-160846224 ACTTGGGAGGAAAAGTGGGAGGG - Intronic
916294622 1:163203800-163203822 AGGAAGCAGGAAAAGTTTGAAGG - Intronic
916949351 1:169763184-169763206 AGTTGGAAAGAAAAGATGGTTGG + Intronic
917306317 1:173628555-173628577 AGGGGAGAGGAAAAGTGGGAAGG + Intronic
917394186 1:174574866-174574888 AGGTGGAAGGAAGAGTAGACTGG + Intronic
917909503 1:179628255-179628277 AGGTGGAAGGAAAGTAAGGAGGG + Intronic
917965548 1:180176297-180176319 GGTGGGAAGGAAAAGATGGATGG + Intronic
919062508 1:192651605-192651627 AGGAAGAAGCAAAAGTAGGAGGG + Intronic
919072147 1:192769331-192769353 GGGTGGAGGGAAAAAGTGGATGG + Intergenic
920347992 1:205318924-205318946 AGGTGGAGAGAAAATTGGGATGG + Intronic
920517535 1:206597385-206597407 AGGTGGAAGGGAAAGTGAGATGG + Intronic
920910036 1:210207704-210207726 AGAAGGAAGGAAAAGAAGGAAGG + Intergenic
921823176 1:219640857-219640879 AAGTGGAGGGAAGAGTGGGAAGG + Intergenic
922174065 1:223181323-223181345 AGGTGGAATGAAAGGATTGATGG + Intergenic
922534956 1:226372863-226372885 AGGTGGAGGGAAAGGTTGAGAGG - Intronic
922942116 1:229476472-229476494 AGGTGGAAGTAAGAGTAAGAGGG + Intronic
923036418 1:230287936-230287958 AGCTGGAAGGAAAGGAAGGAAGG + Intergenic
923257381 1:232233346-232233368 AGGTGGGAGGGAAAGAAGGAAGG + Intergenic
924461482 1:244263411-244263433 AGGAGGAAGGAAAGGGGGGAGGG + Intergenic
1063534150 10:6866599-6866621 AGGAGGAAGGAAGAGATGGAAGG - Intergenic
1063647452 10:7899247-7899269 AGGAGGCAGGAACAGATGGATGG - Intronic
1063729009 10:8674349-8674371 AGGTGGAAGAAAAAGTGAGACGG - Intergenic
1063792681 10:9472270-9472292 AGATGGAAAGAAATGTTAGAAGG - Intergenic
1063856458 10:10259446-10259468 AGGTGGTGGGAAAAGTTGCATGG + Intergenic
1064141439 10:12794071-12794093 CGTTGGAAGGAAAATGTGGAAGG + Intronic
1064537181 10:16369582-16369604 AGGTGGAAATGAGAGTTGGAAGG - Intergenic
1065264180 10:23957745-23957767 AGGAGAAAGGAAAAGTTGGTTGG - Intronic
1065634061 10:27712499-27712521 AGGTAAAAGGAAAAGGTGGGAGG + Intronic
1065747418 10:28855015-28855037 AGGTAGAAGGATAAGGAGGAAGG - Intronic
1067161463 10:43828396-43828418 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1067808239 10:49407927-49407949 AGGAGGAATGAAAAAATGGATGG + Intergenic
1069343555 10:67440261-67440283 AAGTGGAGGGAAGAGTGGGAAGG + Intronic
1070531333 10:77339848-77339870 AGGTAGAAAGAAAAGGGGGAAGG - Intronic
1071018119 10:81021647-81021669 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1071122721 10:82298233-82298255 GGGAGGAAGGAAGAGATGGAGGG + Intronic
1071506381 10:86234187-86234209 TGGAGGAAGGAAAAGGGGGATGG - Intronic
1071549144 10:86552841-86552863 AGGTGGAAGGGTAAGAGGGAAGG - Intergenic
1071564594 10:86665224-86665246 AGGTGGTAGGAGCAGTGGGAAGG + Intronic
1071935462 10:90525977-90525999 AAGTGGAGGGAATAGTTGGAAGG - Intergenic
1071954940 10:90747814-90747836 ACTTGGAATGAAAAATTGGAAGG - Intronic
1072276706 10:93830257-93830279 AGGTGCATGGAATAGGTGGATGG + Intergenic
1072347611 10:94524149-94524171 CGGTGGAAGTAAAAAATGGAAGG - Intronic
1072853682 10:98924495-98924517 AAGTGGAGGGAAAAATAGGAAGG + Intronic
1072916013 10:99537622-99537644 AGGAGGAAGAAAAAGAAGGAGGG + Intergenic
1072940646 10:99760607-99760629 AGGAGGATGGAATAGTTTGAGGG - Intergenic
1073348428 10:102801923-102801945 AGGGGGGAGGAAAAGTGGGGAGG - Intronic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073431234 10:103488778-103488800 GGGTGGCTGGACAAGTTGGAGGG - Intergenic
1073592123 10:104767611-104767633 AGGGGGAAGGAAAAGGGGAAGGG - Intronic
1073628988 10:105129048-105129070 AGGAGAAGGGAAAAGGTGGAAGG - Intronic
1073857798 10:107697494-107697516 AGGAGGAAGAAAAAGAAGGAAGG - Intergenic
1073891514 10:108107956-108107978 AGGTGGTAGGAAAAAAAGGAAGG - Intergenic
1073943995 10:108730032-108730054 AGGAGGGAGGAATAGATGGAAGG + Intergenic
1074074919 10:110114212-110114234 AAGCGGAAGTTAAAGTTGGAAGG + Intronic
1074186606 10:111103692-111103714 AGGTGAAAGGGGAAATTGGAAGG + Intergenic
1074217229 10:111397612-111397634 AGGGGAAAGGAAAAGTAGGAGGG + Intergenic
1074514109 10:114149045-114149067 AGTTGGGAGGAAAAGTTAGGGGG + Intronic
1074664952 10:115711504-115711526 AGATGCAAGGCAAAGTTAGAGGG - Intronic
1074827981 10:117228443-117228465 AGGAGGAAGGGAAGGATGGAGGG - Intergenic
1075197669 10:120375179-120375201 ATCTGGAAAGAAGAGTTGGAGGG + Intergenic
1075288439 10:121207452-121207474 AGCTGGAAGGGAAAGATGAATGG - Intergenic
1075728132 10:124621001-124621023 AGGTGGCAGGCAAGGTTTGAGGG + Exonic
1075847602 10:125557540-125557562 ATGTTGAAGGGAAACTTGGAGGG - Intergenic
1076175384 10:128364081-128364103 AGGGAGAAGGAACACTTGGAAGG + Intergenic
1076572428 10:131441370-131441392 AGGAGGAGGGAAAGGATGGAGGG + Intergenic
1076602486 10:131667803-131667825 ATGTGAAAAGCAAAGTTGGAGGG - Intergenic
1077248918 11:1552051-1552073 AGGTGGAGGGATAAATGGGATGG - Intergenic
1077257771 11:1596458-1596480 ACCTGGAGGGAAAAGGTGGAGGG - Intergenic
1078072744 11:8128679-8128701 AGGTGGAAGAAAATAATGGATGG - Intronic
1078108191 11:8371825-8371847 AGGAGGAAGGAAGGGTGGGAGGG - Intergenic
1078121392 11:8513579-8513601 AGGGGGATGAAAAAGTTGCAAGG - Intronic
1078399012 11:11007872-11007894 AGGTGGGAGGAAAAGTGATAGGG - Intergenic
1078943691 11:16038405-16038427 AAATGGATGGAAAAGTAGGAAGG + Intronic
1079164591 11:18027551-18027573 AAGTTCAAGCAAAAGTTGGAAGG - Intronic
1079430503 11:20385121-20385143 GGATGAAGGGAAAAGTTGGATGG + Intergenic
1079571927 11:21953445-21953467 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1079616405 11:22498722-22498744 AGGTTGAAAGAAGACTTGGATGG + Intergenic
1079754847 11:24244428-24244450 AGGTGGAAGGAAGGGAGGGAGGG - Intergenic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1080856628 11:36117197-36117219 ATCTGGAAGGAAAAGGAGGAAGG + Intronic
1081520138 11:43873537-43873559 AGGTGGAAGCAGAGCTTGGAGGG - Intergenic
1081806508 11:45893793-45893815 AGGAGGGAGGAAAAGATGGAGGG - Intronic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1083719168 11:64595644-64595666 GGGTGGAATGAAAGGATGGATGG + Intronic
1083719216 11:64595909-64595931 AGATGGTTGGAAAAGATGGATGG + Intronic
1084230779 11:67751117-67751139 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1084666630 11:70579855-70579877 GGATGGAAGCAGAAGTTGGAGGG + Intronic
1084696511 11:70758770-70758792 AGATGGAGGCAGAAGTTGGAGGG - Intronic
1084857034 11:71996006-71996028 AGGGGGAGGGCAAAGTTGGGAGG + Intronic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1086007061 11:82049136-82049158 AAGAGGAAGGAAGAGTGGGAAGG + Intergenic
1086191756 11:84087699-84087721 TGATGGAAGTAAAGGTTGGATGG + Intronic
1086558648 11:88141706-88141728 AGGCTGAAGGATAAGGTGGAGGG - Intronic
1086723651 11:90153011-90153033 AGTGGGAAGGAAGAGTTGGGAGG - Intronic
1086902878 11:92387412-92387434 AGGGTGAAGGAAAAGGTGGTGGG + Intronic
1087399155 11:97642822-97642844 TGGTGGAAGGAAACTTTGGGAGG + Intergenic
1087549748 11:99634161-99634183 TGGTTGAAGAAAAAGTTGTAAGG + Intronic
1087831419 11:102823348-102823370 AGGTGGAAGGCAAAGTGAGTGGG - Intergenic
1088157003 11:106818574-106818596 AAGTGAAAAGAAAAGTTGCAGGG + Intronic
1088232706 11:107689021-107689043 AAGTGGGAGGAGAAGCTGGAAGG - Intergenic
