ID: 965897109

View in Genome Browser
Species Human (GRCh38)
Location 3:173591985-173592007
Sequence ATTTTCTTCTGTGGGATCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965897106_965897109 13 Left 965897106 3:173591949-173591971 CCAGGCTGTCTCTTCTGAGCTCT 0: 1
1: 0
2: 2
3: 48
4: 401
Right 965897109 3:173591985-173592007 ATTTTCTTCTGTGGGATCACAGG 0: 1
1: 0
2: 1
3: 33
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965897109 Original CRISPR ATTTTCTTCTGTGGGATCAC AGG Intronic
900698561 1:4028306-4028328 ATTTGCTTCTGCGGCATCCCAGG + Intergenic
901721819 1:11204703-11204725 ATTGTCACCTGTGGGATCACAGG - Exonic
901973152 1:12924199-12924221 ATGCTCTGCTGTGGGACCACAGG - Intronic
902012028 1:13277564-13277586 ATGCTCTGCTGTGGGACCACAGG + Intergenic
902084039 1:13843572-13843594 ATTTTTTCCTGTGGGATCAGTGG + Intergenic
902369142 1:15994443-15994465 ATTCTCTTCGGTGGGAGCACTGG - Intergenic
902509510 1:16958568-16958590 ATCTTCATCTGTGAGAGCACGGG - Exonic
904158642 1:28505766-28505788 GTTTACTTCTGTGCAATCACTGG - Intergenic
905896729 1:41551697-41551719 TTGTTTTTCTGTGGGATCAGTGG + Intronic
907532305 1:55113204-55113226 TTTTGTTTCTGTGGGATCAGTGG - Intronic
907557703 1:55359127-55359149 ATGATCTTCTGTGGCATCCCTGG - Intergenic
907912431 1:58838271-58838293 ATTTTCTCCTGTGGCATCAGTGG + Intergenic
909894529 1:81050706-81050728 ATTTTTTTCGGGGGCATCACAGG - Intergenic
910026690 1:82663227-82663249 CTGGTTTTCTGTGGGATCACAGG - Intergenic
910044642 1:82897595-82897617 ATTGCCTTCTGTGGGAACTCAGG + Intergenic
910295254 1:85637660-85637682 CTGTTCTTGTGTGGGATTACAGG - Intergenic
910427181 1:87129743-87129765 ATATTCTGATGGGGGATCACAGG - Intronic
911691739 1:100842436-100842458 TTGTTTTTCTGTGGGATCAGTGG + Intergenic
911700303 1:100944800-100944822 ATAATCCTTTGTGGGATCACTGG + Intronic
911816296 1:102356965-102356987 TTGTACTTCTGTGGGATCAGTGG - Intergenic
911982925 1:104588304-104588326 TTGTATTTCTGTGGGATCACGGG - Intergenic
912735925 1:112149546-112149568 CTTGTCTTCTGTGTGCTCACAGG - Intergenic
913033402 1:114935726-114935748 TTGTATTTCTGTGGGATCACTGG - Intronic
913933597 1:125010897-125010919 TTTTATTTCTGTGGGATCAGTGG - Intergenic
914668119 1:149849504-149849526 GTTTTCTGCTTTGGGAACACTGG - Intronic
916625262 1:166548953-166548975 TTTGTATTCTGTGGGATCAGTGG + Intergenic
916767956 1:167880141-167880163 ATTGTCTTCTGTGGGATCGTTGG - Exonic
917324189 1:173815008-173815030 TTGTATTTCTGTGGGATCACTGG - Intronic
917467179 1:175290612-175290634 TTTTTCTTCTGTGAGATCAGTGG - Intergenic
918831581 1:189405381-189405403 ATTGACTTCTGTGTGCTCACAGG + Intergenic
918841535 1:189546870-189546892 ATTTTTTTGTGTGGAATTACTGG - Intergenic
918897531 1:190367243-190367265 ATTTACTTCTGTGGACCCACAGG + Intronic
919136271 1:193511531-193511553 TTGTTTTTCTGTGGGATCAGTGG + Intergenic
919338043 1:196265527-196265549 AATTCCTACTGTGTGATCACTGG + Intronic
919461374 1:197881499-197881521 TTTTATTTCTGTGGGATCAGTGG + Intergenic
919523634 1:198620608-198620630 ATTTTGTTCATTGGGATCAGTGG + Intergenic
920447746 1:206032323-206032345 TTTTTCTTCTGTGGGTTTCCAGG - Intergenic
921296539 1:213709368-213709390 TTTGTATTCTGTGGGATCAATGG + Intergenic
922066522 1:222149018-222149040 TTTTATTTCTGTGGGATCAGTGG - Intergenic
923731652 1:236556909-236556931 TTTTTCTTCTGTGAGATCTTTGG - Intronic
923737760 1:236627685-236627707 ATTTTCTTCTGTGGATTGATGGG + Intergenic
1063170901 10:3509058-3509080 CTTTTCTTCTGAGCCATCACCGG - Intergenic
1063352513 10:5368465-5368487 ATTTTCCTCTGTGAGAGCAGGGG - Intronic
1063696125 10:8336787-8336809 CTTTTCTGCCGTGAGATCACAGG - Intergenic
1065059614 10:21886153-21886175 TTTTACTTCTGTGGGGTCAGTGG - Intronic
1065224623 10:23531162-23531184 CATTTCTTCTGTGGTTTCACTGG + Intergenic
1068360012 10:55965668-55965690 CTTTTCTTCTGAGTGCTCACTGG - Intergenic
1068425518 10:56857428-56857450 ATTTTTTTCCATGGGATTACTGG + Intergenic
1068556784 10:58467208-58467230 CTTGTCTTCTGTGGGAGCAGAGG - Intergenic
1069058589 10:63870202-63870224 ATTATTTTCTGTGTGAACACAGG + Intergenic
1069241304 10:66143338-66143360 ATTTTCTTCAGAGGGCTAACTGG + Intronic
1069349833 10:67512014-67512036 TTTTATTTCTGTGGGATCAGTGG + Intronic
1070709534 10:78669703-78669725 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1071214894 10:83389791-83389813 CTTTACTTCTGTGGGGTCAGTGG - Intergenic
