ID: 965893161

View in Genome Browser
Species Human (GRCh38)
Location 3:173540124-173540146
Sequence AGTCATCTGCAGAGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 6, 2: 202, 3: 225, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965893156_965893161 3 Left 965893156 3:173540098-173540120 CCAGAGCTGTTTCTCAGAAGAAG 0: 1
1: 0
2: 3
3: 17
4: 224
Right 965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG 0: 1
1: 6
2: 202
3: 225
4: 350
965893153_965893161 16 Left 965893153 3:173540085-173540107 CCCAGTAGCAGGCCCAGAGCTGT 0: 2
1: 10
2: 211
3: 276
4: 408
Right 965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG 0: 1
1: 6
2: 202
3: 225
4: 350
965893155_965893161 4 Left 965893155 3:173540097-173540119 CCCAGAGCTGTTTCTCAGAAGAA 0: 1
1: 2
2: 52
3: 315
4: 1443
Right 965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG 0: 1
1: 6
2: 202
3: 225
4: 350
965893154_965893161 15 Left 965893154 3:173540086-173540108 CCAGTAGCAGGCCCAGAGCTGTT 0: 1
1: 6
2: 39
3: 236
4: 390
Right 965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG 0: 1
1: 6
2: 202
3: 225
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965893161 Original CRISPR AGTCATCTGCAGAGGATGGC AGG Intronic
900120935 1:1048373-1048395 TGTCCACTGCAGAGGAGGGCGGG + Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901746914 1:11379950-11379972 AGACATCAGAAGAGGATGGATGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902232104 1:15034692-15034714 AGGCATCTGGAGAGGACAGCTGG + Intronic
902518877 1:17004782-17004804 AGTCCCAGGCAGAGGATGGCCGG - Exonic
903120066 1:21210388-21210410 AGTTATCCACAGAGGATGGTGGG - Intergenic
903925054 1:26826305-26826327 AGGCATTTGCAGAGGCAGGCAGG - Intergenic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904034194 1:27550303-27550325 CGTCTGCTGCATAGGATGGCTGG + Exonic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904820183 1:33237656-33237678 AGTCGTTGGCAGAGGATGGCTGG + Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906289438 1:44610342-44610364 TGTTATCGGCAGAGGATGGCGGG - Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907470800 1:54672225-54672247 AGTAATCTGCAGAGATGGGCAGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909248247 1:73317997-73318019 AGGCAGCTGCAAAGGATTGCTGG - Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912100238 1:106194539-106194561 AGTCATCTAGAGAGAAAGGCAGG + Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912570718 1:110619107-110619129 AGGCAGCTGCAGAGGGTGGTTGG - Intronic
912587254 1:110778355-110778377 TGTCATCTGAAGAGGTAGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
913556353 1:119971238-119971260 AGCCAACTGCCTAGGATGGCAGG + Intronic
913633016 1:120727808-120727830 AGTCATTTGCAGAGAAAGGGGGG - Intergenic
914285701 1:146225107-146225129 AGTCATTTGCAGAGAAAGGGGGG + Intronic
914546732 1:148675859-148675881 AGTCATTTGCAGAGAAAGGGGGG + Intronic
914619832 1:149394808-149394830 AGTCATTTGCAGAGAAAGGGTGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916365972 1:164028089-164028111 AGTTATCTGTGGAGGAGGGCAGG + Intergenic
917064486 1:171076743-171076765 AGTCATCTGCTGAGAATGAGTGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
922068843 1:222170803-222170825 AGATATCTGCACAGGATGGGTGG - Intergenic
922223691 1:223627490-223627512 AGGCATCTGCTGAGGCTTGCTGG + Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063100428 10:2945446-2945468 AATCACATGCAGAGGCTGGCTGG - Intergenic
1063260621 10:4385384-4385406 ACTCATCTCTAGAGGAAGGCAGG - Intergenic
1063473068 10:6304438-6304460 AGTAGCCCGCAGAGGATGGCTGG - Intergenic
1064011280 10:11738411-11738433 ACTCTTCTGCAGAGGCTGTCCGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065607016 10:27428505-27428527 AGTTATCCACTGAGGATGGCAGG - Intergenic
1066218357 10:33310723-33310745 AGTCACCTTCAGAGAGTGGCTGG + Intronic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067182018 10:43995366-43995388 ACCCATGTGCAGAGGAAGGCGGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071300643 10:84253672-84253694 AGGCATCTGCACTGGATGACAGG + Intronic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074357253 10:112797449-112797471 AGCCAACTGCAGTGGATGGTGGG - Intronic
1074525218 10:114257278-114257300 GGTCCTGTGCAGAGGATGGTGGG - Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG + Exonic