1088818228 11:113435636-113435658 AGGAGGAAGGGAAAGTGGGGGGG - Intronic
1088824315 11:113481136-113481158 AGGGGGTATGAACAGTTGGATGG - Intergenic
1088840965 11:113627348-113627370 GGATGGAAGGAAAAGGAGGAAGG + Intergenic
1088970080 11:114766269-114766291 AGGTGGAAGGGCAGCTTGGAGGG - Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089747875 11:120629739-120629761 CGCTGGAAGGAAAAGGTGGCTGG - Intronic
1089862514 11:121602604-121602626 AGGAGGAAGGAGAAGAGGGAGGG + Intronic
1089932444 11:122327507-122327529 TGGTGGGAGGAAAAGTTTAAAGG + Intergenic
1090118585 11:124000749-124000771 AGGGGGAAGGAAAAGGGGAAAGG + Intergenic
1091007402 11:131965937-131965959 AGGGGGAAGGAAAGGAGGGAGGG + Intronic
1091173758 11:133541706-133541728 TGGTGGAAGAAAAAGAGGGAAGG + Intergenic
1091406646 12:213563-213585 AGGTGGAAGGAGAAGTGGACAGG - Intronic
1092477032 12:8828327-8828349 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1092998797 12:13976635-13976657 AGGTGAAAGGACAAATTGTATGG - Intronic
1093280057 12:17182697-17182719 AGGCGGAAGGAGAAGTTGAAAGG + Intergenic
1093345434 12:18034861-18034883 AATTGGAAGGACAATTTGGAAGG + Intergenic
1093659437 12:21736964-21736986 GGGAGGAAGGAAAAGAGGGAGGG - Intronic
1093964102 12:25307327-25307349 AGCAGGTAGAAAAAGTTGGAAGG + Intergenic
1093964871 12:25313490-25313512 AGCAGGCAGAAAAAGTTGGAAGG + Intergenic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1094846684 12:34364448-34364470 AGGTGGCAGGAAAGCTTGAAAGG - Intergenic
1094849349 12:34375462-34375484 AGGTGGCAGGAAGGCTTGGAAGG - Intergenic
1094856035 12:34403246-34403268 AGGTGGGAGGAAAGCTTGAAAGG + Intergenic
1094856835 12:34406617-34406639 AGGTGGAAGGAAGGCTTGCAAGG + Intergenic
1094872691 12:34606959-34606981 AGGTGGCAGGAAACCTTGAAAGG + Intergenic
1094872737 12:34607146-34607168 AGGTGGCAGGAAAGCTTGAAAGG + Intergenic
1095119302 12:38396125-38396147 TGGTGCAAAGAAAAGTTGAACGG - Intergenic
1095326482 12:40900385-40900407 AGGTGGTAGCAAAAATAGGAAGG + Intronic
1095587598 12:43865291-43865313 AGTTAGAAGGTAAAGTTAGAAGG - Intronic
1095709748 12:45275744-45275766 AGGGGGAAGGCCAAGTTAGAAGG - Intronic
1096426623 12:51509545-51509567 AGGTGGCAGGAAAAGATGGGAGG - Exonic
1096843031 12:54390754-54390776 GGGTGGAAGGAGAAGATGGTGGG - Intronic
1097968233 12:65603832-65603854 AGGAGGAAGGGAAAGAAGGAAGG + Intergenic
1098385135 12:69910405-69910427 AGGTGGAGGGAGAAGGTGGCAGG + Intronic
1099055631 12:77836316-77836338 AGGTGGCAGACCAAGTTGGAAGG - Intronic
1099750025 12:86761748-86761770 AGATGGAAGCAGAGGTTGGAGGG - Intronic
1100262875 12:92949490-92949512 AGGAGGAAGGAAGAGAGGGAGGG + Intergenic
1100581785 12:95946290-95946312 ATGTTGAAGGAAAAATTGGTGGG + Intronic
1101064734 12:101008175-101008197 AGGTGGTAGGAAAGGAAGGAAGG - Intronic
1101076958 12:101140300-101140322 AGGGGGAAGGAAAGGTGGGTGGG - Intergenic
1101450778 12:104776785-104776807 TGGGGGATGGAGAAGTTGGAAGG - Intergenic
1101621652 12:106394740-106394762 AGATGGCAGGAAAAGATGGAAGG + Intronic
1101654568 12:106708574-106708596 TGGTGGAAGGCAAGGATGGATGG + Intronic
1101661265 12:106767636-106767658 AGGTGGGAAGAAAAGTAGGAAGG - Intronic
1101744460 12:107528048-107528070 GGATGGAAGGAAGAGTAGGAAGG + Intronic
1102046023 12:109830911-109830933 AGCTGGAAGGAGATGTAGGAGGG - Intronic
1102381501 12:112470556-112470578 AGGTGGAGGGAGAAATTGAAGGG + Intronic
1102509919 12:113408230-113408252 AGCTGGAAGGAAAAGAAAGAGGG - Intronic
1102703044 12:114856533-114856555 GGGTAGAGGGAAAAGATGGAAGG + Intergenic
1103859728 12:124002719-124002741 ATGAGGAAGGAACAGTTTGAGGG + Intronic
1104511003 12:129377829-129377851 ACATGGAAGGAAAATATGGATGG - Intronic
1104539572 12:129650917-129650939 GGGTGGATAGAAAAGTTAGAAGG + Intronic
1105479494 13:20760969-20760991 AGGTGGAAGGATACATGGGATGG - Intronic
1105712376 13:23024760-23024782 AGGTGAAAGATAAAATTGGATGG - Intergenic
1105715658 13:23061424-23061446 AGGAGGAAGAAAGAGATGGAGGG + Intergenic
1106184820 13:27400126-27400148 AAGTGGAAGCAAAAGATGGAAGG + Intergenic
1106345304 13:28871301-28871323 AGGGGAAAGAAAAAGCTGGAAGG + Intronic
1106369152 13:29114539-29114561 AACTAGAAGGAAAAGTAGGAGGG + Intronic
1106522027 13:30506498-30506520 AGATGGAAGGAGAAGTGTGAGGG - Intronic
1107083898 13:36405334-36405356 AAAGGGAAGGAAAAGTGGGAAGG - Intergenic
1108106641 13:47017687-47017709 AGATGGAAGGAAAGGTTGGTTGG + Intergenic
1108229857 13:48325368-48325390 TGGAGGAAGGAAAAACTGGAGGG - Intronic
1108415812 13:50197135-50197157 AAGTGGAAGTAAAACTTGAAAGG + Intronic
1109416726 13:62050665-62050687 AGGTAGAAGGGAGAGTTGGGGGG - Intergenic
1111463539 13:88577119-88577141 AAGTGGCAGAAAGAGTTGGAGGG + Intergenic
1111991609 13:95122627-95122649 AGGTGGATGGAAGAGAGGGAAGG - Intronic
1112100251 13:96180851-96180873 GGGAGGAAGGAAAGGATGGATGG - Intronic
1112204101 13:97306886-97306908 AGTTGGGAAGAAAATTTGGATGG + Intronic
1112788092 13:102973734-102973756 AGTTGGAAAGAAAATATGGATGG - Intergenic
1112797396 13:103071305-103071327 AGATGGGAGGAGAAGTTGGGGGG + Intergenic
1113367013 13:109685484-109685506 GGGTGGAAGGAGGAGTGGGAGGG + Intergenic
1113417581 13:110140340-110140362 AGATGGAAGGAACAGATGGAAGG + Intergenic
1114332359 14:21650373-21650395 AGGAGGAAGGCTGAGTTGGAGGG - Intergenic
1114367583 14:22046506-22046528 AGGTGAAAGGAAAAGATTAAGGG - Intergenic
1114538874 14:23440216-23440238 AGGTGGAAGGAAAAAAAGGTAGG + Intergenic
1115180558 14:30621375-30621397 AGGTGGAAGGATAGTTTGGGAGG + Intergenic
1115949993 14:38710192-38710214 AGCAGGCAGGAAAAGATGGAAGG - Intergenic
1116141034 14:40994873-40994895 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1116553371 14:46271099-46271121 AGAAGGAAGGAAGAGTGGGAGGG + Intergenic
1116640754 14:47459459-47459481 AAGGGAAAGGAAAAGATGGAAGG - Intronic
1117784194 14:59265620-59265642 AGGTGAGAAGAAAAGTTGGGGGG + Intronic
1118451563 14:65907127-65907149 AGGGCGAAGGAAAAGAGGGAAGG + Intergenic
1119113081 14:71993918-71993940 AGGGAAAAGGAAGAGTTGGAAGG + Intronic
1119235407 14:73015320-73015342 AGGGGGAAGGAAAGGGGGGAAGG + Intronic
1119310142 14:73639330-73639352 AGGTGGCAGGAAGAGTAGGTGGG - Intergenic
1119996052 14:79254872-79254894 GGGAGGGAGGAAGAGTTGGAGGG - Intronic
1120508702 14:85385698-85385720 AGATGGAATGCAAAGTTGGAGGG - Intergenic
1120515438 14:85464784-85464806 AGGAGGAAGGAATAGTTTCAGGG + Intergenic
1120599441 14:86483328-86483350 AGGTAGAGGAAAAATTTGGAGGG - Intergenic
1120664416 14:87289322-87289344 TGGTGAAAGGAAAAGTGGCAAGG - Intergenic
1120910802 14:89665057-89665079 AGGAGGAAGGGAAAGAAGGAAGG + Intergenic
1120953675 14:90063226-90063248 TGGTGGAAGGAAGACTAGGAAGG + Intronic
1121169536 14:91841955-91841977 AGGTGGAAGGGAAGGATGGATGG - Intronic
1121572873 14:94960752-94960774 TTCTGGAAGGAAAAGTGGGAAGG - Intergenic
1121882595 14:97514362-97514384 GGGAGGAAGGAAGAGGTGGAAGG - Intergenic
1122316873 14:100830873-100830895 AGGTGCAAGGATGACTTGGACGG + Intergenic
1122780978 14:104143463-104143485 AGGAGGAACGAAAAGCTGGCAGG - Intronic
1122780981 14:104143483-104143505 AGGAGGAACGAAAAGCTGGCAGG - Intronic