1072406038 10:95154206-95154228 ATGTATTTCTGTGGGATCATTGG - Intergenic
1072406879 10:95163131-95163153 ATGTATTTCTGTGGGATCAGTGG + Intergenic
1073032750 10:100540612-100540634 ATTTTCTTCTTGGGGAACATAGG + Exonic
1073300345 10:102467541-102467563 ATTTTCTTCAGGGGGTTCAAGGG + Intronic
1076369744 10:129944527-129944549 ATTTCCTTCTGCTGGATCAGTGG - Intronic
1076573581 10:131449173-131449195 GTTCTCTGCTCTGGGATCACTGG + Intergenic
1078731659 11:13980388-13980410 CTTTACTTTTGTGGGATAACCGG + Intronic
1079784118 11:24649274-24649296 AGTTACTTCTTTGGGATCCCTGG - Intronic
1079944451 11:26724577-26724599 ATTTTCTTCTCTTTGATCCCAGG - Intergenic
1080933564 11:36838559-36838581 ATTTCTTTCTATGGGATCCCTGG + Intergenic
1081166357 11:39813252-39813274 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1081343909 11:41959185-41959207 TTTTTTTTCTGTGGGGTCATTGG - Intergenic
1081524084 11:43912220-43912242 ATTTGCTTCTGTTGGAACAAAGG + Intronic
1082102901 11:48188565-48188587 TTTTATTTCTGTGGGATCAATGG + Intergenic
1082152968 11:48764868-48764890 TTTTTTTTCTGTGGGATCAGTGG + Intergenic
1083499533 11:63091077-63091099 TTGTACTTCTGTGGGATCAGTGG - Intronic
1083515929 11:63258635-63258657 TTGTATTTCTGTGGGATCACTGG + Intronic
1086818635 11:91406344-91406366 ATTTTGGGCTTTGGGATCACTGG - Intergenic
1086933826 11:92722735-92722757 ATTTACTTCTGTGCACTCACAGG + Intronic
1087378784 11:97378228-97378250 TTGTTTTTCTGTGAGATCACTGG - Intergenic
1087410239 11:97782275-97782297 TTGTATTTCTGTGGGATCACTGG + Intergenic
1087668111 11:101073653-101073675 TTGTATTTCTGTGGGATCACTGG - Intronic
1087716606 11:101615499-101615521 ATACTCTTCTGTGGAATGACTGG - Intronic
1088069789 11:105768116-105768138 ATGGTCTTTTGTGTGATCACAGG + Intronic
1088616405 11:111633903-111633925 ATTTTTTCCTCTGGAATCACAGG + Intronic
1089037567 11:115410846-115410868 CTTTTCTTCTATGGGTTCTCTGG + Intronic
1089369732 11:117946965-117946987 ATGTTCTTCACTGGGATCAGTGG - Intergenic
1090495639 11:127209320-127209342 TTGTATTTCTGTGGGATCACTGG - Intergenic
1091097359 11:132836910-132836932 ATTTACATATGTAGGATCACTGG - Intronic
1091244916 11:134084047-134084069 TTTTTCTACTGGGGGATCACAGG + Intronic
1091712043 12:2748998-2749020 TTGTATTTCTGTGGGATCACTGG + Intergenic
1093377821 12:18452389-18452411 TTATACTTCTGTGGGATCAGTGG + Intronic
1093896732 12:24583201-24583223 TTTTTCTTCTCTGGGATCCCAGG - Intergenic
1094452805 12:30600626-30600648 ATTTTCCTCTCTGGGATCTGAGG - Intergenic
1095796354 12:46223199-46223221 ACTTTCTAATGTGTGATCACAGG + Intronic
1096000195 12:48122936-48122958 TTATTCTTCTGTAGGTTCACGGG + Intronic
1097654098 12:62340204-62340226 TTTTATTTCTGTGGGATCAGTGG + Intronic
1097851043 12:64409970-64409992 AAATTCTTCTGTGGGATCAGAGG + Exonic
1098421408 12:70302038-70302060 ATGTATTTCTGTGGGATCAGTGG + Intronic
1098780453 12:74679710-74679732 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1099485961 12:83229647-83229669 TTGTTTTTCTGTGGGATCAGTGG + Intergenic
1099878742 12:88440281-88440303 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1100319250 12:93474779-93474801 ATTTTCTTGTTTGACATCACTGG - Intronic
1101075307 12:101123171-101123193 ATTTTCTTCTTTTGGTTCCCTGG - Intronic
1104653113 12:130551835-130551857 ATCCACTTCTGTGGGATGACTGG - Intronic
1104886729 12:132114664-132114686 AATGGCTTCTGTGGGCTCACGGG + Intronic
1106746035 13:32708254-32708276 ATTTTCTTCTGCCCTATCACTGG + Intronic
1107244640 13:38279188-38279210 TTTTATTTCTGTGGGATCAGAGG - Intergenic
1107973451 13:45666880-45666902 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1108861435 13:54864641-54864663 ATTTTCTTCCATGGTATCACTGG + Intergenic
1110246550 13:73331584-73331606 GTTTTCTTCTGTGGGTTCCAGGG - Intergenic
1111042291 13:82765070-82765092 GTTTTCTTCTATAAGATCACAGG + Intergenic
1112233312 13:97610929-97610951 TTGTTTTTCTGTGGGATCAGAGG - Intergenic
1112619865 13:101043761-101043783 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1112672412 13:101655291-101655313 ATTTTCTTATGTGGGAGGAGTGG + Intronic
1113120870 13:106922608-106922630 ACGTTCTGCTGTGGGATCTCAGG - Intergenic
1114251801 14:20968332-20968354 GTTTTCATCAGTGGGATCAATGG - Intergenic
1114509161 14:23242639-23242661 ATTTTCTTCTGTGGGACAGAAGG - Intronic
