ID: 965892498

View in Genome Browser
Species Human (GRCh38)
Location 3:173531932-173531954
Sequence CCACTTTGGCTGAAGAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965892498 Original CRISPR CCACTTTGGCTGAAGAGCCC GGG (reversed) Intronic
900213152 1:1467350-1467372 CCACTGTGGCTCAGGGGCCCAGG - Intronic
900218364 1:1494406-1494428 CCACTGTGGCTCAGGGGCCCAGG - Intronic
900220721 1:1508171-1508193 CCACTGTGGCTCAGGGGCCCAGG - Intergenic
902184520 1:14715177-14715199 CCACCTTGGCTGAGACGCCCTGG + Intronic
902257096 1:15196968-15196990 CCGCTGTGTCTGAAGAACCCTGG - Intronic
902876124 1:19341928-19341950 CAACTGGGGCTGCAGAGCCCAGG - Intronic
902895462 1:19476811-19476833 CCACAGTGGCTGAAGAGGTCTGG - Intronic
903301950 1:22385496-22385518 CCACCTTGGCTGAAGCGTCAGGG - Intergenic
904769404 1:32872427-32872449 CCCGTTTGGGAGAAGAGCCCCGG + Intronic
906561490 1:46761240-46761262 CCCCTTTGGCTGAAGGGCAAGGG + Intronic
912412066 1:109486462-109486484 TCACTGGGGCTGAAGATCCCAGG - Intronic
913098349 1:115540642-115540664 CCCATTTGCCTGAAGGGCCCAGG - Intergenic
914982864 1:152430710-152430732 CCACTGTGGCTGCTGAGGCCTGG - Intergenic
915727552 1:158028573-158028595 CCACTGAGGCTGGAAAGCCCAGG + Intronic
916204010 1:162298012-162298034 CCTCTTTGGCTGGAGAGAGCAGG - Intronic
917296268 1:173522678-173522700 CCACTAAGGCAGAAGTGCCCAGG + Intronic
920606401 1:207392184-207392206 CCAGTTTGGCTGAAGAAACAAGG - Intergenic
922363920 1:224846196-224846218 GCTCTTTGGCAGAAGATCCCTGG + Intergenic
1062967624 10:1621453-1621475 CCACTTGGGCTGGAGAGCAGTGG + Intronic
1063152946 10:3353411-3353433 CCTCTTTGGCAGCAAAGCCCCGG - Intergenic
1063722650 10:8599760-8599782 CAACCCTGGCTGAAGAACCCAGG - Intergenic
1068423421 10:56823935-56823957 CCACCTTGGCAGCAGAGCACAGG + Intergenic
1070958419 10:80481063-80481085 TCACCCTGGCTGGAGAGCCCTGG - Intronic
1075069125 10:119309035-119309057 CCATCTAGGCTCAAGAGCCCGGG - Intronic
1076378232 10:130006782-130006804 CCAGTTGGTCTGAAGAGCCCAGG - Intergenic
1078318309 11:10309823-10309845 ACACCTTGGCTGAACAGCCAAGG + Intronic
1078556329 11:12329543-12329565 CCGCTTAGGCTGAATAGTCCTGG + Intronic
1078846323 11:15121993-15122015 GCCATTTGTCTGAAGAGCCCTGG + Intronic
1079022167 11:16917997-16918019 CCACGTTAGCTGAAGAAACCTGG - Intronic
1080171399 11:29307533-29307555 CCACTTCAGCTGAAGTGCCAAGG + Intergenic
1081543652 11:44054133-44054155 CCACTTGGGCTGGAGTGCCGAGG + Intronic
1084558446 11:69889267-69889289 CAACTTTATCTTAAGAGCCCAGG + Intergenic
1084728076 11:70954904-70954926 CTCCTGTGGATGAAGAGCCCAGG - Intronic
1089587213 11:119517876-119517898 CCATGATGGCTGAAGAGCTCAGG - Intergenic