1122887124 14:104715039-104715061 AGGTTGGAGGAATAGTTGCACGG - Intronic
1123466651 15:20521441-20521463 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1123651463 15:22479600-22479622 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123741881 15:23288461-23288483 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123745115 15:23314097-23314119 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124149068 15:27160547-27160569 AGTTGGAAGGTAAATTTGAAGGG - Intronic
1124267858 15:28253506-28253528 AGGTGAGAGGAGAAGTTGGAGGG - Intronic
1124277386 15:28337417-28337439 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124305316 15:28574189-28574211 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1124382307 15:29177050-29177072 TGGGAGAAGGAAGAGTTGGAGGG + Intronic
1124710792 15:32008390-32008412 AGAAGGAAGGAAAGGATGGAAGG - Intergenic
1125467679 15:39970719-39970741 AAGTGGAAGAAAGAATTGGAAGG + Intronic
1125768569 15:42150669-42150691 ACGTGGAAGGTAAAGGTGGGTGG + Exonic
1125804555 15:42482024-42482046 AAGTTGAAGGAAGAGTGGGAGGG - Intronic
1125886781 15:43235312-43235334 AGGGGGAAGGAGAAGAGGGAAGG + Intronic
1126053263 15:44706975-44706997 AAGGGGAGGGAAAAGTGGGAAGG - Intronic
1126174231 15:45720975-45720997 AGAAGGAGGGAAAAGTTGGCAGG + Intergenic
1126345874 15:47693441-47693463 AGGTGGAAGGAACAATTAGATGG + Intronic
1126440607 15:48683915-48683937 AAGTGGAGGGAAGAGTGGGAAGG + Intergenic
1127155689 15:56122754-56122776 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1127493289 15:59485039-59485061 AAGTGGAGGGAAGAGTGGGAAGG + Intronic
1128218125 15:65948207-65948229 AGGTGGAAAGAACAGTAGGCTGG + Intronic
1128239936 15:66094941-66094963 AGGTGGGGGGAAAAGTGAGAAGG - Intronic
1128280429 15:66389472-66389494 TGGTGGCAGAAAAATTTGGATGG + Intronic
1128716411 15:69911654-69911676 AGGAGAAAGGGAAAGTTTGAAGG + Intergenic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129067147 15:72914789-72914811 AGGCAGAAGGAAGCGTTGGATGG - Intergenic
1129084396 15:73073333-73073355 AGGTTGAGGGACAAGTGGGAAGG + Intronic
1129290970 15:74567310-74567332 AGGTAGAAGAAAAGGCTGGATGG - Intronic
1130000467 15:80042171-80042193 AGGAGGGAGGAAAAGAGGGAAGG - Intergenic
1130716194 15:86337350-86337372 AGTAGGAAGGAAAAGAAGGAAGG + Intronic
1131692937 15:94845873-94845895 AGGTGAAAAAATAAGTTGGAAGG - Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132406513 15:101544483-101544505 AGGAGGAAGGAAAATTGGCATGG + Intergenic
1132750171 16:1453963-1453985 AGATGGCAGGAGAAGCTGGAGGG + Intronic
1134248222 16:12555719-12555741 AGGTGGAAGGAAAAGTGAAAGGG - Intronic
1134571987 16:15298970-15298992 AGGTGGAAGGAAAAGGCCCACGG - Intergenic
1135176482 16:20234181-20234203 GGGGGGAAGGAAAAATTGCATGG - Intergenic
1135317409 16:21461379-21461401 AGATGGATGGAAAAGGTGTAGGG - Intergenic
1135336927 16:21609593-21609615 AGGTGGTGGGAAATGTTGGGGGG + Intronic
1135370307 16:21893191-21893213 AGATGGATGGAAAAGGTGTAGGG - Intergenic
1135441482 16:22477510-22477532 AGATGGATGGAAAAGGTGTAGGG + Intergenic
1135479056 16:22805927-22805949 AGGTGGGAGCAAAAGTTGATTGG + Intergenic
1135652333 16:24217152-24217174 AGAAGGAAGGAAAAGAAGGAAGG + Exonic
1135860164 16:26049239-26049261 AGGCGGAATGAAAAGCTAGAAGG + Intronic
1135922485 16:26663606-26663628 AGAAGGAAGGAAAAATGGGATGG + Intergenic
1135971444 16:27074728-27074750 TGGTGGAATGGAGAGTTGGAAGG - Intergenic
1136071837 16:27792037-27792059 TGGTGGAAGGGAAGGATGGAGGG - Intronic
1136539107 16:30918743-30918765 AGGAGGAAGGAGAAGAAGGAAGG - Intergenic
1136539967 16:30923704-30923726 GGGTGGAAGGAAAGGATAGAGGG - Intronic
1138126171 16:54440487-54440509 AGGAGGGAGGAAGAGTAGGATGG - Intergenic
1138849535 16:60610248-60610270 AGGTGGGAGGAAAAATTAAAGGG + Intergenic
1138862363 16:60774204-60774226 AGATAGGAGGAAAAGTTAGAAGG + Intergenic
1139304884 16:65976767-65976789 AAATGAAAGGAAAAGGTGGAAGG - Intergenic
1139428283 16:66896505-66896527 AGCAAGAAGCAAAAGTTGGAGGG - Intergenic
1139946288 16:70644752-70644774 AGGAGGGAGGAAAAGGAGGAGGG + Intronic
1139946296 16:70644775-70644797 AGGAGGGAGGAAAAGGAGGAGGG + Intronic
1139946301 16:70644798-70644820 AGGAGGAATGAAAAGGAGGAAGG + Intronic
1139992957 16:70954530-70954552 AGGAGGAAGAAAAAGTTTGCTGG - Intronic
1141156478 16:81600907-81600929 AGGAGAAACGAGAAGTTGGATGG - Intronic
1141734636 16:85844149-85844171 GGGAGGAAGGAAAGGTCGGAAGG - Intergenic
1141736764 16:85859384-85859406 AAGTGGAAGGAAAGGATGAAAGG - Intergenic
1142118766 16:88375594-88375616 GGCTGGAAGGAAACGTGGGAAGG - Intergenic
1143359544 17:6357928-6357950 AGGTAGCAAGAAAAGTCGGAGGG + Intergenic
1143997013 17:11015330-11015352 AGGTGGACGGAAAGGTCTGATGG + Intergenic
1145734007 17:27213678-27213700 ACCAGGAATGAAAAGTTGGAGGG - Intergenic
1146456332 17:33012557-33012579 AGGTGGAATGAGAGGTTGGGAGG - Intergenic
1146618086 17:34372561-34372583 AGGTTGAAGGAAAACCAGGAGGG - Intergenic
1147020013 17:37523748-37523770 AGGTGGGGGGAGAAGGTGGATGG + Intronic
1147464319 17:40599040-40599062 AGGAGGAAGGAGAGGGTGGAAGG - Intergenic
1147794589 17:43033451-43033473 AGGGGGAAGGACAGGGTGGATGG + Intergenic
1148474072 17:47915746-47915768 AGGAGGGAGGAAAAAATGGAGGG - Intronic
1149065890 17:52478856-52478878 AGCAGAAAGGAAAAGTAGGAGGG - Intergenic
1149162845 17:53715375-53715397 AGGTGTAAGCAAAAGTTGCTTGG + Intergenic
1149265876 17:54927016-54927038 TGTTGGAAAGAAGAGTTGGAAGG + Intronic
1149543227 17:57484247-57484269 AGGTGGAGGGAGAAGATGCAGGG - Intronic
1149749321 17:59129887-59129909 GGGAGGAAGGAAAAGAGGGAGGG + Intronic
1150271845 17:63871928-63871950 AGGTGGAAAGAAGACCTGGAGGG - Intergenic
1150275394 17:63894829-63894851 AGGTGGAAAGAAGACCTGGAGGG - Intergenic
1151334157 17:73430268-73430290 AGGTGGGAGGAAAAGAGGAAGGG - Intronic
1151419334 17:73987050-73987072 AGGAGCAATGGAAAGTTGGAAGG + Intergenic
1151448275 17:74181462-74181484 AGGTAGAAGGAAAAGCTGCAGGG - Intergenic
1151565030 17:74893087-74893109 TGGTGGAAGGGAAAGTTGAGAGG - Intronic
1151922446 17:77167585-77167607 AGGTGGAAGGAGAAGGTATATGG - Intronic
1152110973 17:78357715-78357737 AGGGGGAAGCAACATTTGGAGGG - Exonic
1152256829 17:79244821-79244843 AGAAGGAAGGAAAAGAAGGAAGG - Intronic
1153486341 18:5602604-5602626 AGGGGAAAGAAAAAGTTAGACGG - Intronic
1153635781 18:7112226-7112248 ACTTGGAAGGACAAGTTGCAAGG + Intronic
1153647206 18:7205938-7205960 AGGTGGAAGGAAGGGAGGGAGGG - Intergenic
1154426386 18:14275303-14275325 GGGTGGAAGGAAAAGGGGGTGGG + Intergenic
1155010566 18:21773751-21773773 AGGTGAAAGAAAATGTTGGATGG + Intronic
1155406443 18:25493151-25493173 AAGTGAAAGGAAGAGTTGCATGG + Intergenic
1156294631 18:35778386-35778408 AGGGGGAAAAAAGAGTTGGAAGG - Intergenic
1156352677 18:36314536-36314558 AGGTGGTAGGAACAATGGGAGGG + Intronic
1156583552 18:38407450-38407472 GGTTGAAAGGAAAAGTTGAAAGG + Intergenic
1158669070 18:59458237-59458259 AAGAGGAAGGAAAGGTTGGATGG - Intronic
1159482781 18:69012151-69012173 TGGTGGAAGAGTAAGTTGGAAGG + Intronic
1160847730 19:1173849-1173871 AGCGGGAAGGAAAGGTTGGGAGG + Intronic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1161729351 19:5949652-5949674 AGGTGGAAGGTGAAGCTGTATGG - Intronic