1114603393 14:23974571-23974593 GTGTATTTCTGTGGGATCACTGG - Intronic
1114747928 14:25170373-25170395 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1115052857 14:29085824-29085846 AGTGTCTTCTGTGGGTTCCCAGG - Intergenic
1115313040 14:31998229-31998251 ATTTTTCTTTATGGGATCACAGG - Intergenic
1116119865 14:40708917-40708939 TTTTTTTCCTGTGGGATCAGTGG - Intergenic
1117671698 14:58114192-58114214 ATTTCCTTCTGTGGGAAGTCAGG + Intronic
1117887926 14:60384966-60384988 TTGTTTTTCTGTGGGATCAGTGG - Intergenic
1118180054 14:63483620-63483642 ATTTTCTGCTGTGGGGTCCAAGG + Intronic
1118537412 14:66783229-66783251 ACTTACTTCTGTGGGATGGCAGG - Intronic
1119312485 14:73660622-73660644 ATATCCATCTGTGGGATCAAAGG + Intronic
1120449764 14:84652443-84652465 TTGTATTTCTGTGGGATCACTGG + Intergenic
1120586261 14:86315536-86315558 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1120842847 14:89101598-89101620 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1202842566 14_GL000009v2_random:135897-135919 ATGTATTTCTGTGGGATCAGTGG + Intergenic
1124155410 15:27220738-27220760 ATTTATTTCTCTGGGGTCACTGG + Intronic
1128687045 15:69694575-69694597 CTTTTCTTCTTTGGGAGCAGGGG + Intergenic
1128818458 15:70630978-70631000 ATTTTATTCTGTGGGCCCTCGGG + Intergenic
1133081274 16:3322285-3322307 TTTTTCTTGTGTGGGTTCACTGG + Intergenic
1134052141 16:11144739-11144761 ATTCTCTTCTGTAGGAGCAGTGG + Intronic
1134557590 16:15179022-15179044 ATTTTATTTTTTTGGATCACAGG - Intergenic
1134918157 16:18090705-18090727 ATTTTATTTTTTTGGATCACAGG - Intergenic
1137534884 16:49312714-49312736 ATTTTCTGCTGGGGGTTAACAGG - Intergenic
1141244934 16:82297096-82297118 ATTTTCAACTGTGGGATTGCTGG + Intergenic
1141259620 16:82440716-82440738 ATTTTATTCTGCGAGACCACAGG + Intergenic
1141836306 16:86542042-86542064 ATTCTCTTCTGAGGGAGCAGGGG - Intronic
1144372066 17:14601095-14601117 TTGTACTTCTGTGGGATCAGTGG - Intergenic
1144735993 17:17555752-17555774 ATTTGCTTCTGTGTGATCGGAGG - Intronic
1145100970 17:20076691-20076713 ATTTTCAGATGTGGGATTACTGG + Intronic
1145410037 17:22651515-22651537 ATTTTATTCATTGTGATCACTGG - Intergenic
1146406920 17:32546667-32546689 ATTTTCATATTTGGGAGCACAGG - Intronic
1147537347 17:41329220-41329242 ATTCTCTTTGGTGGGAGCACTGG - Intergenic
1148539212 17:48466477-48466499 TTTTTCTTTTGGGAGATCACTGG + Intergenic
1149071196 17:52545266-52545288 ATTTTCTTACCTGGGATCACAGG + Intergenic
1149257606 17:54844442-54844464 ATTTCCATCTGTGTGATCAAAGG - Intergenic
1151340275 17:73466641-73466663 TCTTTCTTCTGTGGGCTCCCAGG - Intronic
1153149505 18:2074880-2074902 ATTTTGGCCTGTGGTATCACTGG - Intergenic
1153789254 18:8563008-8563030 AATTTCTACTGTGGCTTCACAGG - Intergenic
1153790637 18:8576035-8576057 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1154087458 18:11321309-11321331 ATTTTCCTCTGAGGGCTTACAGG + Intergenic
1155240051 18:23856429-23856451 ATTCTCTTCTGTGGGACTAAGGG - Intronic
1155982052 18:32190779-32190801 ATTTTATTCTGTAGGTGCACTGG + Intronic
1156993019 18:43433001-43433023 ATTTTCTACTGTGCTATCATTGG - Intergenic
1158098938 18:53807495-53807517 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1158556173 18:58476439-58476461 AGTTTCATCTGTGAGATCACTGG - Intergenic
1159403546 18:67969873-67969895 ATTTTCTTCTGTGAGTACCCAGG - Intergenic
1159732064 18:72040419-72040441 CTTTTGTACTGTGGAATCACTGG + Intergenic
1163904810 19:20143205-20143227 ATTTACTTCTGTGTGAATACAGG + Intergenic
1164436399 19:28233798-28233820 ATTTACTTCTCATGGATCACTGG + Intergenic
1164688936 19:30193140-30193162 ATGTACTTCTGTGGGATCGGTGG - Intergenic
1166394980 19:42433048-42433070 ATTTTCTTCTCGGGGCTCTCAGG + Exonic
1167392514 19:49205238-49205260 GTTTTCTTCTGAGGGATGTCGGG + Intronic
1167962305 19:53115786-53115808 ATTATCCTATGTGGGAGCACAGG - Intronic
925953124 2:8934752-8934774 ATTCTCTCTTGTGGGATCATGGG + Intronic
926848279 2:17166212-17166234 ATTCCCTTCTGTGTGTTCACTGG - Intergenic
927006728 2:18858337-18858359 TTTTATTTCTGTGGGATCAGTGG + Intergenic
927521425 2:23700992-23701014 ATATTCAGCTGTGGGATCTCTGG - Intronic
928314366 2:30234317-30234339 ATTCACTGCTGTGGGATCAGGGG - Intronic
928833280 2:35514483-35514505 ATGTATTTCTGTGGGATCAGTGG + Intergenic
929333221 2:40709943-40709965 ATGTATTTCTGTGGGATCAGTGG + Intergenic
930061325 2:47291400-47291422 ATTTTGTTCTGTGTAATCTCAGG + Intergenic
