ID: 965893708

View in Genome Browser
Species Human (GRCh38)
Location 3:173546801-173546823
Sequence TCCAAGATATAGAACATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965893708 Original CRISPR TCCAAGATATAGAACATTGG TGG (reversed) Intronic
900774633 1:4573285-4573307 AACAAGATATAGAATGTTGGCGG - Intergenic
907015666 1:51010367-51010389 TCCACCATATAGATCATGGGTGG - Intergenic
907624810 1:56019226-56019248 TCCAAAATAAAGAACATGTGTGG - Intergenic
909946143 1:81665557-81665579 TCCCAGATATAGAGCCATGGAGG - Intronic
910135376 1:83962252-83962274 ACCAAGATATGGAACATAAGAGG - Intronic
913059107 1:115188468-115188490 TCAAATATATAGAACAGTGCTGG + Intergenic
916085590 1:161266667-161266689 TCTGAGATATAGGGCATTGGGGG + Intronic
917045624 1:170856841-170856863 TACAAGAAAAAGAACATTAGTGG + Intergenic
922643641 1:227262489-227262511 TACATGATATATAAAATTGGAGG - Intronic
1063723699 10:8613358-8613380 TTCAAGAAATAAAACAGTGGTGG - Intergenic
1064910316 10:20394257-20394279 TCCAAGAGATAGCACGTGGGAGG + Intergenic
1065436021 10:25704678-25704700 TCCATGATAGAGAAAATTCGTGG + Intergenic
1066556091 10:36615264-36615286 ACAAAGAGATAGAACTTTGGAGG - Intergenic
1068690894 10:59912674-59912696 GTCAAGATATTGAACATTTGTGG - Intergenic
1073194730 10:101680561-101680583 TTCACAATATAAAACATTGGAGG + Intronic
1073795917 10:106988254-106988276 TCCAAGTTCTAAAACGTTGGTGG + Intronic
1080235117 11:30059237-30059259 CCCAAAATTTAGAACAGTGGAGG + Intergenic
1080768157 11:35316120-35316142 TCTAAGATATATAATTTTGGAGG + Intronic
1081481335 11:43492289-43492311 TCCATAAAATATAACATTGGTGG - Intronic
1082188996 11:49219145-49219167 TACAAGATATAGAAGAATGGAGG - Intergenic
1082890185 11:58130827-58130849 TCCTAGAAACAGAACAATGGGGG - Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1090621840 11:128567435-128567457 TCCAATTTATACAACATTGAAGG + Intronic
1091065052 11:132501868-132501890 TTCAAGATATAGCAGATAGGAGG - Intronic
1093197188 12:16143417-16143439 GCCAAGATAGAGAACACAGGAGG - Intergenic
1094125466 12:27018484-27018506 TCCAAGATATGCATCATTAGAGG + Intergenic
1095189836 12:39244835-39244857 TCCAAATTATAGAACTTTGGAGG - Intergenic
1098865906 12:75763174-75763196 TCCAAGAGATAAAATATTGAAGG - Intergenic
1098931788 12:76425381-76425403 TCAAAGATATAGTGCATTGTTGG - Intronic
1100175166 12:92022109-92022131 TCCAAGATAAAGAAAAATGTGGG + Intronic
1101888055 12:108686416-108686438 TCTAAGCTTTAGAAGATTGGTGG - Intronic
1107992269 13:45829304-45829326 ATCAAGATATAGAACATGGCTGG + Intronic
1108406288 13:50105836-50105858 TACAATATATATAACATTTGAGG - Intronic
1109851724 13:68074748-68074770 TCTAACATCTAGAATATTGGAGG - Intergenic
1110644779 13:77869668-77869690 TTCAAGATAAAGAACATTTTTGG + Intergenic
1111456066 13:88486059-88486081 TGCAAGAAATAGAAAATTGGAGG - Intergenic
1112533338 13:100225700-100225722 TCCAAAATATAAAACCTTTGAGG - Intronic