1161960117 19:7518505-7518527 AGAAGGAAGGAAAAGAAGGAAGG + Intronic
1162391172 19:10391068-10391090 AGGTGGGAGGGAAACTTGGTGGG - Intergenic
1162740993 19:12773624-12773646 AGGTGAGAGGTAAAGATGGATGG - Intronic
1163088529 19:15001522-15001544 AGATGGAAGGAAAGGTGGGATGG + Intronic
1163323926 19:16591135-16591157 AGGTCCTAGGAAAAGTAGGAGGG + Intronic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1164441987 19:28285419-28285441 ATGGGGAAGAAAAGGTTGGAGGG + Intergenic
1165084907 19:33337753-33337775 AGGTGGATTGAAAAGCTGAATGG + Intergenic
1165416035 19:35694098-35694120 AGGAGGAAGGAAGAGGAGGAGGG - Intergenic
1165881311 19:39045947-39045969 AGGTGGTAGGAAGAGGGGGAGGG + Intergenic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166001749 19:39881613-39881635 AGGAGGAAGGAGACGTTTGAAGG - Intronic
1166004531 19:39897864-39897886 AGGAGGAAGGAGACGTTTGAAGG - Intronic
1166061476 19:40328374-40328396 AGGTGGTAGGAGGAGCTGGAGGG - Intronic
1166147211 19:40845942-40845964 AGGTGGAGGGTAAGGCTGGAGGG - Exonic
1166151368 19:40877838-40877860 AGGTGGAGGGTAAGGCTGGAGGG - Exonic
1166155857 19:40910532-40910554 AGGTGGAGGGTAAGGCTGGAGGG - Intergenic
1166182103 19:41116384-41116406 TGGTGGAAGGATAAGGAGGAGGG + Intronic
1166975409 19:46602429-46602451 AGGTGGAAGGAGAAAATGAATGG + Intronic
1167076666 19:47254332-47254354 TGCTGGGAGGAAAAGTTGGTGGG - Intergenic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1168543452 19:57231448-57231470 AGGTGAAAGAAAGAATTGGAGGG - Intronic
1168711382 19:58502073-58502095 AGGTGGATGGATATGGTGGATGG + Intronic
925183008 2:1829244-1829266 AGGTGTATGGGAAGGTTGGAAGG - Intronic
926195470 2:10761220-10761242 AGGTGGAGGGAAGAGATGGATGG + Intronic
926516326 2:13851064-13851086 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
927023672 2:19043429-19043451 AGGCTGAAAGAGAAGTTGGAGGG - Intergenic
927321725 2:21755119-21755141 AGGTAGAAGGAAAAGTTGCTGGG + Intergenic
927582630 2:24267510-24267532 AGGTAGAAAGGAAAGTAGGAAGG - Intronic
927734314 2:25504604-25504626 GGAAGGAAGGAAAAGATGGAAGG + Intronic
927826858 2:26315387-26315409 AGGTGGAAAGAAAAGAAGGAAGG + Intronic
928157903 2:28893742-28893764 AGGTAGAACGAAAGGTTTGAAGG - Intergenic
928293605 2:30061553-30061575 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
928410250 2:31048948-31048970 AGGTGGAACTGAAGGTTGGAGGG - Intronic
928921710 2:36534254-36534276 AGGAGGAAAGAAAGGATGGAGGG + Intronic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929732607 2:44511737-44511759 AGGAGGAGGGAACAGCTGGAGGG - Intronic
929742070 2:44613009-44613031 TGGTGAAAGGAAAAGATGAATGG + Intronic
929785818 2:44990331-44990353 AGGTAGCAGGAAATATTGGAAGG + Intergenic
930262989 2:49169190-49169212 ATTTGGAAGGGAGAGTTGGATGG - Intergenic
930763176 2:55058143-55058165 AAGGAGAGGGAAAAGTTGGAGGG + Intronic
930779998 2:55215376-55215398 AGATGGAAGGCAGAGTGGGAAGG - Intronic
930970255 2:57386225-57386247 AAGAGGAAGGAGTAGTTGGAAGG + Intergenic
931084059 2:58809265-58809287 AGGTGGAAGGGAAACTTTTAAGG + Intergenic
931264628 2:60649802-60649824 GGGAGGAAGGGAGAGTTGGAGGG + Intergenic
931334343 2:61323585-61323607 AGGTGGGAGGATCACTTGGAGGG + Intronic
931863752 2:66387385-66387407 AGCTGGAAGGAAGAGGTCGATGG - Intergenic
931978101 2:67665691-67665713 AGGAGTGAGGTAAAGTTGGAAGG - Intergenic
931981719 2:67700179-67700201 CAGTGGAAGAAAAAGCTGGAAGG + Intergenic
932680105 2:73817537-73817559 AGAAGGAACTAAAAGTTGGATGG + Intergenic
933315809 2:80713646-80713668 AAGTGATAAGAAAAGTTGGAGGG + Intergenic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933912648 2:86956882-86956904 AGGTGGAAGAATAAGAAGGATGG + Intronic
934010346 2:87813008-87813030 AGGTGGAAGAATAAGAAGGATGG - Intronic
934053643 2:88233031-88233053 AAGTGGAAGAGAAAATTGGAAGG + Intergenic
934745338 2:96756130-96756152 AGGTGGAAGGAAAAGCTTCCTGG + Intergenic
935548818 2:104430303-104430325 AGGTGAAAGGAAATGTTGGAGGG - Intergenic
935773914 2:106453728-106453750 AGGTGGAAGAATAAGAAGGATGG - Intronic
935785156 2:106542016-106542038 TGGAAGAAGGAAAAGTTGGCTGG - Intergenic
935836579 2:107061769-107061791 AGAGGGAGGGAAAAGGTGGAAGG - Intergenic
935906149 2:107842185-107842207 AGGTGGAAGAATAAGAAGGATGG + Intronic
936497963 2:113039045-113039067 AGAAGGAAGGAAAAGTAGGTTGG + Intronic
936981475 2:118269174-118269196 AGGTGGACGGGAGAGATGGAGGG + Intergenic
937327856 2:121002789-121002811 AGGAGGAAGGAAAAATTTGAGGG + Intergenic
937399409 2:121568884-121568906 AGGTGGCAGGAATAGTTTGGAGG + Intronic
937628390 2:124069262-124069284 AGGGGGAAGGAAGAGCAGGAAGG + Intronic
938256944 2:129866620-129866642 AGGTGGGAGGATAGCTTGGAAGG - Intergenic
939312152 2:140494678-140494700 TGGTGGAATGAAAAATTGAAAGG + Intronic
939405006 2:141745402-141745424 AGGGGGAGGGAAGAGTAGGAAGG - Intronic
939833092 2:147096019-147096041 AGGTGGAAGGAGAAACTGCAGGG - Intergenic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
940600773 2:155857049-155857071 AGGTGGAAGGAATATTCAGAAGG - Intergenic
941201415 2:162515887-162515909 AGGTGAAAGGAAGAGTTGGCAGG - Intronic
941866774 2:170343563-170343585 ATGGGGAAGGAACAGTGGGAAGG + Intronic
943098583 2:183458692-183458714 AGGTGTTAGGAAAAGCTGGGTGG + Intergenic
943226729 2:185187750-185187772 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
943334770 2:186600269-186600291 AAGTGGAATGAAGAGATGGAGGG - Intronic
944654635 2:201865353-201865375 TGGTGGATGGAGAAGGTGGAGGG - Intronic
945281461 2:208039423-208039445 ATGTGGAAGAAAAAGATTGAGGG - Intergenic
946025236 2:216667961-216667983 AGGGTGAAGGCAGAGTTGGAAGG + Intergenic
946367111 2:219255157-219255179 AGGTGGAAGGATGAGGTAGAAGG - Intronic
946553071 2:220823798-220823820 AGGAGGAAGGAAAGGAGGGAGGG - Intergenic
946734767 2:222743297-222743319 AGGTGGAGGGAGAAAGTGGAAGG - Intergenic
946781152 2:223193994-223194016 AGGTGGGAGGGAAAGAAGGAAGG + Intronic
948458457 2:238118093-238118115 GGGTGGATGGAGGAGTTGGATGG + Intronic
948458804 2:238119393-238119415 AGGTGGATGGAGGAGGTGGATGG + Intronic
948458829 2:238119481-238119503 AGGTGGATGGAGGAGGTGGATGG + Intronic
948458858 2:238119575-238119597 AGGTGGATGGAGGAGGTGGATGG + Intronic
1168856127 20:1010391-1010413 AGGAGGAAGAAAAACTAGGATGG + Intergenic
1169454634 20:5741473-5741495 AGGTCTAAGGAAAAGAAGGAGGG - Intergenic
1169483895 20:6010107-6010129 AGGAGGAAGCGAAAGTTGTAGGG + Intronic
1169764216 20:9131303-9131325 AGGAGGGAGGAAAAGAAGGAAGG - Intronic
1170038687 20:12017594-12017616 AGGTAGAAGGAAATGGTTGATGG + Intergenic
1170349364 20:15422094-15422116 AGGAGCAAGGAAAAAGTGGAAGG + Intronic
1170440395 20:16373727-16373749 GGGCGGAATGAAAAGTTGCAGGG - Intronic
1170561606 20:17563369-17563391 GGGAGGAAGGAAAGGTAGGAAGG - Intronic
1170624624 20:18021786-18021808 AGGTGGAAGGAAAGGAGGGAGGG + Intronic
1170662101 20:18352140-18352162 ATCTGGAAGGAAAGGATGGAGGG - Intergenic
1172243883 20:33432421-33432443 AGGTGAAAGGTAAAGTAGAAAGG + Intronic
1172422999 20:34833660-34833682 AAGTCGAAAGGAAAGTTGGACGG - Intergenic
1172578298 20:36026570-36026592 AGGTGGCAGGAGATGCTGGAGGG - Intronic