930465146 2:51738017-51738039 TTTTATTTCTGTGGGATCAGTGG + Intergenic
930935907 2:56951267-56951289 TTTTATTTCTGTGGGATCAGTGG + Intergenic
933237818 2:79884934-79884956 ATTGTCTACTGGGGGAGCACGGG + Intronic
934485507 2:94705556-94705578 TTTTTTTTCTGTGGGATCAGTGG + Intergenic
936717662 2:115207631-115207653 GTTTCCCTCTGTGGCATCACAGG - Intronic
936939981 2:117874147-117874169 TTTTATTTCTGTGGGATCAGTGG + Intergenic
937633180 2:124126238-124126260 TTGTACTTCTGTGGGATCAGTGG - Intronic
937966009 2:127511264-127511286 ATTTTCTACTATGTGATCAAAGG + Intronic
938489272 2:131753556-131753578 ACTTTCGTCTGTGGGGTCCCAGG - Intronic
938951968 2:136263248-136263270 TTTTACTTCTGTGGGACCAGTGG + Intergenic
939717683 2:145605051-145605073 TTGTACTTCTGTGGGATCAGTGG + Intergenic
940167781 2:150793745-150793767 TTGTTTTTCTGTGGGATCAGTGG - Intergenic
940395472 2:153185276-153185298 TTGTATTTCTGTGGGATCACTGG + Intergenic
940564857 2:155348340-155348362 TTGTTTTTCTGTGGGATCAGTGG + Intergenic
940994514 2:160134227-160134249 TTTTATTTCTGTGGGATCAGTGG - Intronic
940996109 2:160151769-160151791 TTTTATTTCTGTGGGATCAGTGG - Intronic
941114727 2:161459315-161459337 TTGTTTTTCTGTGGGATCAGTGG + Intronic
941845618 2:170129244-170129266 TTGTTTTTCTGTGGGATCAGTGG - Intergenic
942504218 2:176624625-176624647 TTTTATTTCTGTGGGATCAGTGG + Intergenic
943112044 2:183618798-183618820 TTTTATTTCTGTGGGATCATTGG + Intergenic
943866255 2:192927985-192928007 TTTGTGTTCTGTGGGATCAGTGG + Intergenic
943871971 2:193011552-193011574 ACTTTCTTCTGTTGGCACACAGG - Intergenic
943885825 2:193215239-193215261 TTTTATTTCTGTGGGATCAGTGG + Intergenic
945528394 2:210919144-210919166 ATGTTCTTCTGTGGAACTACAGG + Intergenic
946009199 2:216551428-216551450 ATATTTTTCTTTGGGATCATGGG - Intronic
946523713 2:220495246-220495268 ATTGTATTCAGTGGCATCACTGG + Intergenic
946607956 2:221426561-221426583 ATTCTCTGCTGTGGTATCAGTGG - Exonic
948113825 2:235478588-235478610 TATTTCATCTGTGTGATCACAGG - Intergenic
1170229061 20:14025188-14025210 TTGTATTTCTGTGGGATCACTGG + Intronic
1170265377 20:14461244-14461266 TTGTACTTCTGTGGGATCAGTGG + Intronic
1170818825 20:19738950-19738972 GTTTTCTTCTTGGGGCTCACGGG - Intergenic
1171726359 20:28624761-28624783 CTTTTCTCCAGTGAGATCACAGG - Intergenic
1171790550 20:29519257-29519279 CTTTTCTCCAGTGAGATCACAGG - Intergenic
1172347571 20:34215936-34215958 AAATTCTTCTGTGGGATCAGAGG - Intronic
1173764675 20:45596644-45596666 TTTGACTTCTGTGGGAACACAGG - Intergenic
1173857167 20:46257921-46257943 ACTTTCTTCTGTTGGCTCCCAGG - Intronic
1174899498 20:54483893-54483915 ATTTTGTTCTCTGGGATCCAGGG - Intronic
1176316619 21:5251163-5251185 TTGTATTTCTGTGGGATCACGGG + Intergenic
1176333597 21:5574871-5574893 TTTTATTTCTGTGGGATCAACGG + Intergenic
1176394160 21:6246081-6246103 TTTTATTTCTGTGGGATCAACGG - Intergenic
1176467259 21:7070093-7070115 TTTTATTTCTGTGGGATCAACGG + Intronic
1176490820 21:7451871-7451893 TTTTATTTCTGTGGGATCAACGG + Intergenic
1176509822 21:7686512-7686534 TTTTATTTCTGTGGGATCAACGG - Intergenic
1179110002 21:38438130-38438152 ATTTTCTGCTGTTTAATCACGGG + Intronic
1179307270 21:40166259-40166281 TTTTTTTTCTGTGGCGTCACTGG - Intronic
1181379411 22:22488559-22488581 ATTTTCTTTCTTGGGATCAAAGG + Exonic
1181382192 22:22514818-22514840 ATTTTCTTTCTTGGGATCAAAGG + Exonic
1182381004 22:29887688-29887710 ATTTTCTTATGTTGGAGCAGTGG + Intronic
1182591697 22:31385964-31385986 TTTTATTTCTGTGGGGTCACTGG + Intergenic
1182781521 22:32872354-32872376 GTTTTCTTCTCTAGGATCGCAGG - Intronic
1182902382 22:33909246-33909268 ATTTTTCTCTGTTGAATCACTGG - Intronic
1184554009 22:45223040-45223062 AAATTCATCTGTGGGATCGCTGG - Intronic
949179948 3:1116967-1116989 ATTTCCCTCTGTGGCTTCACAGG + Intronic
949632274 3:5941372-5941394 TTGTTTTTCTGTGGGATCAGTGG + Intergenic
950227103 3:11244843-11244865 ATGTTCTTCAGTTGGATCAGTGG + Intronic
950817600 3:15722681-15722703 ATTTTCTTTTCTGGGATCACTGG + Intronic
951450261 3:22829648-22829670 ATTTATTTCTGTGGGAGCAGTGG - Intergenic
953047533 3:39307875-39307897 ATGTATTTCTGTGGGATCAGTGG - Intergenic
953092293 3:39740791-39740813 TTGTACTTCTGTGGGATCAGTGG + Intergenic
954779924 3:53051406-53051428 ATGTCCATCTGTGGGATTACAGG - Intronic
954908832 3:54086419-54086441 ATTTTCTTCAGGGGGAAGACTGG + Intergenic