1113738497 13:112694762-112694784 TCTAAGATAGAAAACATTGAAGG + Intronic
1114836439 14:26208259-26208281 TCCAAAACATATATCATTGGGGG + Intergenic
1115636836 14:35298130-35298152 TTTAAGATTTAGAAAATTGGGGG + Intronic
1116122118 14:40734144-40734166 ACCAGGATATAAAAGATTGGAGG + Intergenic
1116368401 14:44099322-44099344 TGCAAGCTACAGAACATTTGAGG - Intergenic
1118202125 14:63685505-63685527 TCCATGATGTTGAACATGGGAGG - Exonic
1119913493 14:78373131-78373153 TCAAATATATTAAACATTGGAGG + Intronic
1119939073 14:78621133-78621155 ACCAAGATCTAGAGCATTGAGGG + Intronic
1125499183 15:40227750-40227772 TCCATGGTATAGGCCATTGGGGG + Intergenic
1126858298 15:52860022-52860044 TCTAAGATGGAGAACATTTGGGG + Intergenic
1127198968 15:56622733-56622755 TCCAAGAAATAGCACAATGTAGG - Intergenic
1130399716 15:83538460-83538482 TTCAAGATATAGAACATTAGTGG + Intronic
1132380036 15:101359998-101360020 TCCTAGATCTGGAACATTGCAGG - Intronic
1139144813 16:64310394-64310416 TTCAAGGTATAGAGCTTTGGAGG + Intergenic
1140607386 16:76556098-76556120 TCTAAGATGTAGAACATAGGGGG - Intronic
1142331447 16:89456657-89456679 TCCAAGACATACAACATAGATGG + Intronic
1143890635 17:10099554-10099576 TCCAAAAAAAAGTACATTGGAGG - Intronic
1147910820 17:43854943-43854965 TCCAAGGTATAGAAAGGTGGTGG + Intronic
1151648195 17:75448234-75448256 TCCCAGCTATAGTACATGGGAGG - Intronic
1156829355 18:41471890-41471912 TATAACATATATAACATTGGAGG - Intergenic
1166024639 19:40070407-40070429 TCAAAGAAACAGAAGATTGGTGG - Intronic
1166644260 19:44519528-44519550 ACCAAGATGGAGAAGATTGGGGG - Intronic
1167554437 19:50185038-50185060 TCAAAGATACAGAAAATTTGGGG - Intergenic
1168017443 19:53584847-53584869 GCCAAAATAAAGAACAGTGGAGG + Intergenic
925589009 2:5491821-5491843 TCCAAGATTTACAACATGAGTGG - Intergenic
927072446 2:19545060-19545082 GCCAAAATATTGAATATTGGTGG - Intergenic
927341350 2:21986869-21986891 TTAAAGATATTGAACATTGGAGG - Intergenic
930158309 2:48127714-48127736 TCCGAGATAGAGAACACAGGAGG + Intergenic
931308401 2:61055168-61055190 TAAAAGATATAAAACATTGGGGG - Intergenic
935538685 2:104324310-104324332 TCCAAGATTTGGAACTGTGGTGG - Intergenic
936654887 2:114473644-114473666 TCCCAGATATTGAACCTTAGAGG + Intronic
939808433 2:146803849-146803871 AGCAAGAGATAGAAAATTGGTGG + Intergenic
940138387 2:150464960-150464982 TGCAAGGCATAGAATATTGGAGG - Intergenic
940629245 2:156216923-156216945 TCCAAGCTACAAAAGATTGGGGG + Intergenic
940793493 2:158052788-158052810 TCCCAGATAGTAAACATTGGAGG + Intronic
940917374 2:159271572-159271594 GTCAAGAAATAGAACATTGCTGG - Intronic
941224307 2:162827123-162827145 CTCAAGATGTAGAAAATTGGAGG + Intronic
947811231 2:233005163-233005185 TCCCAGAAATGGCACATTGGGGG - Intronic
1173371132 20:42437034-42437056 TACAAGATTTAGAAGAGTGGAGG + Intronic
1173876582 20:46376090-46376112 GCTATGATACAGAACATTGGGGG + Intronic
1176874089 21:14109521-14109543 TCCAAGATATAGAATACTTTAGG - Intronic