1090424767 11:126599760-126599782 TCACTGTGGTTGAAGGGCCCTGG + Intronic
1092578957 12:9819215-9819237 CCACTTTTGCTGGGAAGCCCTGG - Intergenic
1097102734 12:56600901-56600923 CAGCTTGAGCTGAAGAGCCCAGG - Intronic
1099350269 12:81558781-81558803 CCACTCTGGCTGGAGTGGCCTGG + Intronic
1101661538 12:106770263-106770285 TCACCTTGGCTGAAGAGCAATGG + Intronic
1102036416 12:109772904-109772926 CCAATTTGGCTCCAGAACCCAGG + Intergenic
1104171104 12:126281624-126281646 CCACTGTGACTGCTGAGCCCTGG - Intergenic
1104554659 12:129788850-129788872 CCAGTTAGACGGAAGAGCCCTGG + Intronic
1106109865 13:26767364-26767386 CCCCTTTGGATGTAGGGCCCAGG - Intergenic
1107663633 13:42665615-42665637 CCACTGTGACTGGAGACCCCTGG - Intergenic
1108638200 13:52357018-52357040 CCACTTTGGTTGAAAGTCCCAGG - Intergenic
1111684170 13:91481686-91481708 TCACTTTAGCTGTAGAGCCCAGG - Intronic
1114988547 14:28261308-28261330 CCACTTTTGCTGGGAAGCCCGGG - Intergenic
1115509863 14:34128903-34128925 CCAACTTGGCTGAGAAGCCCTGG - Intronic
1115757927 14:36548301-36548323 CAACTTTGGCTGAGGTGACCTGG - Intergenic
1118065372 14:62184993-62185015 GCACTTTTCCTGAAGAGCCAGGG - Intergenic
1122997749 14:105274710-105274732 CCACTCTGTCTGCAGAGCACAGG + Intronic
1127263557 15:57343706-57343728 TCACTGTGGCTGCAGGGCCCTGG - Intergenic
1127800051 15:62470304-62470326 CCTCCTTGGCTGAGGAGCCCGGG - Intronic
1127943959 15:63730777-63730799 CAAATTTGGCTGAAGAGCACAGG + Intronic
1129997863 15:80022516-80022538 CCACTAAGGCTGAAGAGGCAAGG + Intergenic
1132326254 15:100973131-100973153 CCGCTTTTGCTGAACGGCCCGGG + Intronic
1135057821 16:19245137-19245159 ACCTTTTGGCTGGAGAGCCCGGG + Intronic
1135755482 16:25093647-25093669 CATCTTTGGCTGAAAAGCGCTGG - Intergenic
1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137269616 16:46894622-46894644 CCACTGTGTCTGGAGAGCCAGGG - Intronic
1141179186 16:81740799-81740821 CCACTGTGGGTGCAGAGGCCTGG + Intronic
1141673596 16:85505878-85505900 CCACTTGGGAGGATGAGCCCAGG + Intergenic
1142614365 17:1126103-1126125 CCACTTGGGCTCCAGAGCCCAGG + Intronic
1143452326 17:7043360-7043382 GCACTTTGACCGAAGCGCCCAGG - Exonic
1143609599 17:8010272-8010294 CCACTTGTGCAGAATAGCCCTGG + Intronic
1144842702 17:18197983-18198005 CCACATTGCCACAAGAGCCCAGG - Intronic
1145979448 17:29003238-29003260 CCACTGTGGCTGGATGGCCCAGG + Intronic
1146663771 17:34683132-34683154 CCAATTAGGCTGAGAAGCCCAGG - Intergenic
1148722286 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG + Intronic
1150272284 17:63874169-63874191 CCACTTTTGCTGATGACTCCTGG + Intronic