955448110 3:59035515-59035537 TTGTTTTTCTGTGGGATCAGTGG - Intronic
955802804 3:62703558-62703580 TTTTTCTTCAGTGGGATTAGTGG + Intronic
955975840 3:64479119-64479141 TTATATTTCTGTGGGATCACTGG - Intergenic
956222262 3:66917070-66917092 TTTTATTTCTGTGGGATCAGTGG - Intergenic
956740488 3:72271944-72271966 CTTTTCTTCTGTGGGATTGGAGG - Intergenic
956870052 3:73407985-73408007 ACATTCTTGTGTGGGATGACAGG - Intronic
957681003 3:83435178-83435200 TCTTTCTTCTGTAGGTTCACTGG - Intergenic
957700375 3:83702551-83702573 ATGTATTTCTGTGGGATCAGTGG - Intergenic
958434224 3:94077757-94077779 TTGTATTTCTGTGGGATCACTGG + Intronic
958775752 3:98480808-98480830 TTTTATTTCTGTGGGATCAGTGG + Intergenic
959030799 3:101297214-101297236 TTTTAATTCTGTGGGATCAGTGG + Intronic
959376731 3:105596764-105596786 TTTTTGTTCTATGAGATCACTGG + Intergenic
961524857 3:127490343-127490365 ACTTACAGCTGTGGGATCACAGG - Intergenic
965897109 3:173591985-173592007 ATTTTCTTCTGTGGGATCACAGG + Intronic
966310863 3:178592125-178592147 ATTTTCTTCTTTGCTATTACTGG + Intronic
966574186 3:181480952-181480974 GTTTTTTTTTGTGGGATCAGTGG - Intergenic
966637474 3:182151798-182151820 ATGTATTTCTGTGGGATCAGTGG + Intergenic
966753501 3:183345742-183345764 TTGTTTTTCTGTGGGATCAGTGG - Intronic
968386745 4:147389-147411 ATCTTCTTCTGTTGGATCTCTGG + Intronic
968959850 4:3737936-3737958 TTGTTCTTCTGTGGGGTCTCAGG + Intergenic
971444141 4:26724378-26724400 ATATTATACTGTGGTATCACTGG + Intronic
973276566 4:48316285-48316307 TTTTACTTCTGATGGATCACTGG + Intergenic
974421397 4:61680869-61680891 TTTTTCTTGTTTGGGTTCACAGG + Intronic
975295863 4:72733678-72733700 TTTTATTTCTGTGGGATCAGTGG - Intergenic
975295877 4:72733878-72733900 TTTTATTTCTGTGGGATCAGTGG - Intergenic
975451292 4:74529919-74529941 ATTTTCTTCTTTGGTTGCACTGG + Intergenic
976438178 4:85043284-85043306 ATTTTTATCTGTGAGATCTCTGG + Intergenic
977793298 4:101132422-101132444 TTTTATTTCTGTGGGATCAGTGG - Intronic
978590975 4:110324639-110324661 TTTGTATTCTGTGGGATCAGTGG + Intergenic
978699479 4:111625538-111625560 TTTTATTTCTGTGGGATCAGTGG + Intergenic
979022557 4:115521890-115521912 TTTTATTTCTGTGGGATCAGTGG + Intergenic
979205961 4:118038300-118038322 GTTTTCTTCTCTTGCATCACTGG + Intronic
979921006 4:126496564-126496586 TTGTACTTCTGTGGGATCAGTGG - Intergenic
980149696 4:129030634-129030656 TTTTATTTCTGTGGGATCAGTGG - Intronic
980503699 4:133687997-133688019 TTGTATTTCTGTGGGATCACTGG + Intergenic
981062724 4:140443679-140443701 ATTTCCATCTGTGGGATTCCGGG + Intronic
981338257 4:143591057-143591079 TTTTATTTCTGTGGGATCAGTGG + Intronic
981671851 4:147295784-147295806 TTTTATTTCTGTGGGATCAGTGG - Intergenic
981692700 4:147527212-147527234 ATTATCTTGAGTGGGATTACTGG - Intronic
982826034 4:160004996-160005018 TTGTATTTCTGTGGGATCACTGG - Intergenic
982875121 4:160638536-160638558 TTTTATTTCTGTGGGATCAGTGG + Intergenic
984537398 4:180993939-180993961 GTTTTGTTCAGTGGGATCAAGGG - Intergenic
984903433 4:184605134-184605156 TTGTATTTCTGTGGGATCACTGG - Intergenic
985250449 4:188019200-188019222 AGTTTTTTCTTTGAGATCACAGG - Intergenic
985299545 4:188473318-188473340 ATATTCTTCTCTGGGTTCTCAGG + Intergenic
985434166 4:189912935-189912957 CTTTTCTCCAGTGAGATCACAGG + Intergenic
986713134 5:10502396-10502418 ACTTCCTTCTGTGGGAGCGCTGG - Intergenic
987392177 5:17386817-17386839 ATTTGCTTCTGTGGCCTCCCCGG + Intergenic
987530351 5:19110842-19110864 ATTTTATTCTGTGTCTTCACAGG + Intergenic
987674569 5:21058931-21058953 ATTTATTTCTGTGTGATCAGTGG + Intergenic
987687889 5:21228599-21228621 CTTGTTTTCTGTGGGATCAGTGG - Intergenic
988116324 5:26896991-26897013 TTGTATTTCTGTGGGATCACTGG - Intronic
989231590 5:39093298-39093320 ATTTTCTTCTGTGGGTTTGGAGG + Intergenic
989832073 5:45932381-45932403 TTTGTATTCTGTGGGATCAGTGG - Intergenic
989849962 5:46196601-46196623 TTGTTTTTCTGTGGGATCAGTGG - Intergenic
990657111 5:57969434-57969456 TTTTATTTCTGTGGGATCAGTGG + Intergenic
990823245 5:59867197-59867219 ATCTTCTTCTCTGGGATCAAGGG - Intronic
991126745 5:63078205-63078227 ATTTCCTTATGAGGGCTCACAGG - Intergenic
991544511 5:67766547-67766569 ATTTTCTACTGAGGAATCAATGG - Intergenic
992362667 5:76056826-76056848 TTGTTTTTCTGTGGGATCAGTGG + Intergenic
993002672 5:82397403-82397425 ATTTTCTTCTTTGGTCTCTCTGG + Intergenic