1177253417 21:18626889-18626911 TGCAAGATAGAGAACATTCTTGG - Intergenic
1183264265 22:36815973-36815995 CCCAAGATACAGAAAATTGCAGG - Intronic
1183432957 22:37776780-37776802 ACCATGATATAGAACATTTCTGG - Intergenic
951371026 3:21848150-21848172 TCCATGATGTAGAATATTGCAGG + Intronic
951407945 3:22324612-22324634 TCCAATATATAGATAATTTGGGG - Intronic
952130021 3:30350717-30350739 TCCAGCACAAAGAACATTGGTGG - Intergenic
952172986 3:30830071-30830093 TCCAAAATATGGCACCTTGGAGG + Intronic
952611269 3:35213457-35213479 TCCAACACAAATAACATTGGAGG - Intergenic
954601987 3:51877383-51877405 ACCAAAATACAGAACATTGCAGG - Intergenic
956669809 3:71676359-71676381 GCCAAGAAATAGAACTTTGCCGG - Exonic
958673395 3:97233457-97233479 AGCAAGATATAGAACTTTTGGGG + Intronic
959322349 3:104892709-104892731 TTCAAGATATAGAATTTGGGAGG + Intergenic
960429180 3:117547774-117547796 TTTAAAATATAGAACATTAGTGG + Intergenic
960547450 3:118932537-118932559 TCTAAGATAAATAACATTAGGGG + Intronic
960696698 3:120403165-120403187 GCCAAGATAGAGAGGATTGGTGG - Intronic
962899667 3:139749104-139749126 TCCAAGATATAGTACATGTTAGG - Intergenic
963416078 3:144997578-144997600 TCCAAGACAGAAAAGATTGGTGG - Intergenic
964450982 3:156813119-156813141 TGCAAGACAGGGAACATTGGGGG - Intergenic
965893708 3:173546801-173546823 TCCAAGATATAGAACATTGGTGG - Intronic
965953359 3:174337719-174337741 TCCAACATATAGTATTTTGGTGG - Intergenic
966623146 3:181987265-181987287 TCCAAGAGATAGAATATTCTTGG - Intergenic
970718004 4:18950547-18950569 TCCAAGATCTAAACCATTGAAGG + Intergenic
972205454 4:36766543-36766565 TGCAAGATTTAGAAGATTGCAGG + Intergenic
973984246 4:56335158-56335180 TCCTGGATATAGCACACTGGTGG + Intergenic
974468105 4:62283708-62283730 ATCAAGATATAGAACATTTCTGG - Intergenic
975167404 4:71192798-71192820 ACCAAAATATAGACCATTGCTGG + Intronic
977037595 4:91975252-91975274 TCCTAGATATACAGCCTTGGTGG + Intergenic
977468538 4:97412973-97412995 TCCAAGTAAAAGAACATTTGAGG - Intronic
978619708 4:110626434-110626456 TCCAATACGGAGAACATTGGTGG + Intronic
978869647 4:113559963-113559985 TCCAGGTTCTGGAACATTGGGGG + Intronic
979910373 4:126358052-126358074 TTAAATATATAGAACATAGGTGG + Intergenic
980885529 4:138758561-138758583 ACCAAGATATAGAACAGAGGTGG - Intergenic
981279862 4:142945533-142945555 ACCAAGATAGAGAGCCTTGGGGG - Intergenic
982127145 4:152193858-152193880 CCCAATATATAGCACCTTGGAGG + Intergenic
982367840 4:154599379-154599401 TCCAGTATATAGATCATTAGTGG + Intergenic
982619092 4:157680295-157680317 TGTAAGATATAAAAGATTGGTGG - Intergenic
986470471 5:8068712-8068734 TCCTAGATATTGAACAGTGATGG + Intergenic
986565291 5:9107472-9107494 ACCAAGGTATAGAACATTGTGGG - Intronic
986902636 5:12455373-12455395 TTCAAAATATTGAACATTGGAGG - Intergenic
987400197 5:17467146-17467168 TAAAATATATACAACATTGGGGG - Intergenic
990256494 5:53976017-53976039 TCCAATAAACAGAACATTGATGG - Intronic