1078507343 11:11962141-11962163 AGTCATTTGCAGTGGCTGGAAGG - Intergenic
1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080145649 11:28979691-28979713 AGTCAACTGCATAGGATGGATGG - Intergenic
1080592904 11:33738949-33738971 AGTCTTGTGCTAAGGATGGCAGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081718835 11:45271496-45271518 AGTCAGCTGGAGAGGAAGGCTGG + Intronic
1081754864 11:45537302-45537324 AGGCCCCTGCAGGGGATGGCTGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1084231583 11:67757423-67757445 AGACATCAGCAGATGCTGGCAGG + Intergenic
1085269832 11:75263667-75263689 AGTCATCAGCAAAGGATGGTAGG + Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1089762342 11:120737138-120737160 GGTTATCTCCTGAGGATGGCCGG + Intronic
1089903604 11:122013580-122013602 GTTAATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090873210 11:130766326-130766348 AGTGATCTGCAGGGGAAGGCAGG - Intergenic
1090891794 11:130930141-130930163 ACTCATGTGCATATGATGGCAGG + Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092274208 12:7046966-7046988 AGGAATGTGCTGAGGATGGCAGG + Intronic
1092305709 12:7298624-7298646 AGTCATCTGCATACCTTGGCTGG + Intergenic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095322401 12:40845646-40845668 TCTCATCTCCAGAGGCTGGCGGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096195200 12:49645175-49645197 AGCCATCTGCAGAGAGTGGTTGG + Exonic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096576960 12:52558875-52558897 GTTCATCTGCTGAGGAGGGCTGG - Intergenic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099578071 12:84405367-84405389 AGGCATATACAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG + Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101137224 12:101756755-101756777 ATTCATCCCCAAAGGATGGCTGG + Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103927561 12:124432370-124432392 AGGCCTCTGCAGAGGAGGCCAGG - Intronic
1104323296 12:127772468-127772490 AGTCATCGGCAGAGGAAGAGTGG - Intergenic
1105431173 13:20339258-20339280 AGTCATCCACAGAGCAGGGCTGG - Intergenic
1105546028 13:21351844-21351866 CAGCATCTGGAGAGGATGGCTGG + Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1105999618 13:25708948-25708970 TGTCATCTGCAGAGCTTTGCTGG + Intronic
1106752501 13:32789421-32789443 AGTCGCCTTCTGAGGATGGCAGG - Intergenic
1107126434 13:36851402-36851424 AGTCATCTGCACATGAGGGTGGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109720398 13:66268669-66268691 AGTCTTCTGCAGAGGGTCTCAGG - Intergenic
1109914047 13:68956168-68956190 AGTAATCTGCTGATGTTGGCTGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110613041 13:77510404-77510426 AGTCATGTACAAAGGATGTCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1111535771 13:89600709-89600731 AGTCATCCACAGAGGAGAGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112464851 13:99635047-99635069 AGGCAGCTGCAGAGGGTGCCAGG + Intronic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114228574 14:20760426-20760448 AGTCATCTACATAGTATAGCAGG - Intergenic
1114563053 14:23607279-23607301 AGTCATCCTCAGGGGGTGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115503001 14:34065732-34065754 AGTCACCTGGAGGTGATGGCAGG - Intronic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117120058 14:52557959-52557981 AGTCATATGCAGTGGATGAAAGG - Intronic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG + Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118014276 14:61642543-61642565 AGGCAGCTGGAGAGGAAGGCAGG + Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119447209 14:74675785-74675807 CGTCAACAGCAGTGGATGGCCGG + Exonic
1119555773 14:75551222-75551244 AGATAAATGCAGAGGATGGCAGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1121157585 14:91701121-91701143 AGTCAAGTGGAGAGGAAGGCAGG + Intronic
1121231818 14:92364013-92364035 AGTCACCTACAGAGGATACCAGG - Intronic
1121580629 14:95027016-95027038 AGGCATCTGCAGAGGTTGCAGGG + Intergenic
1121634622 14:95445614-95445636 AGTCTTCTGCAGAGAGTGACAGG - Intronic
1123817817 15:23997529-23997551 AGTTATCTGTGGATGATGGCAGG + Intergenic
1123908503 15:24943681-24943703 AGTTAACTACAGAGGATAGCAGG + Intronic