1173010868 20:39180866-39180888 AGGTGGAAGGAAACTTTAGGAGG + Intergenic
1173235132 20:41238425-41238447 AGAAGGAAGGAAAAGAAGGAGGG + Intronic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173513704 20:43650034-43650056 AGGTGGGAGGAAAGGGGGGAGGG + Intergenic
1173648614 20:44649337-44649359 AGCTGGCAGGAGAAGTGGGAAGG - Intronic
1174106415 20:48165474-48165496 GGGTGGGAGGAAGAGTTGGAAGG + Intergenic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174529433 20:51199309-51199331 AGGAGGAAGGACAAGGTTGAGGG - Intergenic
1174545733 20:51323761-51323783 TGGCGGAAGGAGAGGTTGGAAGG + Intergenic
1174707047 20:52667671-52667693 AGGGGGAATGAGAAGGTGGAGGG - Intergenic
1175676486 20:60950453-60950475 AGGTGGAGGGAATAGATTGATGG + Intergenic
1175775707 20:61652254-61652276 GGGTGGAAGGAACTGTTCGAAGG - Intronic
1177046991 21:16183157-16183179 AAGTGGAAGGTAAAAGTGGAAGG - Intergenic
1177212900 21:18091873-18091895 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
1177761422 21:25406682-25406704 AAGGGGAGGGAAAAGTGGGAAGG - Intergenic
1178007297 21:28235443-28235465 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1178170953 21:30039475-30039497 AGCAGGAAGGAAAAGAGGGAGGG - Intergenic
1178446413 21:32647593-32647615 AGATGGAGGTAAAAGTTAGAGGG - Intronic
1179137823 21:38696182-38696204 AGGAGGAAGGAAGAGATGCACGG + Intergenic
1179267378 21:39816363-39816385 AGGTGGAAGGAAAAGAGAGAAGG + Intergenic
1179291218 21:40019932-40019954 AGGAGGAAGGGAAAGAAGGAGGG - Intronic
1179572994 21:42288908-42288930 TGGTGGAAGGCAAAGTGGGATGG + Intronic
1180606824 22:17065209-17065231 AGGTGGAATGGAAAGATAGAAGG + Intergenic
1181497916 22:23298392-23298414 AGCTGGAATAAAAAGCTGGAGGG + Intronic
1181620064 22:24084978-24085000 AGGTGAGAGGAAAAGTATGAGGG - Intronic
1182031619 22:27163446-27163468 AGGATGAAAGAAAAGCTGGATGG + Intergenic
1182086077 22:27562138-27562160 ACGTAGAAAGAAAAGTTGGCTGG + Intergenic
1182324141 22:29499094-29499116 ACTTGGAAGGAAGAGTGGGAGGG - Intergenic
1182514322 22:30844872-30844894 AGGTGAAAGAAAGAGTTGCATGG - Intronic
1182654502 22:31879300-31879322 GGGTGGGAGGAGGAGTTGGAAGG - Intronic
1182728292 22:32466557-32466579 TGCTGAAAGGAAAAGGTGGAGGG + Intergenic
1183415816 22:37681272-37681294 AGCAGGAAGGAAAAGGTGCAGGG - Intergenic
1183463500 22:37967332-37967354 AGGAGGCAGGGAAAGTGGGAGGG + Intronic
1184047371 22:41979781-41979803 CGGTGGAAGGACCAGGTGGAGGG + Intronic
1184092023 22:42297843-42297865 GGGTGGAAGGAACACATGGAGGG + Intronic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184920821 22:47604594-47604616 AGCTGGAAGGAAGGTTTGGAGGG + Intergenic
949517563 3:4821157-4821179 AGATGGAAGGAAAAGCAGGCTGG + Intronic
949590386 3:5487976-5487998 AGGTGGAAGATAAATTTGAATGG + Intergenic
949898705 3:8792289-8792311 AGGTGGAAGGTGAAGAAGGAGGG - Intronic
950622707 3:14218750-14218772 AGGAGGAAGGAAAGGAAGGAAGG - Intergenic
951005150 3:17607371-17607393 AGTTGGAAGTAAAAGCTGGAGGG - Intronic
951053921 3:18125625-18125647 ATGTGTAACGAAAAGTTGGCAGG + Intronic
951102374 3:18703673-18703695 AAGTGGAGGGAAGAGTGGGAAGG + Intergenic
951494987 3:23316336-23316358 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
951808107 3:26669213-26669235 AGGTGAAAGCAAAAATTCGATGG + Intronic
952145335 3:30525989-30526011 AGGAGGAAGGAAAGGAGGGAAGG - Intergenic
952241201 3:31532886-31532908 AGGAGGAAGAAAAAGGAGGAGGG - Exonic
952241753 3:31537599-31537621 AGGGGGAAGGAAAAGTCCCAAGG - Intronic
952474982 3:33699290-33699312 AGGTAGAAGAAATATTTGGAGGG + Intronic
952979140 3:38721077-38721099 AGGTGGGAGGAAAACTAGGGTGG - Intronic
953101068 3:39828628-39828650 ACTTGGGAGGAAGAGTTGGAGGG - Intronic
953217282 3:40931105-40931127 AAGGGGAAGGAAAAGTGGAAAGG + Intergenic
953867025 3:46593126-46593148 GGGAGGTAGGAAAAGTAGGAGGG - Intronic
954163456 3:48738480-48738502 AGCTGGAAGGAAAACCAGGAGGG + Intronic
954411818 3:50374251-50374273 AGGGGGAAGGAAAAGGGGAAAGG + Intronic
954753220 3:52825175-52825197 AAATAGAAGGAAAAGTTGCAGGG - Intronic
955051318 3:55413972-55413994 AGGTGGATGGCAAGGGTGGATGG + Intergenic
955274306 3:57533057-57533079 AAGGGGAGGGAAAAGTAGGAAGG - Intronic
955922291 3:63970171-63970193 AGGTGGCATAAACAGTTGGATGG + Intronic
955924034 3:63988335-63988357 AGGTGGGAGAAAGAGTTGGAGGG - Intronic
956953074 3:74304627-74304649 AGGAGTAAGGAAAAGTTTGGTGG + Intronic
957404720 3:79762842-79762864 AAGTGGAAGTAAGAATTGGAGGG + Intronic
957935945 3:86942781-86942803 AGGTAGAAGGAACAGTTAGTAGG + Exonic
958111983 3:89159940-89159962 AGGAAGAAGGAAAAGAAGGAAGG - Intronic
958117156 3:89234947-89234969 AGGAGGAAGGGAAAGAGGGAGGG - Intronic
958613831 3:96464035-96464057 AGGGTGAAGGAAACTTTGGATGG + Intergenic
958656930 3:97014409-97014431 AGGTGGGAGGGAAAGAAGGAAGG - Intronic
958744687 3:98118628-98118650 AGATAGAAAGAAAAGTTTGAGGG + Intergenic
958991393 3:100849798-100849820 AAGTTGAAAGAAGAGTTGGAAGG + Intronic
959102051 3:102021975-102021997 AGCTGGAAGGGCTAGTTGGAGGG - Intergenic
959215562 3:103446938-103446960 AGGCGGAAGGAAAGCTTAGATGG - Intergenic
959682983 3:109117091-109117113 AGGTGGAACAAAAAGTTAAAAGG - Intronic
959798072 3:110456863-110456885 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
960141531 3:114155919-114155941 AGGCGGAAGGGGAAGTGGGAGGG - Intronic
960153473 3:114274720-114274742 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
960176229 3:114520824-114520846 AGGAGGAAGAGAAAGTTTGAAGG - Intronic
960747224 3:120903481-120903503 AGCTGGAAGGAGAATTTGGATGG - Intergenic
961696375 3:128708079-128708101 CAGAGGAAGAAAAAGTTGGAGGG + Intergenic
961930297 3:130526162-130526184 AGGTGGGAGGTAATTTTGGATGG + Intergenic
961939271 3:130620526-130620548 TGGTGGAAGTGAAAGTTAGAAGG + Intronic
962023104 3:131520633-131520655 AGGAGGAAGAAAGAGATGGAAGG - Intergenic
963025878 3:140918094-140918116 AGGTGTAAGGCAAGGGTGGAGGG + Intergenic
963094966 3:141526412-141526434 AGGTGGAAGGATAAATGAGAAGG - Intronic
963396726 3:144743904-144743926 TGGAAGAAGGAAATGTTGGACGG - Intergenic
963644297 3:147894764-147894786 AGGTGGAAGGATCGCTTGGAAGG + Intergenic
963794368 3:149616900-149616922 AAGTGGAAGAAAAAGTAAGAAGG + Intronic
963822933 3:149919375-149919397 AGGATGAAGGAAAAGTTGGAAGG - Intronic
963873096 3:150441386-150441408 AGGTAGAAGGAAAAACAGGAGGG - Intronic
964219708 3:154329189-154329211 AAGTAGAATGAAAAGGTGGAAGG + Intergenic
964368394 3:155973162-155973184 AGAGGGAAGGAAAAAGTGGACGG - Intergenic
964379466 3:156083369-156083391 ACTTGGAAGGAAAAGATGGTGGG - Intronic
964414964 3:156437837-156437859 AGGATGAAGAAAAATTTGGAAGG - Intronic
964421096 3:156503664-156503686 AGGTGAAAGATAAAGGTGGAGGG + Intronic
965441422 3:168719999-168720021 GGGTGGGAGTAAAAGTTGGGAGG - Intergenic
965448314 3:168804181-168804203 AGAAGGAAGGAAAAGAGGGAGGG - Intergenic
965727968 3:171739534-171739556 AAGTGGGAGGGAAAGTTGAAGGG - Intronic
965783520 3:172313024-172313046 AAGTGAGAGGAAAAGCTGGAAGG - Intronic
965891250 3:173516515-173516537 AGGTGGAAGGAAAAGTTGGAAGG - Intronic