1150275831 17:63897066-63897088 CCACTTTTGCTGATGACTCCTGG + Intergenic
1150510881 17:65751884-65751906 ACACTTTGGCTGCAGAGCACAGG + Intronic
1155680777 18:28483020-28483042 CTACTTTTGCCAAAGAGCCCAGG - Intergenic
1156511092 18:37637455-37637477 CCACTGTGCCTGGAGAGCCCAGG + Intergenic
1158274933 18:55756905-55756927 CAACTCTGGCTTAAGTGCCCTGG + Intergenic
1158943440 18:62427376-62427398 CCTCTGAGGCTGAAGGGCCCAGG - Intergenic
1159016634 18:63106201-63106223 GAACTTTGGGTGCAGAGCCCAGG + Intergenic
1159831666 18:73284923-73284945 CCTGTTTCTCTGAAGAGCCCTGG - Intergenic
1161669377 19:5596714-5596736 CCAGTTTGGGTGAGGGGCCCTGG - Intronic
1163148632 19:15398663-15398685 CAGCTTTGTCTGGAGAGCCCAGG + Intronic
1163916773 19:20246963-20246985 CCTCCTGGGCTGAAGAACCCTGG - Intergenic
1166292008 19:41869382-41869404 CCTCTCTGGCTGACTAGCCCAGG + Intronic
1167524116 19:49973025-49973047 TCACTCTGGGTGAAGAGACCAGG - Intergenic
1168328586 19:55552201-55552223 CCACCCAGGCTGGAGAGCCCTGG - Intergenic
927138872 2:20116192-20116214 CCACATAGGCAGAGGAGCCCGGG + Intergenic
927719252 2:25372553-25372575 ACACGTGGGCTGAAGAGCCAGGG - Intergenic
928034706 2:27811195-27811217 CCACCTAGCCTGAGGAGCCCAGG - Intronic
932075508 2:68659220-68659242 ACACTGTGGTAGAAGAGCCCTGG - Intergenic
935540658 2:104344481-104344503 TCTCTTTGGCTGAAGAGTTCCGG + Intergenic
936457461 2:112686373-112686395 CCACTGTGGCTAATGAGCCCGGG - Intergenic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
948983249 2:241505701-241505723 CTGCTTGGGCTGATGAGCCCTGG - Intronic
1170354314 20:15475623-15475645 TCATGCTGGCTGAAGAGCCCTGG + Intronic
1170917422 20:20641058-20641080 GCACTTTGGCTCCAGAACCCAGG - Intronic
1172121332 20:32600725-32600747 TCACTTGCTCTGAAGAGCCCAGG + Intronic
1172173472 20:32958721-32958743 CAGCTATGGCTGGAGAGCCCAGG + Intronic
1172350334 20:34234234-34234256 TCACTTTGGGTCATGAGCCCTGG - Intronic
1173267272 20:41495933-41495955 GCAGTTTGACTGCAGAGCCCAGG + Intronic
1179541272 21:42084514-42084536 CCAGTTTGCCTGGAGAGGCCAGG + Intronic
1181868094 22:25875213-25875235 GCAGTCTGGCTGCAGAGCCCAGG - Intronic
1184732355 22:46377890-46377912 GCACTGTGGCTCAAGGGCCCAGG - Intronic
1184851312 22:47122826-47122848 CCTCTCTGGCTGTAGACCCCTGG + Intronic
951027651 3:17846593-17846615 GTGCTTTGGCTGAGGAGCCCAGG + Intronic
951082296 3:18466757-18466779 CCACTTGGTCTGCAGAGCCCAGG + Intergenic
952337329 3:32415217-32415239 AAACTTTGGCTGAGGGGCCCAGG + Intronic
953284616 3:41594569-41594591 CCACTGTGGCTGAAGAATACAGG + Intronic
953677520 3:45014865-45014887 CCCCTTTGACTGGAGAGCCTTGG - Intronic
957227382 3:77467445-77467467 CTACTTTGTCTGAAGACCCGAGG + Intronic
957418352 3:79934995-79935017 CCACATTGGCTGAAGTGCCGTGG - Intergenic
959957125 3:112251953-112251975 CCACTTTTGCTGGGAAGCCCAGG + Intronic
965892498 3:173531932-173531954 CCACTTTGGCTGAAGAGCCCGGG - Intronic
966201016 3:177359675-177359697 CCTCTTAGGCTGCAGAGCCGAGG - Intergenic
966210660 3:177450234-177450256 CCAGTTTGACTGCAGAGCCTGGG + Intergenic
966858054 3:184209745-184209767 CCACTTTGGCCTCAGAGCGCTGG + Intronic
968513991 4:1008761-1008783 CCACTCTGGCTGCTGAGCACAGG + Intergenic
968951482 4:3696765-3696787 CCCATTTCCCTGAAGAGCCCTGG + Intergenic
969217511 4:5734125-5734147 CCACTTTAGCCGCAGAACCCCGG + Intronic
970413514 4:15834131-15834153 CCACTATGACTGAACAGCCAGGG + Intronic
974298524 4:60035178-60035200 CCACTTTGGCTGAATTACCAAGG - Intergenic
981502570 4:145468080-145468102 CCACCTAGGCTGGAGTGCCCTGG + Intergenic
982584892 4:157223044-157223066 CCACTTTGGCTACAGAGCTTGGG + Intronic
983644044 4:169971895-169971917 CGACTGTGGCTGGAGAGCCCAGG + Intergenic
984164081 4:176286958-176286980 GCACTGAGGCTGAACAGCCCAGG + Intergenic
987231914 5:15902976-15902998 GCACTTTTGCAGAAGAGCTCTGG - Intronic
989537513 5:42581796-42581818 CAACTGTGCCTGAAGAGCACTGG - Intronic
992233782 5:74687354-74687376 CCCCTGTCTCTGAAGAGCCCAGG + Intronic
994897136 5:105721124-105721146 CTACTTTTGCTGGAAAGCCCAGG - Intergenic
995452428 5:112316811-112316833 CTACCTGGGCTGAAGAACCCAGG + Intronic
996944522 5:129050569-129050591 CCTTTTTGACTGAAGAGCCTGGG - Intergenic
997657873 5:135568736-135568758 CAAAGCTGGCTGAAGAGCCCCGG - Intergenic
998404678 5:141867654-141867676 CCACTTTGGCTTGAGGACCCAGG + Intronic
998541168 5:142982826-142982848 CCACCTGGACTGAAGATCCCAGG - Intronic
999269719 5:150289745-150289767 CCGGTTTGACTGACGAGCCCGGG + Intronic
999274266 5:150318637-150318659 CCACTTTGGATGGAGTGGCCAGG + Intronic
1000222619 5:159228358-159228380 CCATTTTAGCAGAAGCGCCCTGG - Intergenic
1000724487 5:164752574-164752596 GGGCTTTGGCTGAAGAGCACTGG - Intergenic
1001159668 5:169301621-169301643 CAATTTTGCCTGAAGAGCCTTGG + Intergenic
1001322263 5:170692327-170692349 CCGCTTTGCCTGAAAAGGCCTGG - Intronic
1001474974 5:172044138-172044160 CCACCTGGGCAGAAGAGGCCAGG + Exonic
1007048207 6:38798858-38798880 CCACTAGGGCTGAAGGGACCAGG + Intronic
1007408504 6:41648461-41648483 CTCCCTTGGCTGAAGAGGCCGGG - Intronic
1007836175 6:44675466-44675488 CCGCTTTGGCTGAATACTCCAGG - Intergenic
1009631548 6:66207636-66207658 CCACATAAGCTGAAGAGACCAGG - Intergenic
1012073838 6:94658008-94658030 CCACCATGGCTGAAGTGCACTGG - Intergenic
1012633321 6:101501795-101501817 TCACTTAGGCTGGAGTGCCCTGG + Intronic
1014235222 6:118946572-118946594 CCACTTAGGCTGAAGTGCAGTGG - Intergenic
1017855213 6:158344860-158344882 ACAGTTTGGCTCAAGAGGCCTGG - Intronic
1019716185 7:2540537-2540559 CAACTTTGGAGGAAGGGCCCAGG - Intronic
1021648345 7:22808370-22808392 AGACATTGGCTGAAGAGACCAGG - Intergenic
1025261954 7:57425758-57425780 CCTCTCTGGCTGGAGATCCCCGG + Intergenic
1025739279 7:64182975-64182997 CCTCTCTGGCTGGAGACCCCCGG + Intronic
1028615845 7:92765999-92766021 CCACTGTGGCTGGAGAACCGTGG + Intronic
1029503063 7:100945783-100945805 CCACTTTCCCTGCAGAGCCTGGG - Intergenic
1031932174 7:127696683-127696705 CCATTTTGGCTGAAGACCAAGGG - Intronic
1032250896 7:130256392-130256414 CCACATGAGCTGAAGAGGCCAGG - Intergenic
1032712511 7:134473090-134473112 CCACTAAGACTGAGGAGCCCCGG - Intergenic
1034425162 7:151010235-151010257 GCACCTTGGCAGAAGAGCCCAGG + Exonic
1039955357 8:42203006-42203028 ACACCCTGGCAGAAGAGCCCGGG - Intronic
1040715394 8:50245641-50245663 CCACTTAGGCTGAAGTGCAGTGG - Intronic
1041991495 8:63998265-63998287 CCACCTAGGCTGAAGAGCAGTGG + Intergenic
1045685173 8:104704065-104704087 CCACTGAGGATGGAGAGCCCTGG - Intronic
1046150266 8:110214631-110214653 CCACTTTTGCTGAATACCACAGG - Intergenic
1048619964 8:136121132-136121154 CCACTTTGGCTGTTGGGTCCTGG + Intergenic
1056455835 9:86758901-86758923 CCTCTCTGGCTGCAGTGCCCAGG - Intergenic
1057679767 9:97168472-97168494 ACACATTAGCTGAAGAGGCCAGG - Intergenic
1058968118 9:110055763-110055785 CCACTGTGCCTGGAGTGCCCTGG + Intronic
1059640627 9:116213299-116213321 CCATTTGGGCTGATGACCCCTGG + Intronic
1061011159 9:127955432-127955454 CCACTTTGGCTCAGGAGCCCGGG + Intronic
1061978293 9:134084660-134084682 CCACTGTTTCTGAAGAGCCTTGG - Intergenic
1062546149 9:137064560-137064582 CCTCTCTGGCTGGAGACCCCCGG - Exonic
1062599007 9:137311745-137311767 CCCCTGTGGCTGGGGAGCCCAGG - Intronic
1187075520 X:15930488-15930510 CCACTTTGCCAGAATATCCCTGG - Intergenic
1187215977 X:17276840-17276862 AGGCTTTGGCTGAAGAGGCCTGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1192360150 X:70434196-70434218 CCACCTTAGCTGCGGAGCCCAGG - Intergenic
1194621736 X:96181554-96181576 CCACATGAGCTGAAGAGGCCAGG - Intergenic
1195453192 X:105038504-105038526 CCACTTTGGTGGAAGAGCAGTGG + Intronic
1199917130 X:152355390-152355412 CCACCTTGGCTGAAGATCAGAGG + Intronic
1202171918 Y:22058776-22058798 CCTCTTTGGCTGGAGTGCACTGG - Intergenic
1202219444 Y:22527596-22527618 CCTCTTTGGCTGGAGTGCACTGG + Intergenic
1202323734 Y:23668485-23668507 CCTCTTTGGCTGGAGTGCACTGG - Intergenic
1202547037 Y:26001569-26001591 CCTCTTTGGCTGGAGTGCACTGG + Intergenic