993119459 5:83756795-83756817 TTGTATTTCTGTGGGATCACTGG - Intergenic
993381567 5:87214676-87214698 TTGTTTTTCTGTGGGATCAATGG + Intergenic
993410281 5:87565457-87565479 TTGTCCTTCTGTGGGATCAGTGG + Intergenic
993444411 5:87993767-87993789 TTTTATTTCTGTGGGATCAGTGG - Intergenic
993497146 5:88620264-88620286 TTTTTTTTTTGTGGGATCAATGG + Intergenic
994847110 5:105003384-105003406 TTTTATTTCTGTGGGATCAGTGG + Intergenic
995475336 5:112542285-112542307 TTTTATTTCTGTGGGATCAGTGG - Intergenic
998311307 5:141135825-141135847 ATTTCCTTCTCTGGGAACTCTGG - Exonic
999052424 5:148537560-148537582 TTTTGTTTCTGTGGGATCAGTGG - Intronic
1001808993 5:174612675-174612697 ATTTTCTTCTGTGACAACACAGG - Intergenic
1004056352 6:12142707-12142729 TTTGTATTCTGTGGGATCAGTGG - Intronic
1004425457 6:15504061-15504083 CTTCTCTCCTGTGGGATCCCTGG + Intronic
1006799428 6:36750554-36750576 TTTTTCATCTGTGGGATGGCAGG - Intronic
1007437438 6:41825368-41825390 ACTTCCTTCTGTGGGATCTCAGG - Intronic
1008735289 6:54535904-54535926 ATTTTCTGCTCTGTTATCACTGG - Intergenic
1009652366 6:66492352-66492374 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1010172052 6:72986388-72986410 TTTTTCTTCTCTGGGAGCCCAGG - Intronic
1010421857 6:75685212-75685234 TTGTACTTCTGTGGGATCAGTGG + Intronic
1011201399 6:84840467-84840489 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1012148812 6:95719902-95719924 TTGTTTTTCTGTGGGATCAGTGG - Intergenic
1012560657 6:100577080-100577102 ATTTTTTTCTGTTGGAGCTCTGG - Intronic
1013069220 6:106713615-106713637 ATTTTTTTCTGTGGGCTCATAGG + Intergenic
1013302333 6:108815921-108815943 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1013357287 6:109357393-109357415 ATTTTCTTCATTGAAATCACAGG - Intergenic
1013848313 6:114482106-114482128 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1013930020 6:115519416-115519438 TTGTATTTCTGTGGGATCACTGG - Intergenic
1013973076 6:116043907-116043929 TTGTACTTCTGTGGGATCAGTGG - Intronic
1013984943 6:116179901-116179923 ACTTGCTTCAGAGGGATCACTGG - Intronic
1014175069 6:118323290-118323312 ATTTTCTTCAATGGAATCAGTGG + Intergenic
1014224906 6:118836664-118836686 ATGTATTTCTGTGGGATCAGTGG + Intronic
1014243935 6:119047549-119047571 TTTTATTTCTGTGGGATCAGTGG - Intronic
1014569338 6:122989525-122989547 TTGTACTTCTGTGGGATCAGTGG - Intergenic
1014810752 6:125882687-125882709 GTTTTCTTCTGTTGGATGCCTGG + Intronic
1015902183 6:138079264-138079286 CTGTATTTCTGTGGGATCACTGG - Intergenic
1016932785 6:149426604-149426626 GTTTTCTTCTGTGTGATCGTTGG + Intergenic
1017104673 6:150876309-150876331 TTTTGCTTCTTTGGGGTCACGGG + Intronic
1017160596 6:151362026-151362048 ATTATCTTCTGTGGGAACTGTGG + Intergenic
1017564803 6:155672133-155672155 ATGTGCTTCTGTGGGAGCACAGG + Intergenic
1017980894 6:159400486-159400508 ATTTTCTTCAATGGGTTCACAGG + Intergenic
1018688979 6:166328316-166328338 ATTTTCTTCAGTTGCTTCACAGG + Exonic
1020015396 7:4828659-4828681 AGTTTCAGGTGTGGGATCACGGG + Intronic
1020511972 7:9067691-9067713 TTGTATTTCTGTGGGATCACTGG + Intergenic
1020630093 7:10629005-10629027 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1021051649 7:15992670-15992692 ATATATTTCTGTGGGATCAGTGG + Intergenic
1021652474 7:22845446-22845468 ATTTACTTCAGTGGGGTTACTGG + Intergenic
1021753190 7:23825417-23825439 TTGTATTTCTGTGGGATCACTGG + Intronic
1022448719 7:30493646-30493668 AATTTTTTCTGTGGTATAACTGG + Intergenic
1022958408 7:35402131-35402153 ACTTCCTACTGTGTGATCACTGG - Intergenic
1023894640 7:44422459-44422481 TTTTATTTCTGTGGGATCAGTGG - Intronic
1024664598 7:51533632-51533654 TTTGTATTCTGTGGGATCAGTGG + Intergenic
1025119466 7:56288164-56288186 AAATTCCTCTGTGGGATCAGAGG + Intergenic
1026311761 7:69191970-69191992 GTTCTCTTCTGTGGCTTCACTGG - Intergenic
1028924218 7:96340011-96340033 ATGTTCTTGTGATGGATCACAGG - Intergenic
1029049398 7:97668866-97668888 ATGTTCTACTTTGAGATCACTGG - Intergenic
1030426345 7:109383828-109383850 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1032966649 7:137105484-137105506 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1034110792 7:148535962-148535984 TTTTTTTTAAGTGGGATCACTGG - Intergenic
1034922974 7:155098947-155098969 ATTTCCTCCTGTGGGAACACAGG - Intergenic
1035103906 7:156425861-156425883 ATTTTCTGCTGTTGGAACAGAGG - Intergenic