966375234 3:179290092-179290114 GGGTGGAAGGAAACTTTGGAAGG - Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966463552 3:180203748-180203770 AAGGGGAAGGAAGAGTGGGAGGG + Intergenic
966846790 3:184136743-184136765 ACATGGAAAGAAAAGTTGCAGGG - Intronic
967118794 3:186364519-186364541 ATGTGGAAGGCAAAGAGGGATGG + Intergenic
967174572 3:186851636-186851658 AGGAGGAAGGAAAAGAAGAAAGG - Intronic
967274541 3:187761006-187761028 TGGTGGAAGATAAAGTTGGAGGG + Intergenic
968481142 4:833562-833584 AGGAGGAAGGAAGAGGGGGAAGG + Intergenic
968991632 4:3917301-3917323 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
969844224 4:9907397-9907419 TGGTGGAGGGGAAAGTTGGGTGG - Intronic
970156645 4:13149025-13149047 TGGTGGAAGGAAGAGTGGGGAGG - Intergenic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
970781183 4:19739963-19739985 AGATGGAAGGAAATTTTGGAAGG - Intergenic
971163481 4:24158044-24158066 GGGGGGAAGGAAAAGTGGGGAGG - Intergenic
971573076 4:28238312-28238334 AGGAGGAAAGAAAAGAAGGAAGG - Intergenic
971935601 4:33143465-33143487 AGCAGGCAGGAAAATTTGGAAGG - Intergenic
972556862 4:40190054-40190076 AGGGGGATAGAAAACTTGGAGGG - Intergenic
973084071 4:46032487-46032509 GGGTGGAGGGAAGATTTGGAAGG - Intergenic
973117700 4:46481827-46481849 AGGTGGAAGGAATAGTTAAGTGG - Intergenic
973647680 4:52966446-52966468 ATGTGGAAGGTAATGTGGGAAGG - Intronic
974414911 4:61594895-61594917 AAGAGGAAGGAAGAGTGGGAAGG - Intronic
975375896 4:73645703-73645725 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
975502211 4:75099743-75099765 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
976982126 4:91244186-91244208 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
977091548 4:92682765-92682787 TGGTGGAATGAAAACTTGGAAGG + Intronic
977627145 4:99199906-99199928 TGGTAGAAGGCAAAGTGGGAGGG + Intergenic
978125015 4:105125130-105125152 AGCTGCATGGAAAAGTTGCAAGG + Intergenic
978277318 4:106967724-106967746 AGGAGGAAGGAACAGAGGGAGGG + Intronic
978660016 4:111114688-111114710 AGAAGGAAGGAAAAGAGGGAGGG - Intergenic
979211027 4:118103340-118103362 AAGTGGAAGGAAAGATAGGAAGG + Intronic
979550764 4:121988548-121988570 AAAAGGAAGGAAAGGTTGGAGGG + Intergenic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
980102105 4:128552060-128552082 AGGTGTAAGTAAATGTAGGATGG - Intergenic
980398240 4:132244126-132244148 AGATGAAAAGAAATGTTGGAAGG + Intergenic
980451435 4:132977816-132977838 AGATGGCAGGAAAATATGGAAGG - Intergenic
980681270 4:136165056-136165078 ATATGGAAGAAAAAGATGGATGG + Intergenic
980838271 4:138224785-138224807 AGGAAGAAGGAAAAGAAGGAAGG + Intronic
981032095 4:140135906-140135928 AGGTTGAAGGAGAAGGGGGAGGG - Intronic
981530744 4:145751862-145751884 AAGGGAAAGGAAAAGTGGGAAGG - Intronic
982160852 4:152568066-152568088 GCGTGGAAGGAAAAGAGGGAGGG - Intergenic
982174143 4:152689604-152689626 AGTTGGAGGGGAAAGATGGAAGG + Intronic
983083094 4:163412106-163412128 AGAAGGAAGGTAAAGGTGGAGGG + Intergenic
983401738 4:167274921-167274943 GGGTGGGAGGGAAAGTTGGCAGG - Intergenic
983913834 4:173269345-173269367 AGGTGGAAGATAAAGTGGGGAGG - Intronic
983915538 4:173287557-173287579 AGATGGAGGGAAAGGCTGGAGGG + Intronic
984389724 4:179113622-179113644 AGATGGAAAGAAAAGTGGGATGG - Intergenic
984445766 4:179833619-179833641 AGTTGGTAAGAAAAGATGGAAGG - Intergenic
984460840 4:180034661-180034683 GGGAGGGAGGAAAGGTTGGAAGG + Intergenic
984460848 4:180034686-180034708 GGGAGGGAGGAAATGTTGGAAGG + Intergenic
984961045 4:185099288-185099310 AGTTGGAAGGAACACTGGGAAGG - Intergenic
985081862 4:186274014-186274036 AGGTGGGTGAAAAAGTTGAAAGG + Intronic
985086485 4:186318205-186318227 AGGTGGAAGGAAAGGATGGATGG + Intergenic
987314088 5:16708149-16708171 AGTTGGGAGTAGAAGTTGGATGG - Intronic
987382526 5:17298926-17298948 AAGTGGAAAGAGAAATTGGAAGG + Intergenic
987911752 5:24155501-24155523 AAGTGGAAGGAAAAGTGGGAAGG + Intronic
988884931 5:35546451-35546473 GGGTGGAAGGAACAGGTGAAAGG - Intergenic
989127940 5:38075045-38075067 ATGTGCAAGGAAAAGCAGGAAGG + Intergenic
989496342 5:42114440-42114462 AATTGGAAGGACAATTTGGAAGG + Intergenic
989525274 5:42446445-42446467 AGGTGAAGGGAAAAGTAGGCAGG + Intronic
989629027 5:43461709-43461731 AAGGGGAGGGAAAAGTGGGAAGG + Intronic
990372767 5:55137314-55137336 AGCTGGTAGGAAACTTTGGATGG - Intronic
991008986 5:61861956-61861978 CTGTGGCAGGAAGAGTTGGAAGG - Intergenic
991500405 5:67270559-67270581 GGGTGGAAGAAAATGCTGGATGG + Intergenic
991663692 5:68974855-68974877 AAGGGGAGGGAAAAGTGGGAAGG + Intergenic
992692660 5:79256152-79256174 AAGGGGAGGGAAAAGTGGGAAGG - Intronic
992865877 5:80956813-80956835 GGGAGGAAGGAAAGGTGGGAGGG - Intergenic
992869572 5:80992807-80992829 AGGTGGAAAGAAAAGAAGCAGGG + Intronic
992940661 5:81758130-81758152 AGGTAGAAGGAAGAGAGGGAAGG + Intergenic
993441954 5:87968079-87968101 AGTTGGGATGAAGAGTTGGAAGG - Intergenic
993710235 5:91217068-91217090 AGGTGGAAGGAAAGGTGGAAGGG + Intergenic
993981319 5:94546139-94546161 AAGGGGAAGGAACAGTGGGAAGG + Intronic
994203510 5:97005963-97005985 AGATGGTAGGAAAAGAGGGAAGG + Intronic
994282539 5:97922561-97922583 AGAGGGAAAGAACAGTTGGAGGG + Intergenic
994326814 5:98457241-98457263 AGTAGGAAGGAAAAGGTAGAGGG - Intergenic
994658224 5:102620866-102620888 AAGTGGTAGGAAAGGATGGAGGG - Intergenic
995135410 5:108674871-108674893 AGAAGGAAGGAAGGGTTGGATGG - Intergenic
995176942 5:109189012-109189034 AGGTGGAAGTAGAAATGGGAGGG - Exonic
995652447 5:114385181-114385203 AGATGGAAGGAAATGAAGGAAGG - Intronic
995881402 5:116848232-116848254 AGGTTGAAGGAGAGGCTGGAAGG - Intergenic
996221629 5:120939552-120939574 AAGTGGAAGCAAAACTTGAAGGG + Intergenic
997291866 5:132742913-132742935 GGGTGGAAGGGAAAGAGGGAGGG - Intergenic
998288869 5:140892897-140892919 AGGGTGAAGGAAAAGGAGGATGG - Intronic
998382545 5:141735966-141735988 AGGAGGAAAGGGAAGTTGGAGGG - Intergenic
998678895 5:144442531-144442553 AGAAGGAAGGAAAAGTTGGAAGG - Intronic
998699381 5:144680349-144680371 AGGGGGAAGGAAATGAAGGATGG + Intergenic
998723357 5:144979231-144979253 ATGTGGAAATAAAAGTTGGTTGG - Intergenic
999118171 5:149183350-149183372 AGCTGGAAGAAAAAGTGGAAGGG - Intronic
999286746 5:150398724-150398746 AGGTGAAAGGAAACGTTGCCTGG + Intronic
999664910 5:153902714-153902736 AGGTGGAAGGAACAATTTTAGGG - Intergenic
999801190 5:155038695-155038717 AAGTGAAAGGAAGAGTTGCATGG - Intergenic
999863329 5:155672820-155672842 TGGGGGAAGGAAAGATTGGAGGG + Intergenic
1000331218 5:160207081-160207103 AGGTAGAAGGAAAAGTGCAAAGG + Intronic
1000651267 5:163821856-163821878 AAGGGGAGGGAAGAGTTGGAAGG - Intergenic
1000668018 5:164023053-164023075 AGGTAGTAAGAAAAGTTGAATGG + Intergenic
1000993265 5:167933022-167933044 AGGTGGAATATAAAATTGGAAGG - Intronic
1001201358 5:169720477-169720499 AAATGGAAGGAAAAAATGGAAGG - Intronic
1001241953 5:170077924-170077946 AGGAGGAAGGGAAAGGTAGAAGG - Intronic
1002136655 5:177111992-177112014 AGGTAGAAGGAAGAGTTGGAGGG + Intergenic
1003683224 6:8276199-8276221 AGGTGGAAGGCAGGGATGGAGGG + Intergenic
1004554637 6:16683807-16683829 AGGAAGAAGGGAAAGTTGCAGGG - Intronic
1005386064 6:25285619-25285641 AGGTGGAAAGAATATTTTGATGG + Intronic