1125481078 15:40081299-40081321 AGGCTTCTGGAGAGGAGGGCTGG - Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127791695 15:62404233-62404255 AGGCACCTGCAGAGGACAGCTGG + Intronic
1128497749 15:68207832-68207854 GGTCAGGTGCAGAGGAGGGCAGG + Exonic
1128765193 15:70247101-70247123 AGACCTCTGCAGATGAAGGCTGG - Intergenic
1129269743 15:74413299-74413321 AGTCCTCTGCAGAGAATGGGAGG - Intronic
1129785723 15:78308917-78308939 AGGTATGTGCAGAGGATGGGAGG - Intergenic
1131524178 15:93139555-93139577 GCACATTTGCAGAGGATGGCGGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132103069 15:99041423-99041445 AGTCACCCTCAGAGGATGACAGG + Intergenic
1135643060 16:24137648-24137670 ATGGATATGCAGAGGATGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139639836 16:68283315-68283337 AGTCACAGGCTGAGGATGGCAGG - Intronic
1140524907 16:75614545-75614567 ATACATCTGGAGAGGTTGGCTGG + Intronic
1140816909 16:78629581-78629603 AGTAAGCTGCAGAGGTTGGCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142637942 17:1269536-1269558 AGTCAGCAGCAGAGGGTGACGGG - Intergenic
1143298791 17:5893360-5893382 CAGCATCTGCAAAGGATGGCTGG + Intronic
1144090273 17:11850153-11850175 GGGCATCTGGAGAGGATGGGTGG + Intronic
1144406560 17:14957785-14957807 AGACATGGACAGAGGATGGCAGG + Intergenic
1145246583 17:21273633-21273655 AGTCATAGGCAGAGGCTGGATGG + Intergenic
1145985617 17:29043985-29044007 AGTCCACTGCAGTGGATAGCTGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1149037922 17:52156689-52156711 AGTCATCAGAAGAGGAGAGCAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151784426 17:76268472-76268494 AGTCATCCCCAGAGGGTGGGGGG + Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153963219 18:10157835-10157857 TGACTTCTGCAGAGGATGGGAGG - Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155761400 18:29572474-29572496 GGTGAACTGCAGAGGAAGGCTGG + Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156825696 18:41427805-41427827 AGTCTCCTGCAGAGTATGGTGGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157321241 18:46636285-46636307 AGTCATCTCCAGCGAATGTCAGG + Intronic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160063227 18:75550829-75550851 AGGCATCAGAGGAGGATGGCCGG + Intergenic
1160816758 19:1039629-1039651 CGGCTTCTGCAGAGGATGGCAGG - Intergenic
1160858322 19:1227242-1227264 AGTCACCTGCCGAGGATGCGGGG + Intronic
1161321308 19:3642906-3642928 AGTCGTCTGGACAGGATGGCAGG - Exonic
1161582196 19:5087055-5087077 CGTCTTCTGCAGAGCAGGGCTGG + Intronic
1163058899 19:14743865-14743887 AATCATCTACAGGGGAGGGCAGG - Intronic
1163460881 19:17436751-17436773 GGTCGTCTTCAAAGGATGGCGGG + Exonic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164707692 19:30332492-30332514 AGCCAGCTGCAAAGGATGGAGGG - Intronic
1165318758 19:35073657-35073679 GGGCATCTGCAGGGCATGGCTGG - Intergenic
1167609913 19:50502039-50502061 AGGGCTCTGCAGAGGCTGGCGGG - Intergenic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
924965410 2:72238-72260 AGTCCTCACAAGAGGATGGCAGG + Intergenic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925511336 2:4628993-4629015 AGTCAGGTGCTGAGGCTGGCTGG + Intergenic
925789586 2:7470477-7470499 AGTCACCTGCAGGAGGTGGCTGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927705748 2:25295330-25295352 AGTCAGCTGCAGGGCAGGGCGGG - Intronic
928687017 2:33760303-33760325 AGCCATATGCTGATGATGGCAGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931817637 2:65920459-65920481 AGCCATCTGCAGTGTATGCCTGG - Intergenic
933168167 2:79097150-79097172 AGTCCTCTGCAGAGGAGGCATGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933947016 2:87295629-87295651 ATTCATATGCAGAGAAGGGCAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935878981 2:107542213-107542235 AGTCATCTGGAAAGATTGGCTGG + Intergenic
936333174 2:111565940-111565962 ATTCATATGCAGAGAAGGGCAGG + Intergenic
936826363 2:116586643-116586665 AGTGATCTGGAGAGATTGGCTGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
938133072 2:128733714-128733736 AGACATCCACTGAGGATGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942229528 2:173847356-173847378 AGACACCAGCTGAGGATGGCTGG + Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942357850 2:175138595-175138617 GGTGATTTTCAGAGGATGGCAGG - Intronic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944213130 2:197227060-197227082 TGTTTTCTGCTGAGGATGGCAGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