991703990 5:69340669-69340691 TCCAAAATTTAGAACTGTGGAGG + Intergenic
995240664 5:109882552-109882574 TCAAGGATACAGAATATTGGAGG - Intergenic
1001883958 5:175271495-175271517 TCTAATATATAGCAAATTGGTGG + Intergenic
1005336388 6:24800811-24800833 TCCAAGATATAGAAACTGAGAGG - Intronic
1005812836 6:29529844-29529866 CCCAAGAGGTAGAACAGTGGTGG - Intergenic
1009836722 6:69010604-69010626 TTCAAGATATAAAGCATAGGTGG + Intronic
1010768486 6:79802768-79802790 TCCAAGATGGAGAAGAGTGGAGG - Intergenic
1012872150 6:104685062-104685084 TCCAACATATGGTACATTGCCGG - Intergenic
1013445198 6:110218875-110218897 ATCAAGATCTAGAACATTTGCGG + Intronic
1014515697 6:122375792-122375814 TCCAAGATATCCAACATAAGAGG + Intergenic
1015297575 6:131615334-131615356 TTCAAGGTCTAGAGCATTGGAGG + Intronic
1017625214 6:156341050-156341072 TCCTAGATATTGAAGATGGGAGG + Intergenic
1021124834 7:16839430-16839452 GCCAAGAAATAAAACAGTGGTGG - Intergenic
1022578360 7:31521761-31521783 CCCAAGCTATAGTACAGTGGCGG + Intronic
1026336899 7:69401967-69401989 TCAAAGAAATAGAACAGTGTGGG + Intergenic
1028587094 7:92463196-92463218 TCATAGATACAGAACATTAGAGG + Intergenic
1028756393 7:94439941-94439963 ACCCAGATAAAGAACATTGTTGG + Intergenic
1029626939 7:101725776-101725798 TCCTAGATACAGACCATTAGTGG - Intergenic
1030766692 7:113419249-113419271 GCCAAGATATGGAATACTGGAGG + Intergenic
1031822175 7:126516679-126516701 TCTAAGAAAGAGAACATGGGAGG + Intronic
1032349428 7:131146627-131146649 TGCAACAAATACAACATTGGCGG + Intronic
1033137334 7:138796356-138796378 TCTAAGATATAAAATAGTGGTGG - Intronic
1033246238 7:139718638-139718660 TACAAGAGAAAGAACAGTGGTGG - Intronic
1033677699 7:143559908-143559930 TCCAAGATATGTCACAGTGGAGG + Intergenic
1033694136 7:143769532-143769554 TCCAAGATATGTCACAGTGGAGG - Intergenic
1038628575 8:29218573-29218595 TCTAAGATACAGAGCTTTGGAGG + Intronic
1039894301 8:41705363-41705385 TCAAAGATCCAGAACATTCGTGG + Intronic
1040847012 8:51854387-51854409 TCTAAGAAATAGAACAGTGGTGG + Intronic
1041185150 8:55291488-55291510 TGAAAGATATACCACATTGGTGG - Intronic
1042798647 8:72692510-72692532 TTAATGTTATAGAACATTGGAGG - Intronic
1046442683 8:114279552-114279574 TCCAAGGGATAGAAGGTTGGTGG - Intergenic
1052149442 9:25096111-25096133 TACAAGATATAGAAATTTGATGG + Intergenic
1052161608 9:25267874-25267896 TCAAACATATAGAACTTTAGTGG + Intergenic
1058390286 9:104488732-104488754 TCCATGATATACAACTTTTGGGG + Intergenic
1187294745 X:17987821-17987843 GCCAAGCTATGGAACAATGGAGG - Intergenic
1187868411 X:23744076-23744098 CCCAAGATATCAAACATTGGGGG - Intronic
1189508845 X:41640500-41640522 ACAAAGATATAGAACAATGGAGG - Intronic
1190532972 X:51398679-51398701 ACCAAAATATAGAACATTACTGG + Intergenic
1192130006 X:68540948-68540970 TCCAAAATAAGGAACATAGGAGG - Intergenic
1194006084 X:88494353-88494375 TTCAAGATAGAGCACATTTGAGG - Intergenic
1196071232 X:111524834-111524856 ACTGAGATATAGAACAATGGAGG + Intergenic