ID: 965897141

View in Genome Browser
Species Human (GRCh38)
Location 3:173592467-173592489
Sequence GAATTAGCTGCCAGTCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965897140_965897141 -10 Left 965897140 3:173592454-173592476 CCACACAATAGTGGAATTAGCTG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 965897141 3:173592467-173592489 GAATTAGCTGCCAGTCTACATGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965897141 Original CRISPR GAATTAGCTGCCAGTCTACA TGG Intronic