945756830 2:213856940-213856962 AATCATCAGCATAGGATGGGTGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947184322 2:227441613-227441635 AGTCATCTGCAGGTGCTGGCAGG + Intergenic
947273211 2:228362616-228362638 AGGCACCTTCACAGGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948491424 2:238315503-238315525 GGTCATCTTCACAGGATGACAGG - Intergenic
1169020969 20:2330542-2330564 AGTCATCTGCAGAGGCAGAGAGG - Intronic
1169388890 20:5173594-5173616 TATCATCTGCAGAGACTGGCAGG - Exonic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1171409822 20:24938657-24938679 AGTCTTCTGAGGAAGATGGCAGG + Intergenic
1171436116 20:25125919-25125941 AGTCATCTGAGGAAGATGGCAGG - Intergenic
1172006248 20:31820530-31820552 ATTCACCTGGAGATGATGGCAGG - Exonic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1172574473 20:35997119-35997141 AAAGATCTGCAGAGGATGGAAGG - Intronic
1172773929 20:37396560-37396582 AGCCAGCTGCAGAGAAAGGCGGG - Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1173700991 20:45071450-45071472 AGTCATCAGCAGTGCCTGGCTGG + Intronic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1174973153 20:55300831-55300853 AATCAATTGCAGAGGATAGCAGG - Intergenic
1175161087 20:57008470-57008492 AGTCAGCTGCAGAGGTGGGTGGG + Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1175479204 20:59299942-59299964 AGCCATCTGCACAGGTTGGGTGG - Intergenic
1175557793 20:59883682-59883704 AGTGGTCACCAGAGGATGGCAGG + Intronic
1175601530 20:60277877-60277899 AGTTATCTCCAGAGGACTGCTGG - Intergenic
1175928909 20:62484431-62484453 GGTCCTCTGGAGAGGGTGGCTGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177250867 21:18589170-18589192 AGTCATTTGCAGGGGGTGGTAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178450922 21:32699058-32699080 AGTCCTCAGCAGAGCATGGCAGG - Intronic
1179257279 21:39727689-39727711 AGTCATTTGGAGATGGTGGCTGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180065232 21:45409004-45409026 GGTCAGGTGCAGAGGCTGGCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180689147 22:17696646-17696668 TGTCTTCTGCAAAGGATGGTTGG - Intronic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1182008799 22:26983317-26983339 TGCCATCTCCAGAGGGTGGCTGG - Intergenic
1182283407 22:29231003-29231025 GGTCATCTGAAGAGGAAGACAGG - Exonic
1182426540 22:30276255-30276277 AGGCAACTGCAGAAGATGGTGGG + Intergenic
1183455243 22:37918969-37918991 AGTGATGTGAACAGGATGGCTGG + Intronic
1184233151 22:43169198-43169220 AGTCATATGGAGACGTTGGCTGG - Intronic
1184572675 22:45336206-45336228 TGTCATCTCTAGTGGATGGCAGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949401632 3:3670607-3670629 AGTCATTTCCAGAAGATGCCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950269482 3:11602158-11602180 AACCATGTTCAGAGGATGGCAGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951077822 3:18418225-18418247 AGTCATCTTCAGAAGTTGGTAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951571105 3:24064220-24064242 AGTTAACTGCAGAGTGTGGCAGG + Intergenic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952233195 3:31453359-31453381 AGTCCTCTTCCGAGGATAGCCGG + Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952930041 3:38352850-38352872 AGTCATCTGTAGAGAAGGGACGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954127993 3:48543485-48543507 AGGCATCTGGAGGGGAAGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955952447 3:64255958-64255980 AGCCATATGCCGAGGTTGGCAGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957048127 3:75392272-75392294 AGACATCAGCAGATGCTGGCAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958179879 3:90046512-90046534 AGTTATCCACAGAGGATAGCAGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959174001 3:102881827-102881849 AATAATCTGCAGAGGTTGGCTGG - Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960705375 3:120476019-120476041 AGTCCTGTGCAGTGGATGACAGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
961787620 3:129357170-129357192 AGTGATGTGCAGAGGCTGGCAGG + Intergenic
961880199 3:130056382-130056404 AGACATCAGCAGATGCTGGCAGG + Intergenic