1005715648 6:28544565-28544587 AGTTGGAGGGGGAAGTTGGAGGG + Intergenic
1005774065 6:29110071-29110093 AGAAGGAAGGAAAAGTGGGAGGG - Intergenic
1006173015 6:32106252-32106274 AGGTGGGAGGAAAGGTGGTAGGG + Intronic
1006562980 6:34929783-34929805 AGGAGGAAGGAAAAGGGGAAGGG - Intronic
1007377464 6:41466632-41466654 AGGATGAAGGAAAAGGGGGAAGG + Intergenic
1007641891 6:43347558-43347580 TGGAGAAAGAAAAAGTTGGAAGG + Intronic
1007746127 6:44043926-44043948 AGGTGGGAAGAAAAGTTGGCTGG + Intergenic
1007806658 6:44455378-44455400 TGGTGGAAGAAAAAGGAGGATGG + Intergenic
1007917254 6:45573037-45573059 AGAAGGAAGGAAGAGTTGGGTGG - Intronic
1008008158 6:46434441-46434463 ATGAGGAAGGAATATTTGGAGGG + Intronic
1008863181 6:56176615-56176637 AAGAGGAAGGAAAAGAGGGAGGG + Intronic
1009450276 6:63791960-63791982 ATTTGGAAGGAAAATTTGAAAGG + Intronic
1009555170 6:65154312-65154334 AGGAGCAAAGAAAAGGTGGAAGG + Intronic
1009780393 6:68261263-68261285 AAGTGGTTGGGAAAGTTGGAGGG - Intergenic
1010328121 6:74588348-74588370 AAGTTGAGGGAAAAGTGGGAAGG + Intergenic
1010514236 6:76753596-76753618 AGGGAGAAGGAAGAGTGGGAAGG + Intergenic
1011222225 6:85066893-85066915 AGGAGGAAGGAAAGGAGGGAAGG + Intergenic
1011258435 6:85448121-85448143 CAGTGGAAGGTAAAGTTGGCTGG + Intergenic
1011638114 6:89393655-89393677 ATGTTCAAGGAAATGTTGGAGGG - Intronic
1011645994 6:89458634-89458656 AGCTGGCAGGAGAAGATGGAAGG - Intronic
1011799115 6:90991058-90991080 AGGTAGAAGGTAAACTTGGCTGG + Intergenic
1012049983 6:94328971-94328993 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1012422287 6:99078500-99078522 GGGAGGGAGGAAAAGATGGAAGG + Intergenic
1012620499 6:101339125-101339147 AAGGGGAAGGAATAGTGGGAAGG - Intergenic
1013768306 6:113598403-113598425 ACGTGGAAGGTAGAGTGGGATGG - Intergenic
1014537115 6:122627539-122627561 AATTGGCAAGAAAAGTTGGAAGG - Intronic
1014991439 6:128083639-128083661 AGAAGAAAGGAAAAGTTAGAGGG - Intronic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1015113392 6:129619346-129619368 AGGGGGAGGGAAAAGGGGGAGGG + Intronic
1015113398 6:129619359-129619381 AGGGGGAGGGAAAAGGGGGAGGG + Intronic
1015886809 6:137926162-137926184 AGCTGGAGGGAAAAGGGGGATGG + Intergenic
1015959503 6:138632143-138632165 AAGGGGAGGGAAAAGTGGGAAGG + Intronic
1016201503 6:141415898-141415920 AGGTGGGAGGATGAGGTGGAAGG - Intergenic
1016357980 6:143238457-143238479 AGATAAAAGGAAAAGTTGGCTGG - Intronic
1016758322 6:147711047-147711069 AGAAGGAAGGAAAAGAAGGAAGG + Intronic
1018088698 6:160327169-160327191 AAATGGGAGGAAAAGATGGAGGG - Intergenic
1018492357 6:164307063-164307085 AGTGGGAAGGAAAGGTGGGATGG + Intergenic
1018657927 6:166057750-166057772 AAGTGGAAGGAGAAATTGAAAGG - Intergenic
1019159077 6:170057617-170057639 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019159101 6:170057664-170057686 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019160917 6:170066459-170066481 AGATGGAAGGATAGGGTGGATGG - Intergenic
1019730599 7:2627451-2627473 GGGAGGGAGGAAAAGATGGAGGG + Intergenic
1019730605 7:2627471-2627493 GGGAGGGAGGAAAAGATGGAGGG + Intergenic
1019920015 7:4157452-4157474 AGGTGGAAGGGAGAGAAGGAAGG + Intronic
1019951007 7:4372697-4372719 AGGTGAAAGGAAAGGTTGGGAGG + Intergenic
1020314453 7:6895119-6895141 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1020355819 7:7274466-7274488 AGGAGGCAGAGAAAGTTGGAAGG + Intergenic
1020621073 7:10519875-10519897 ATGTGGAAAGAAAAGGTGTAAGG + Intergenic
1020811485 7:12854783-12854805 AGGTGGGAGGGGAAGTTAGAGGG + Intergenic
1021741204 7:23687273-23687295 AGGTGGAAGGGCAGGTTAGAAGG + Intronic
1022070998 7:26914316-26914338 AGAGGGAAGGAAAAGCTAGATGG - Intronic
1022080264 7:27012969-27012991 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1022199511 7:28103124-28103146 AGGTGGAAGGAAAAGCCAGGAGG - Intronic
1022223528 7:28339858-28339880 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1022975268 7:35550487-35550509 TTCTGAAAGGAAAAGTTGGACGG + Intergenic
1022995748 7:35753720-35753742 AGGTAGAAGAAAAAGTTGGTCGG - Intergenic
1024228703 7:47347697-47347719 GGATGGAAGGAAGAGGTGGAAGG - Intronic
1024266843 7:47613255-47613277 GGGAGGAAGGAAAAGAAGGAAGG - Intergenic
1024298295 7:47863702-47863724 AGATGGAAGCCAAAGTTTGATGG + Intronic
1024970008 7:55060508-55060530 AGATGGAAGGAAAAGATGCTAGG - Intronic
1025941066 7:66076409-66076431 AGAAGGAAGGAAGAGTTGGAAGG - Intronic
1026044206 7:66894586-66894608 AGGAGGAAGGAAAGGAAGGAAGG + Intergenic
1026387050 7:69860542-69860564 AAGTGGAAGGAAAAGTGCCATGG - Intronic
1027604947 7:80288395-80288417 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1027617038 7:80436146-80436168 TGGTGGAAGGCAAAGCAGGAGGG - Intronic
1027864907 7:83633151-83633173 AGGAGGAAGGAAAAGGAGGAAGG - Intronic
1027925948 7:84463780-84463802 AAGAGGGAGGAAAAGTGGGAGGG - Intronic
1028405273 7:90467336-90467358 AGGAGGAAGGAGAATTTGGTTGG + Intronic
1030126264 7:106155386-106155408 AAGGGAAAGGAAAAGATGGAGGG - Intergenic
1030408264 7:109142869-109142891 AAGTGGAAGGAAGAGTGAGAAGG - Intergenic
1031306320 7:120131401-120131423 AAGGGGAGGGAAAAGTGGGAAGG + Intergenic
1031430718 7:121665407-121665429 GGTTGGAAGGGAAAGATGGAAGG - Intergenic
1032346026 7:131117702-131117724 ATGTGGAGAGAATAGTTGGAAGG + Intronic
1032514699 7:132498308-132498330 ACTTGGAAGAAAAAGTTTGATGG + Intronic
1033124790 7:138698140-138698162 AGGAGGAAGGAAAGAATGGAGGG + Intronic
1033384733 7:140861844-140861866 AGTAGAAAGGAAAAGTGGGAGGG + Intronic
1034421107 7:150991392-150991414 AGGCGGAAGGGAGAGGTGGAGGG + Intronic
1034711745 7:153198745-153198767 AGGAGGAAGGAAAAGGAGGAAGG - Intergenic
1034982902 7:155489946-155489968 AGGTGGAAGGGCAGGTGGGAGGG + Intronic
1035580036 8:733869-733891 GGGTGGAGAGAAAAGCTGGACGG - Intronic
1036115779 8:5959378-5959400 ATCTGGATGGAAACGTTGGATGG + Intergenic
1036550577 8:9811935-9811957 AGTTGTAAGAAAAAGTTGCAGGG + Intergenic
1036948308 8:13116462-13116484 AGGTGGGAGGAAGAGTTGAAAGG - Intronic
1037469904 8:19197579-19197601 TGGTGAAAGGAAGAGTTAGAAGG + Intergenic
1037680441 8:21092811-21092833 AGGAAGAAAGAAAAGATGGAAGG - Intergenic
1037943388 8:22971712-22971734 AGGTGGAAGGAAAACCAGAAAGG - Intronic
1038105439 8:24428654-24428676 TGGTGGAAGCCAAGGTTGGAGGG + Intergenic
1038161365 8:25042175-25042197 AGGAGGAAGGAAAAGAAAGAAGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1039044789 8:33439972-33439994 AGGTGGAAGGAAGAGAAAGAAGG - Intronic
1039142741 8:34411146-34411168 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1039359679 8:36862711-36862733 TGGGGGAAGGATAAGTGGGAGGG - Intronic
1039790380 8:40871296-40871318 AGGTGAAATGAAAAGTGGAAAGG - Intronic
1041921732 8:63189355-63189377 AGGTGGAAAGAGAAAATGGATGG + Intronic
1041982005 8:63873011-63873033 AGGTGGCAGGCACAGATGGAAGG - Intergenic
1042175480 8:66033870-66033892 AGGTGGAAAGAGAATTTGGATGG + Intronic
1042190282 8:66178831-66178853 AGGAGGAAGGGGAAGTGGGAAGG + Intergenic
1042192494 8:66201629-66201651 GGGGTGAAGGAAAAGTTGGATGG + Intergenic
1042397694 8:68311067-68311089 AGGAGGAAGGAAAATAAGGAAGG - Intronic