1035834294 8:2731759-2731781 ATTTTCTTCAGTGTGATCAAGGG + Intergenic
1036551525 8:9819463-9819485 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1036558311 8:9879921-9879943 TTGTTTTTCTGTGGGATCACTGG - Intergenic
1038971674 8:32643597-32643619 ATTTTATTCTGTAGGTTTACTGG - Intronic
1039357760 8:36840031-36840053 ATTTTCTTCTTTGAGATAAATGG + Intronic
1040051648 8:43021160-43021182 ATTTTGTTCTGTGAGATGAGAGG + Exonic
1040736840 8:50518626-50518648 ATATATTTCTGTGGGATCAGTGG - Intronic
1040816027 8:51509366-51509388 ATTTTATTCTGAGTGAGCACTGG - Intronic
1041003174 8:53471732-53471754 ACTTTCTTATGAGGGCTCACCGG + Intergenic
1041295292 8:56350910-56350932 ATTTATTTCTGTGGGGTCAATGG + Intergenic
1041502973 8:58559466-58559488 ATTATCTTCTTTGGGTTCAAAGG - Intronic
1041528176 8:58832573-58832595 ATTTGATTCTGTGGGCTCAGAGG + Intronic
1041611668 8:59857356-59857378 TTTTTTTCCTGTGGGATCAGTGG - Intergenic
1042200053 8:66272890-66272912 ATTCCCTTCTGTGTGTTCACGGG - Intergenic
1042812595 8:72842753-72842775 TTGTACTTCTGTGGGATCAGTGG + Intronic
1043329896 8:79102563-79102585 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1043534764 8:81190177-81190199 AGTTTCTTCTGTTTGATCAAGGG + Intergenic
1043819240 8:84842290-84842312 TTGTATTTCTGTGGGATCACTGG - Intronic
1043891065 8:85653232-85653254 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1043896106 8:85738720-85738742 TTGTACTTCTGTGGGATCAGTGG - Intergenic
1043896573 8:85743088-85743110 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1043898896 8:85761455-85761477 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1043900509 8:85773649-85773671 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1043902471 8:85788924-85788946 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1043904082 8:85801117-85801139 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1043905694 8:85813311-85813333 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1043907301 8:85825498-85825520 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1044048159 8:87463909-87463931 TTTTATTTCTGTGGGATCAGTGG + Intronic
1044405538 8:91821810-91821832 TTGTTTTTCTGTGGGATCAGTGG - Intergenic
1046067677 8:109215847-109215869 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1047133976 8:122054671-122054693 TTGTACTTCTGTGGGATCAGTGG - Intergenic
1047568469 8:126072620-126072642 TTTTTCTTCTCTGGGAGCCCAGG - Intergenic
1047851434 8:128861734-128861756 ATTTTCTTCTGAGAAATCACTGG - Intergenic
1048169074 8:132087853-132087875 ATCTTCATCTGTGTGATGACAGG - Exonic
1048713739 8:137243686-137243708 TTGTTTTTCTGTGGGATCAGTGG - Intergenic
1048816196 8:138336429-138336451 TTTTATTTCTGTGGGATCAGTGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050049671 9:1586238-1586260 TTGTATTTCTGTGGGATCACTGG + Intergenic
1050239594 9:3621148-3621170 TTGTTTTTCTGTGGGATCAGTGG + Intergenic
1050588069 9:7133858-7133880 GTTCTCTACTGTGGGATCCCGGG + Intergenic
1051078783 9:13272551-13272573 ATTTTCTAATTTGGGATTACAGG - Intronic
1051125202 9:13795851-13795873 GTATTTTTCTGTGGGATCAGTGG - Intergenic
1051196735 9:14569997-14570019 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1051235256 9:14992830-14992852 ATTTCCTTCTGGGAGATCATCGG + Intergenic
1051998690 9:23250089-23250111 TTGTATTTCTGTGGGATCACTGG - Intergenic
1052080656 9:24202225-24202247 ACTTTCTTCTGTGGGAAAAATGG + Intergenic
1052721288 9:32173988-32174010 CTTTTCTTCTCGTGGATCACAGG - Intergenic
1052753046 9:32511903-32511925 TTGTATTTCTGTGGGATCACTGG - Intronic
1053672281 9:40378776-40378798 TTTTTTTTCTGTGGGATCAGTGG - Intergenic
1053723255 9:40971098-40971120 CTTTTCTCCAGTGAGATCACAGG + Intergenic
1053922100 9:43005132-43005154 TTTTTTTTCTGTGGGATCAGTGG - Intergenic
1054342709 9:63880894-63880916 CTTTTCTCCAGTGAGATCACAGG - Intergenic
1054383391 9:64518804-64518826 TTTTTTTTCTGTGGGATCAGTGG - Intergenic
1054512343 9:65997534-65997556 TTTTTTTTCTGTGGGATCAGTGG + Intergenic
1055042237 9:71886747-71886769 AGTTTCATCTGTGAGATCAAAGG + Intronic
1055267496 9:74513542-74513564 ATTTTTTTCTCTGTGAACACAGG - Intronic
1055983860 9:82035759-82035781 GTTTTCTTCTGTGGCATCTGAGG - Intergenic
1057123028 9:92594276-92594298 ATTCTTATCAGTGGGATCACGGG + Intronic