962448864 3:135494603-135494625 AGTCAACTGCAGAGGAAGCTGGG + Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964724944 3:159804997-159805019 AGAAATCTGCTGAGGATGACTGG - Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965863420 3:173174666-173174688 AGTTATCCGCATAGGAAGGCTGG - Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969822765 4:9732893-9732915 AGACATCAGCAGATGCTGGCAGG - Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
970956376 4:21816648-21816670 AATCCTCATCAGAGGATGGCAGG - Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
972805913 4:42529297-42529319 AGTTACCTGCAGATTATGGCAGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
972925585 4:44002547-44002569 AGTCAACTGCTGCTGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974688523 4:65265560-65265582 AGTAATCTGCTGAGGATGGTGGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
976104880 4:81605974-81605996 AGAGATCTGGAGAGGATGGCTGG - Intronic
976702360 4:87985181-87985203 ACTCACCTGCAGGTGATGGCTGG + Intergenic
976890811 4:90045242-90045264 AGTCATCAGCAGGGGTTGGTAGG - Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977337380 4:95716128-95716150 AGTTATCTGCGGAGGGTGTCAGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977847096 4:101779251-101779273 AGCAATCTGCAGATGATGTCAGG + Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978330173 4:107603925-107603947 ACTCATCAGCAGATGAAGGCTGG - Intronic
978691093 4:111511582-111511604 TGTCATCTTCTGAGGATGACAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979404636 4:120294688-120294710 AGCCTTCTGCAGATGATGGAGGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981305807 4:143245836-143245858 TGTCTTCTGCATGGGATGGCTGG + Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981517339 4:145624331-145624353 TGTCTTCTCCAGAGGATAGCTGG + Intronic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
982724022 4:158886451-158886473 AGTGGTCTGGAGAGGGTGGCAGG + Intronic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984310818 4:178055705-178055727 AGTCTTTTGTAGAGGATGGATGG - Intergenic
984645008 4:182209882-182209904 AGTCATCTGCAGGGGGAGGTGGG + Intronic
985139053 4:186820497-186820519 ATTCCTCTGCAGCGGTTGGCAGG + Intergenic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
986042605 5:4008191-4008213 AGTCCTTTGCAGAGCAGGGCAGG + Intergenic
986076838 5:4346731-4346753 AGTGATCTGGGGAGGAAGGCTGG + Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986573418 5:9188822-9188844 AGTTATCTGGAGGGGATGGGAGG - Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988527494 5:31999767-31999789 AGTCATCAGGGCAGGATGGCAGG + Intronic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988779520 5:34507374-34507396 TGTGATTTGCAGAGGATAGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989100787 5:37821125-37821147 ACTCCTCTGCAGAGGATGCTGGG + Intronic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992023508 5:72648721-72648743 ACTGAACTGCAGAGGCTGGCTGG + Intergenic
992033726 5:72750124-72750146 AGTGATACACAGAGGATGGCAGG + Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992856551 5:80867471-80867493 ACTCCTTAGCAGAGGATGGCAGG + Intronic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999639092 5:153653370-153653392 CGTCCACTGGAGAGGATGGCAGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002337967 5:178493508-178493530 TGTCATGTGCAGAGTAGGGCAGG - Intronic
1002500384 5:179643927-179643949 AGTCATCTGCAGAGGCCTGATGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003405584 6:5824593-5824615 CAGCATCTGGAGAGGATGGCTGG - Intergenic
1003425315 6:5994926-5994948 AGACAGCTCCAGAGGATGGACGG + Intergenic
1003490890 6:6620559-6620581 ATTCCTCAGCAGAGGATGGTGGG - Intronic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1004738404 6:18431757-18431779 CTTCATCTTCAAAGGATGGCAGG + Intronic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006294607 6:33164583-33164605 AGTCATGAGCAGGGAATGGCTGG + Intronic
1006413534 6:33890066-33890088 TTTCATATGAAGAGGATGGCTGG + Intergenic
1007191305 6:40021244-40021266 AGTCAGATGCAGAGGATTACGGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008448854 6:51625749-51625771 TGCCATCTGCAGAGAGTGGCAGG - Intronic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1010768364 6:79801543-79801565 AGTCATGTGCTGCAGATGGCAGG + Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011445678 6:87436561-87436583 AGTCATCTGAGGAGGGTGGGGGG + Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014763108 6:125379699-125379721 ATTCATCTACACATGATGGCAGG + Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015525005 6:134167751-134167773 AGTCAACAGCAGAGCATGACCGG + Intergenic