1042397806 8:68311851-68311873 AGGGGGAAGGGAAAGAAGGAAGG - Intronic
1042397829 8:68311928-68311950 AGGAGGAAGGGAAAGAAGGAAGG - Intronic
1042507316 8:69574407-69574429 AGGAGGAAGTAAATGTCGGATGG - Intronic
1042524034 8:69746044-69746066 AGGTGGAAGGAAGAGGAGGAAGG - Intronic
1042781500 8:72495839-72495861 AAGAGGAAAGAAAGGTTGGATGG + Intergenic
1043601923 8:81950469-81950491 AGAAGGAAGGAAAAGAAGGAAGG - Intergenic
1043740144 8:83801264-83801286 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1044277941 8:90323664-90323686 AGGAGAAAGGAACAGATGGAAGG - Intergenic
1044752168 8:95426799-95426821 AGGTGGGAGGAAACTTTGGAAGG - Intergenic
1045087484 8:98702101-98702123 GGGGGGAAGAAAAAGTTGTATGG + Intronic
1045289972 8:100824787-100824809 AGGTGGAAAGTGAAGTGGGAGGG - Intergenic
1045838025 8:106546569-106546591 AGCTGGAAGGAAAAGAGGAAGGG + Intronic
1045885033 8:107085791-107085813 AGGAGGAAGGAAAAATAGGAGGG - Intergenic
1045959290 8:107948355-107948377 AGGTTGAAAGAGAAATTGGAAGG + Intronic
1046146627 8:110169967-110169989 AGGAAGAAGGAAAGGTTGAAAGG - Intergenic
1046677155 8:117122509-117122531 AAGGAGAGGGAAAAGTTGGATGG - Intronic
1046860704 8:119088145-119088167 AGAAGGAAGGAATAGTGGGAAGG + Intronic
1047138299 8:122106774-122106796 AAGGGGAAGGAAGAGTAGGAGGG - Intergenic
1047511881 8:125521757-125521779 GGCTGGAAGGAAAAGAAGGAAGG - Intergenic
1047517098 8:125564446-125564468 AGGTGGGAGAAAAAGTTATAAGG + Intergenic
1047521632 8:125599488-125599510 AGGTGGAAGGCCAAGGGGGAAGG - Intergenic
1047595966 8:126378302-126378324 AGGAGGAAGGGAAAGAGGGAGGG - Intergenic
1048365668 8:133736288-133736310 AGGAGGAAGGGAGAGATGGAGGG - Intergenic
1048408110 8:134143241-134143263 AGGTAGAAAGAAAAGAAGGAAGG - Intergenic
1048811928 8:138296281-138296303 AGATGGGAGGATAAGTTTGAAGG - Intronic
1049137833 8:140921036-140921058 AGCTTGAAGCAAAATTTGGAAGG + Intronic
1050247424 9:3705243-3705265 AGGTGGAAAGTAAAGTGAGATGG + Intergenic
1050308605 9:4330575-4330597 AGGTGGAGGTGAAGGTTGGATGG + Intronic
1050308612 9:4330608-4330630 AGGTGGAGGTGAAGGTTGGATGG + Intronic
1050318400 9:4426359-4426381 AGGAGGAAAGAAGAGTTGGTTGG - Intergenic
1050777263 9:9280826-9280848 ATATTGAAGGAAAAGGTGGAGGG + Intronic
1051443112 9:17108645-17108667 AGTTGGAAAGAAAAGTATGAGGG + Intergenic
1051795486 9:20864395-20864417 TGGAGGAAGGAAAAGTTTGAAGG - Intronic
1052993307 9:34535405-34535427 AGGATGAAGGAAAAGAGGGAAGG - Intergenic
1053008389 9:34619583-34619605 AGGTAGAAGGAAAACCAGGAGGG + Intronic
1053040115 9:34863047-34863069 AAGGGGAAGGAAGAGTGGGATGG + Intergenic
1053461798 9:38277180-38277202 AGGGGGATTGCAAAGTTGGATGG + Intergenic
1055073800 9:72193864-72193886 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1056077988 9:83061293-83061315 AGCTGGAGGGAGAAGTTGGGAGG + Intronic
1056160830 9:83891083-83891105 ATTTGGAGGGAATAGTTGGATGG - Intronic
1056359299 9:85838145-85838167 ATTTGGAGGGAATAGTTGGATGG + Intergenic
1056523171 9:87418813-87418835 AGGAGGAAGGAAAAGAAGGAAGG - Intergenic
1056667977 9:88597167-88597189 GGGAGGAAGGAAAGGCTGGAGGG - Intergenic
1057153097 9:92812276-92812298 AGGTGGGAGGAAAAGCTTCAAGG - Intergenic
1058706575 9:107642415-107642437 AGGAGGAAGGAACATTAGGAGGG - Intergenic
1058780223 9:108325621-108325643 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1059768371 9:117404893-117404915 AGGTGGAAAGAATAGAGGGAGGG + Intronic
1060024540 9:120160183-120160205 ATGAGAAAGGGAAAGTTGGAGGG + Intergenic
1060152716 9:121299185-121299207 AGAAGGAAAGAAAAGTAGGAGGG + Intronic
1060474690 9:123977884-123977906 AGATGGAAGCAGAAATTGGAGGG - Intergenic
1060476672 9:123992239-123992261 AGATGGAAGCAGAAATTGGAGGG + Intergenic
1061060260 9:128246710-128246732 GGGAGGAAGGAAAAGAGGGAGGG - Intronic
1061136430 9:128736769-128736791 AGGTGGGAGGAACACTTGCATGG - Intronic
1061244658 9:129395241-129395263 AGGATGAATGAAAAGATGGATGG + Intergenic
1061531854 9:131220560-131220582 ATGTGGAAGGAAGAGGTTGAAGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1185734252 X:2485468-2485490 AGGAGGGAGGAAAAGAGGGAGGG + Intronic
1185740374 X:2527162-2527184 AGGAGGAGAGTAAAGTTGGAGGG - Intergenic
1186244324 X:7604872-7604894 AAGTGAAATGAAAATTTGGAGGG + Intergenic
1187072020 X:15897883-15897905 AGGTGGAAGCAACAGATTGATGG - Intergenic
1187209540 X:17215476-17215498 AGGTAGAAAGAAAAGTTAGCAGG + Intergenic
1187316768 X:18203126-18203148 TGGGGGAAGGAAAAGGAGGATGG + Intronic
1187856916 X:23645674-23645696 AGGAGGAAAGAAATGTTAGAGGG + Intergenic
1187901492 X:24030390-24030412 GGGAGGAAGGAAAAGCTGCAAGG + Intergenic
1188850810 X:35129494-35129516 AGATGTAAGGAAAAGGTGAATGG - Intergenic
1188983058 X:36744875-36744897 AGGTGGAAAGGAAAGTGGTATGG + Intergenic
1189411825 X:40779526-40779548 AAGTGGAGGGAAGAGTGGGAAGG - Intergenic
1189447698 X:41096029-41096051 AGGTGGCAGGAAAAGTTGAAAGG - Intronic
1189540019 X:41977367-41977389 AGGGGGATGGAAAAGGTGGGTGG + Intergenic
1189858387 X:45247472-45247494 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1190374280 X:49774355-49774377 AGGAGGAGGGAAGAGTGGGAAGG - Intergenic
1191832748 X:65432504-65432526 ATGTGGAAGAGAAACTTGGAGGG + Intronic
1191912135 X:66162633-66162655 AGGTGGAAGCACCAGTAGGAAGG - Exonic
1192393466 X:70754367-70754389 AGGGGGAGGGAAGAGTGGGAGGG + Intronic
1192484987 X:71517199-71517221 AGGGGGGAGGAAAGGTGGGATGG + Intronic
1192720047 X:73685516-73685538 AGGTGGAAAGGAAAGTGGTATGG + Intronic
1193185106 X:78502339-78502361 AAGTGGAAAGAAGAGTGGGAAGG + Intergenic
1194253240 X:91603506-91603528 AAATGGAAGAAAGAGTTGGAGGG + Intergenic
1194624394 X:96212098-96212120 ACATGGAAGGAAAAGCTGGAGGG - Intergenic
1194737221 X:97526855-97526877 AGATAGATGGAAAAGTTGAATGG - Intronic
1194788780 X:98119323-98119345 AGGGGGAAGGAAGAGTGGGAAGG + Intergenic
1194889876 X:99364979-99365001 AAGGGGAAGGAAGAGTTGGAAGG + Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195394297 X:104394422-104394444 AGGTAGGAGGAAAACTAGGAAGG + Intergenic
1195455456 X:105064267-105064289 AGGGGGAGAGAAAAGTGGGAAGG - Intronic
1196567300 X:117223894-117223916 GGGTGGGAGGAAATGTTGGGAGG - Intergenic
1196838227 X:119833042-119833064 AGGAGGCAGGAAAAATTGAAAGG - Intergenic
1196887571 X:120262621-120262643 AGGAGGAAGGGAGAGTTTGAAGG - Intronic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197361065 X:125504481-125504503 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1197430056 X:126351187-126351209 AGGTGGAGAGAAAAGGAGGAGGG + Intergenic
1197769284 X:130079721-130079743 GGGTGGAGGGATAGGTTGGAAGG + Intronic
1198200099 X:134407898-134407920 AGGTGGAAGTAGAAGGTGAAAGG + Intronic
1198521020 X:137452534-137452556 AGGAGGAAGGGCAAGTTTGAGGG - Intergenic
1198585666 X:138118031-138118053 AGGTGGAGGAAAACTTTGGACGG - Intergenic
1198714324 X:139540253-139540275 AGGAGGAAGGAATAGGTGAAAGG - Intronic
1198788816 X:140319834-140319856 AGGTGGAAGGAAACAGTTGAAGG - Intergenic
1199849418 X:151714817-151714839 AGGTGGGAGGAAGAGGAGGAAGG - Intergenic
1199989603 X:152978785-152978807 AGGTGGAAGGAAAGGCAGAATGG - Intergenic
1200920618 Y:8609781-8609803 AGGTGCAAGAAAAAGATGGCTGG - Intergenic