1058182863 9:101819157-101819179 TTGTATTTCTGTGGGATCACTGG - Intergenic
1058350483 9:104015612-104015634 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1060761539 9:126254993-126255015 ATTTTCCTCTGAGTGCTCACAGG - Intergenic
1203428100 Un_GL000195v1:60351-60373 TTTTATTTCTGTGGGATCAATGG - Intergenic
1203451891 Un_GL000219v1:124879-124901 CTTTTCTCCAGTGAGATCACAGG - Intergenic
1188148297 X:26641479-26641501 TTTTACTTCTGTGGCATCACTGG - Intergenic
1188530334 X:31133263-31133285 CTTTTCTTCTATTTGATCACAGG + Intronic
1188793875 X:34439004-34439026 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1190307481 X:49093387-49093409 ATTCTCTTCCCTGGGATTACAGG + Intronic
1190420080 X:50221092-50221114 TTGTACTTCTGTGGGATCAGTGG + Intronic
1190914113 X:54797581-54797603 TTTTTCTTCTTTAGGATCTCAGG + Intronic
1191134265 X:57046762-57046784 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1191156034 X:57274083-57274105 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1191635407 X:63370733-63370755 TTGTATTTCTGTGGGATCACTGG - Intergenic
1191772177 X:64772845-64772867 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1191774609 X:64800169-64800191 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1191964585 X:66743195-66743217 TTTTACTTCTGTGGGATCGGTGG + Intergenic
1192023601 X:67424223-67424245 TTTTGTTTCTGTGGGATCAGTGG + Intergenic
1192075540 X:67992059-67992081 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1192626884 X:72738205-72738227 ATTTGGTTCTGTGTGATCATAGG - Intergenic
1192910523 X:75599320-75599342 GTTTATTTCTGTGGGATCAGTGG + Intergenic
1192912490 X:75619701-75619723 TTGTACTTCTGTGGGATCAGTGG - Intergenic
1192957332 X:76086323-76086345 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1192976445 X:76291177-76291199 TTGTATTTCTGTGGGATCACTGG - Intergenic
1193030178 X:76889484-76889506 TTGTGCTTCTGTGGGATCAGTGG - Intergenic
1193050306 X:77092577-77092599 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1193059878 X:77194306-77194328 TTTTATTTCTGTGGGATCAGCGG + Intergenic
1193090185 X:77485734-77485756 AGTTTCTTCTGTGAGGTCACTGG - Intergenic
1193303785 X:79925312-79925334 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1193541840 X:82782038-82782060 ATTTACTTCTGTGCACTCACAGG + Intergenic
1193616525 X:83694722-83694744 TTGTACTTCTGTGGGATCAGTGG + Intergenic
1194228881 X:91297332-91297354 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1194324794 X:92501048-92501070 TTTTATTTCTGTGGGATCAGTGG - Intronic
1194357168 X:92899978-92900000 TTTGTATTCTGTGGGATCAGTGG + Intergenic
1194782839 X:98046170-98046192 ATGTATTTCTGTGGGATCAGTGG + Intergenic
1195518847 X:105808342-105808364 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1196598050 X:117567946-117567968 AGTTATTTCTGTGGGATCAGTGG + Intergenic
1196631178 X:117941653-117941675 GTTTCTTTCTGTGGGATCAGTGG + Intronic
1197123992 X:122923206-122923228 TTTTTTTTCTGTGGGGTCAGTGG + Intergenic
1198477097 X:137005822-137005844 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1198714687 X:139544625-139544647 CTTTTTTTCTGGGGGAACACAGG - Intronic
1199150356 X:144477770-144477792 ATTTTTTTATGTGATATCACAGG + Intergenic
1199914811 X:152328023-152328045 TTTTATTTCTGTGGGATCAGTGG - Intronic
1200405656 Y:2808377-2808399 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1200633527 Y:5620224-5620246 TTTTATTTCTGTGGGATCAGTGG - Intronic
1200665501 Y:6016973-6016995 TTTGTATTCTGTGGGATCAGTGG + Intergenic
1200984615 Y:9292089-9292111 TGTTTTCTCTGTGGGATCACGGG - Intergenic
1201021299 Y:9660326-9660348 TTGTTTTTCTGTGGGATCAGTGG - Intergenic
1201302473 Y:12521220-12521242 TTTCACTTCTGTGGGATCAGTGG + Intergenic
1201333203 Y:12850264-12850286 TTTTATTTCTGTGGGATCAGTGG + Intronic
1201409411 Y:13683773-13683795 TTTTATTTCTGTGGGATCAGTGG - Intergenic
1201588475 Y:15587813-15587835 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1201619804 Y:15943796-15943818 TTTTATTTCTGTGGGATCAGTGG + Intergenic
1201913862 Y:19161317-19161339 GTTTGTTTCTGTGGGATCAGTGG - Intergenic
1201992068 Y:20038121-20038143 TTGTATTTCTGTGGGATCACTGG - Intergenic
1202125830 Y:21568142-21568164 TGTTTTCTCTGTGGGATCACGGG + Intergenic
1202153171 Y:21861238-21861260 TGTTTTCTCTGTGGGATCACGGG - Intergenic