1015862089 6:137691813-137691835 AGTTATCTGTGGATGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1016835272 6:148470674-148470696 AGTCATCTGGAAAGGATCGGGGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1020315236 7:6901085-6901107 AGACATCAGCAGATGCTGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027626584 7:80552525-80552547 AGTCATATGCAGAGAATTGAAGG - Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028414764 7:90567783-90567805 GATCATCTGCAGGGGATGGGAGG + Intronic
1028582682 7:92423539-92423561 AGTCATCTGGAGAGGAAGGCTGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029690099 7:102175567-102175589 AGGCAGGTGCAGAGGCTGGCAGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030479471 7:110084029-110084051 AGTTTTCTGCAAAGGATGCCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032991619 7:137400669-137400691 TGTCAGCTGCAGAGGATGAAAGG - Intronic
1033296581 7:140143347-140143369 TGTCATCTGAAAAGGATGGCAGG + Intronic
1033599514 7:142878498-142878520 AGTCATATGCACAGGCTAGCAGG + Intronic
1034876875 7:154732625-154732647 AGTCATCAGCCTGGGATGGCAGG + Intronic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1036747490 8:11420245-11420267 AGGCAGCTGCAGAGGCTGGCGGG - Intronic
1037078764 8:14756518-14756540 AGTCATCTGCAGAGTACTGTGGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037917592 8:22781860-22781882 TGTCACCTGCAGAAGATGCCTGG - Intronic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1039968302 8:42299635-42299657 GGTCACGTGCAGAGGTTGGCAGG - Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044892819 8:96855336-96855358 AGGCAGCTGCTGAGGAGGGCTGG + Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047884308 8:129231650-129231672 AATCATCTGTGAAGGATGGCAGG + Intergenic
1050277792 9:4018132-4018154 AGTCATCTGAAAAGGAAGGCAGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052301745 9:26959735-26959757 AGTCATCTGCTGAGAGTGGCAGG + Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052847397 9:33349372-33349394 AGTAATGTGGAGAGGATGACAGG + Intronic
1052965876 9:34340342-34340364 ATTCATCTGCAGATTGTGGCAGG + Intronic
1053293898 9:36899729-36899751 AGTGACTTGCAGAGGATGCCTGG - Intronic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056106519 9:83352600-83352622 TGTCATCTTCAGATGATGGAAGG - Intronic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056450383 9:86710962-86710984 AGTGATCTGCAGAGCCAGGCTGG + Intergenic
1056801332 9:89694113-89694135 GGTCATGCTCAGAGGATGGCCGG + Intergenic
1057001632 9:91515168-91515190 AGTCATCTGCATTGCGTGGCTGG + Intergenic
1057004945 9:91548846-91548868 AATTATCTGCAGAGGATGAGAGG + Intergenic
1057177005 9:93007769-93007791 AGTCACCTTCAGGGAATGGCTGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058460872 9:105181425-105181447 AGTCCTCTCCAGAGGAACGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062552456 9:137095874-137095896 AGTCATCTGCAAAGTGAGGCAGG - Intronic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189219798 X:39361826-39361848 AGTCATCTGGAGAGGCTGAGAGG + Intergenic
1189648769 X:43165156-43165178 TGTCATCTCCAGAGGATGTAAGG + Intergenic
1189733786 X:44048951-44048973 AGTGAACAGCAGAGGAGGGCTGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190446475 X:50530385-50530407 AGTCATGGGCAGAGAATAGCTGG - Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191921585 X:66262423-66262445 AGTCATCTGCTGAGAATGAAAGG + Intronic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194155338 X:90380963-90380985 AGTCATCTTCAGAGAATGACAGG + Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200274692 X:154720661-154720683 TGTCATCTTCAGAGGATGTAAGG + Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200501688 Y:3957896-3957918 AGTCATCTTCAGAGGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201767607 Y:17587171-17587193 AGTCCTGTGGAGAGAATGGCTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201833946 Y:18318814-18318836 AGTCCTGTGGAGAGAATGGCTGG + Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic