ID: 965897141

View in Genome Browser
Species Human (GRCh38)
Location 3:173592467-173592489
Sequence GAATTAGCTGCCAGTCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965897140_965897141 -10 Left 965897140 3:173592454-173592476 CCACACAATAGTGGAATTAGCTG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 965897141 3:173592467-173592489 GAATTAGCTGCCAGTCTACATGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965897141 Original CRISPR GAATTAGCTGCCAGTCTACA TGG Intronic
903718719 1:25388728-25388750 GAATTTGTTACCAGGCTACAGGG - Intronic
905266382 1:36756868-36756890 GAGTTGGCTGCCAGCCTGCACGG + Intergenic
908458146 1:64324032-64324054 GAGTTAGCTGCTGGTCCACAAGG - Intergenic
914768075 1:150657453-150657475 GAATTAGGTTCCAGTCCTCAAGG - Intronic
915776029 1:158487177-158487199 GAATTAACTGGCAGGTTACAAGG + Intergenic
917799357 1:178556246-178556268 GAATTAGGTTCCAGTCCTCAAGG + Intergenic
918046528 1:180944928-180944950 GAAAGAGCAGCCAGCCTACAGGG - Intronic
919834007 1:201561308-201561330 GAACTAGCTCCCAGCCTAAAGGG + Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
924713172 1:246547690-246547712 GAATTAGATGCCTGTCTTTAAGG - Intronic
924861259 1:247924962-247924984 CGATTAGCTGACAGTTTACAGGG - Intergenic
1068181444 10:53523898-53523920 GAATTAGCTGCTATTATAAAGGG + Intergenic
1068886275 10:62100272-62100294 GAATTCCCTCCCAGTCTCCATGG - Intergenic
1069507031 10:69008695-69008717 GAATGATCTGCAACTCTACAGGG + Intronic
1070532885 10:77352893-77352915 GAATTATCAACCAGTTTACAAGG - Intronic
1070541014 10:77415428-77415450 GACTCAGCTGCCAGTCTGCAGGG + Intronic
1073508786 10:104028411-104028433 GAATTAGCTGCTATTCTATGTGG + Exonic
1073633711 10:105176021-105176043 CCATTAGCAGCCAGCCTACATGG - Intronic
1074850101 10:117432680-117432702 CACTTAGCTGCCAGTCACCAGGG - Intergenic
1078448436 11:11422388-11422410 GTATTTGCTGCCAGTCTTGAGGG + Intronic
1081494470 11:43594596-43594618 AACTTAGCAGCCAGTCTACAAGG - Intronic
1085088295 11:73687886-73687908 AAATTACTTGACAGTCTACAAGG - Intronic
1095597308 12:43973550-43973572 GACTTAACTGCGAGTGTACAAGG + Intronic
1095801726 12:46275938-46275960 AAATAAGCTTCCATTCTACATGG + Intergenic
1097369950 12:58766173-58766195 GACATAGTTGCCAGGCTACAGGG - Intronic
1099231710 12:80034070-80034092 GCACTAGCTACCAGTTTACATGG - Intergenic
1105611661 13:21974484-21974506 GAATGAGCTTGCAGTCTGCAGGG - Intergenic
1107526126 13:41233540-41233562 GAGTTAGCTGTCATGCTACAAGG + Intronic
1110410211 13:75196569-75196591 GACTCAGCTGCCATTCCACAGGG - Intergenic
1111293757 13:86254005-86254027 GAATCAGCGGACAGTCTAAAAGG - Intergenic
1111607881 13:90564100-90564122 GAAGTGGCTGCCACTCTACGAGG - Intergenic
1114152461 14:20059150-20059172 CAATTGTCTGCCATTCTACATGG + Intergenic
1114743883 14:25125707-25125729 GAACAAGCTGCCAGACTTCAAGG - Intergenic
1121252890 14:92513200-92513222 GAATTAGATGCCAGGCTTGATGG + Intergenic
1122455282 14:101845493-101845515 GTAGAAGCTGCCAGTCTTCATGG + Intronic
1129611634 15:77064286-77064308 CCATTAGCTGTCAGACTACAGGG + Intronic
1135124988 16:19801723-19801745 GAATCAGCGGACAGTCTAAAAGG + Intronic
1135249384 16:20888164-20888186 GAATTAGCTGCCATTCCAGGTGG + Intronic
1138122700 16:54413260-54413282 GAATTAGGTGCAAGTCCAGAAGG + Intergenic
1140772700 16:78220063-78220085 GCATTACCTCCCATTCTACAGGG - Intronic
1140829421 16:78737650-78737672 AGTTTAGCTCCCAGTCTACAGGG + Intronic
1155931632 18:31714822-31714844 AAATGAGCTGACAGCCTACAAGG - Intergenic
1156660725 18:39343181-39343203 GGATTAGATGCCATTCTAAATGG + Intergenic
1158091265 18:53716451-53716473 GAATGAACTTCCAGTCTACTTGG - Intergenic
1158617123 18:58998338-58998360 GAAGCAGTTGCCATTCTACATGG + Intergenic
1161671300 19:5612276-5612298 GAATTAAATGCCACTCTACGTGG + Intronic
925677506 2:6380163-6380185 GAATTACCTGCCAATATACAAGG + Intergenic
927340011 2:21972703-21972725 GAGTGAGCTGCCAGGCTACAGGG + Intergenic
933822270 2:86124214-86124236 GAATTAGCTGGGTGTCTAAAAGG + Intronic
935455222 2:103259516-103259538 GAATTATCTGCCAGTTGAGATGG - Intergenic
936255527 2:110907486-110907508 GAAAAGGCTGTCAGTCTACAGGG - Intronic
944274669 2:197822251-197822273 GAATTTGCTTCCAGTCAGCAGGG + Intronic
944301280 2:198127712-198127734 GACTTAGGTGCAAATCTACATGG + Intronic
946498419 2:220219456-220219478 GAGTTAGCTGCCAGTTCCCAGGG + Intergenic
1168786585 20:544707-544729 GAAGTAACTGCCAGTGTAAAGGG - Intergenic
1176958466 21:15132927-15132949 GAATTAGCTGAAAGTCTAGATGG + Intergenic
1177337152 21:19744338-19744360 AAATTAGTTGCCTGTATACAGGG + Intergenic
1180117693 21:45722216-45722238 GACTTAGGTGCCAGTATACTGGG - Intronic
1181447662 22:22990509-22990531 GAATTAGAAGCCAGGCAACAAGG - Intergenic
949198175 3:1338247-1338269 GAATTCACAGCCACTCTACAAGG - Intronic
955627930 3:60939067-60939089 CAATTAGGTGCAATTCTACATGG + Intronic
956860465 3:73318624-73318646 AAATTAGCTTGCAGTCCACAAGG - Intergenic
962425326 3:135264357-135264379 GAATTTGCTGCCATTGTACCAGG - Intergenic
965897141 3:173592467-173592489 GAATTAGCTGCCAGTCTACATGG + Intronic
973608958 4:52615728-52615750 GAATTAACTGCCAGTCATGAGGG + Intronic
980797225 4:137700404-137700426 TATTTGGCTGACAGTCTACATGG + Intergenic
981902274 4:149880622-149880644 GGAATAGAAGCCAGTCTACAAGG + Intergenic
982606843 4:157526517-157526539 GACTTAACTGCAAGTGTACAAGG + Intergenic
986261204 5:6147953-6147975 GGATTAGCTGCCCTTCTAAAAGG - Intergenic
990131293 5:52588829-52588851 GATTTAGCTGTAAGTCTACAAGG - Intergenic
992390531 5:76326927-76326949 TCATTGGCTGCAAGTCTACAAGG - Exonic
993263002 5:85684784-85684806 AGATTAGCTGCCACTCTAAATGG - Intergenic
994490158 5:100431660-100431682 GAATAAGCTCCCATTGTACAGGG + Intergenic
996860408 5:128059225-128059247 GAAATAGCTGCCAGTAAACCAGG + Intergenic
998401287 5:141850333-141850355 GATTTAGCTCCCACTCTCCACGG + Intergenic
999811774 5:155134247-155134269 GATTTAGCTCCCTGTCTACCAGG - Intergenic
1000941442 5:167366745-167366767 GAGTTAGCTGCAAGGCTACTAGG - Intronic
1000996735 5:167967077-167967099 TAATAAGCTGCCAGTTTCCAAGG - Intronic
1004433799 6:15570317-15570339 CAAGAAGCTGGCAGTCTACAAGG - Intronic
1007687317 6:43674591-43674613 GAATCTGCTTCCACTCTACAGGG + Intronic
1008469289 6:51865278-51865300 GAAAAAACTGCCACTCTACAAGG - Intronic
1010032113 6:71282081-71282103 GAAGTTGCTGACAGTCTATAAGG + Intergenic
1010884535 6:81219450-81219472 GAATATGATTCCAGTCTACATGG + Intergenic
1010931728 6:81812053-81812075 GAATTAGATGTCACTGTACATGG - Intergenic
1011228737 6:85136412-85136434 GAAATAGCAGCCACTCAACAGGG - Intergenic
1013163470 6:107568641-107568663 GAAGGAGCTGCCAGTCAATAGGG + Intronic
1014440932 6:121473204-121473226 GAATTAGCTGCCAATGTGCTTGG + Intergenic
1016966127 6:149719981-149720003 GAATTAGGGGGCAGTGTACATGG + Intergenic
1019010265 6:168839309-168839331 GAATGAGCTGACGGTCTCCATGG + Intergenic
1020956162 7:14741723-14741745 GATTTAACTGCGAGTATACAAGG - Intronic
1031054710 7:116980595-116980617 GAAACAGCTGGCAGTCTATATGG + Intronic
1031895731 7:127346609-127346631 GAATTAGCTGTCAGTGAGCAAGG + Intergenic
1034418440 7:150977138-150977160 GAATTAGGTGACAGTCTCCAGGG + Intronic
1034891611 7:154844560-154844582 GAATTATTTGCCAGTTTTCAGGG + Intronic
1036538670 8:9679757-9679779 CAATTTGCTGCCCGTCTCCAAGG + Intronic
1038692436 8:29775435-29775457 GAATTTCCTGCCACACTACATGG + Intergenic
1052727284 9:32244592-32244614 TAATCAGCTGCCTGTCTCCACGG - Intergenic
1056722698 9:89085342-89085364 GATTTAGCTGCCATTTTACAAGG - Intronic
1187236565 X:17473243-17473265 GAAATAGCTTCCAGTATAAATGG - Intronic
1190722867 X:53164873-53164895 GACTTAACCGCCAGTGTACAAGG - Intergenic
1196885387 X:120239750-120239772 AAATTGGCAGCCAGTCTAAAGGG + Intergenic