ID: 965900889

View in Genome Browser
Species Human (GRCh38)
Location 3:173640236-173640258
Sequence CTGAAGCCTGTATTTTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965900889 Original CRISPR CTGAAGCCTGTATTTTAATG AGG Intronic
900851715 1:5148613-5148635 CTGAAGGCTGTATTTATGTGGGG + Intergenic
906124584 1:43419923-43419945 CTGAACCCTGAATATTACTGCGG + Exonic
909096700 1:71296664-71296686 CTGGGGCCGGAATTTTAATGAGG + Intergenic
909290081 1:73871707-73871729 CTGAAGTCTGTATTATGATTTGG - Intergenic
909698753 1:78496193-78496215 CTTAAGCCTGTATTTTTATAAGG - Intronic
909911340 1:81261241-81261263 ATGAAGCTTGTATTCTAATGAGG - Intergenic
909914444 1:81300163-81300185 CTGTAACCTGTATTTGCATGTGG + Intergenic
910206518 1:84753797-84753819 CTGATGCTTGTAATTTAATGTGG + Intergenic
916478097 1:165189041-165189063 CTGAAGCTTATATTTTATTCAGG + Intergenic
916853143 1:168724511-168724533 ATGAAGCTTATATTTTAGTGAGG + Intronic
916858495 1:168776976-168776998 CTGAATTGTGTATTTTAAAGTGG + Intergenic
917089548 1:171338811-171338833 AAAAAGCCTGTATTTTAATGGGG - Intronic
917155886 1:171998609-171998631 CTAGAGCTTGTATTCTAATGGGG + Intronic
917653280 1:177100481-177100503 CTGAAGCCAATTTTTTAAAGTGG + Intronic
919571284 1:199251942-199251964 CTGAAACCTATATTTTAAAAAGG + Intergenic
922348774 1:224718728-224718750 GTGAAGCCTGTTCTTTGATGTGG + Intronic
923458363 1:234186022-234186044 CTGAAGGCAGCATTTTAAGGAGG + Intronic
923735860 1:236606503-236606525 CTGAAGCCAATATTATAGTGAGG - Intergenic
923909768 1:238428252-238428274 ATGATGGCTGTATTTTGATGGGG + Intergenic
1065238411 10:23679634-23679656 CTGAAAGCTGTCTTTTAATTAGG - Intergenic
1065605958 10:27418065-27418087 CTGAAGCTTCTATTTTTATTTGG + Intergenic
1068752849 10:60615606-60615628 CTGATGCCAGCATTTTCATGCGG - Intronic
1069871076 10:71533455-71533477 CAGAAGCCTGTGGTCTAATGAGG + Intronic
1070339011 10:75479691-75479713 ATAAAGCTTGTATTTTAGTGAGG + Intronic
1070339032 10:75479884-75479906 ATAAAGCTTGTATTTTAGTGAGG + Intronic
1070339053 10:75480077-75480099 ATAAAGCTTGTATTTTAGTGAGG + Intronic
1070339074 10:75480270-75480292 ATAAAGCTTGTATTTTAGTGAGG + Intronic
1070339097 10:75480463-75480485 ATAAAGCTTGTATTTTAGTGAGG + Intronic
1074330986 10:112509070-112509092 CTGAGCTCTTTATTTTAATGTGG - Intronic
1075356731 10:121784951-121784973 CTGGAGAATGTATTTTAATATGG - Intronic
1076219367 10:128720749-128720771 TTGAATCCTTTATTTTAATGAGG + Intergenic
1076835494 10:133018894-133018916 CAACAGCCTGGATTTTAATGTGG - Intergenic
1080116862 11:28631220-28631242 CAGAAGCCAGCATTTTAATTAGG + Intergenic
1080322190 11:31023304-31023326 CTCAAGCCTTTGTTTTAATTGGG - Intronic
1081024426 11:37992320-37992342 CTGAATCCAGGATTTTTATGGGG + Intergenic
1081505030 11:43707217-43707239 ATGGAGCCTGCATTTTAATGAGG + Intronic
1085997671 11:81940110-81940132 CAGAAACCTCTATTTTAAGGAGG + Intergenic
1087008684 11:93493459-93493481 CTGCAGCCTCTATTTTATTTGGG - Intronic
1087600633 11:100310565-100310587 CTGAAGCTTGTATTGTAGTAGGG + Intronic
1087945907 11:104160144-104160166 GTGAAGCTTGTTTCTTAATGTGG - Intronic
1088321334 11:108557297-108557319 TTGTAGATTGTATTTTAATGGGG + Intronic
1088404177 11:109454197-109454219 CTGAAGCTTAAATTATAATGAGG + Intergenic
1088488384 11:110363410-110363432 CTGAATCCAGTTCTTTAATGAGG + Intergenic
1089040660 11:115446207-115446229 CTGACCCCTGTATTCTGATGAGG - Intronic
1089101981 11:115970669-115970691 CCGAATCCAGTATTTTATTGAGG - Intergenic
1089106297 11:116008631-116008653 CCGAATCCAGTATTTTATTGAGG - Intergenic
1090291595 11:125550758-125550780 CTGAAGCCAGTAATCTAATCAGG - Intergenic
1090526357 11:127542814-127542836 CTCAAGCCTGTAATTCAGTGTGG + Intergenic
1093503605 12:19839023-19839045 CTGAAGCCTGTGATTTCTTGAGG + Intergenic
1093539245 12:20261434-20261456 CTGGAGCTTGTGTTTTAATGGGG - Intergenic
1094353392 12:29551149-29551171 CTGAAGCTGGTATACTAATGTGG + Intronic
1096398843 12:51288551-51288573 CTGAGGCTTATATTTTAGTGCGG - Intronic
1098551771 12:71770315-71770337 CTGAAACTGGTATTTTAATGGGG + Intronic
1098814437 12:75139992-75140014 CTGATGCCTATATTTTAGGGTGG - Intronic
1098834172 12:75400803-75400825 CTAAATACTGTATTTTACTGAGG - Intronic
1099846987 12:88039741-88039763 GTGAAACTTGCATTTTAATGAGG - Intronic
1100489235 12:95063071-95063093 ATGAAGCTTTTATTTTAGTGGGG + Intronic
1102068277 12:109996740-109996762 ATGAAGCTTGCATTTTACTGGGG + Intergenic
1102201924 12:111063238-111063260 AAGAAGCCTGTATTTGAATGTGG - Intronic
1104687355 12:130796172-130796194 ATGAAGGATGTCTTTTAATGTGG - Intronic
1107391785 13:39972535-39972557 CTGCAGCCTCTACTTTAAAGAGG - Intergenic
1108363077 13:49685479-49685501 CTATAGCCTGTTTTTCAATGGGG - Intronic
1109634843 13:65101720-65101742 CTGCAGCCTGAATGTTAAAGTGG + Intergenic
1110019030 13:70445680-70445702 CTGAAGTCTGTACTTTATTTAGG + Intergenic
1110964114 13:81669649-81669671 CTGAAGCCTGTTGCTAAATGAGG - Intergenic
1111140370 13:84110341-84110363 ATGAAGACAGTATTTTAAAGGGG - Intergenic
1111451186 13:88419582-88419604 CTGAAGTCTGAATTTCCATGTGG + Intergenic
1114545097 14:23494118-23494140 AAGAAGCCTGTATTGTAGTGTGG - Intronic
1115201552 14:30859359-30859381 CTGAAGCTTGTAGTTTAGTTGGG - Intergenic
1115623311 14:35163588-35163610 CTTTTGCCTGTTTTTTAATGGGG + Intronic
1116265106 14:42677913-42677935 ATGAAGTCTGGACTTTAATGTGG + Intergenic
1117168812 14:53068828-53068850 TTGAAGGCAGTATTTTGATGAGG - Intronic
1117396938 14:55320169-55320191 CTGAAGCGTGCATTTGAAAGAGG + Intronic
1117492551 14:56264818-56264840 CTGAATCCTGTATTTTCCTTAGG + Intronic
1118436475 14:65775561-65775583 ATAAAGCCTGTCTTTCAATGGGG - Intergenic
1121971155 14:98357683-98357705 CTAAAACATGTATTCTAATGGGG - Intergenic
1124865944 15:33491425-33491447 CTGAAGCATTTATCTTCATGGGG + Intronic
1125746433 15:42000449-42000471 CAGGAACCTGCATTTTAATGAGG + Intronic
1127359772 15:58235117-58235139 CTGGAGCCATTATTTTAATCTGG - Intronic
1128179279 15:65587377-65587399 CTGAAGAATGTATTTTACTTAGG + Intronic
1128536748 15:68497376-68497398 ATGAAGCATGTCATTTAATGAGG - Intergenic
1128851630 15:70963538-70963560 CTAAAGCCTGTATTTTATCCAGG - Intronic
1130214036 15:81951809-81951831 CTGATGTCTATTTTTTAATGGGG + Intergenic
1130721843 15:86394908-86394930 ATGAAGCTAGTATTTTAATATGG + Intronic
1131563055 15:93460918-93460940 TTAAAGCATGTATTTTAATAAGG + Intergenic
1131836158 15:96393289-96393311 CTGGAGCCTGCATTTTCATTTGG - Intergenic
1135655412 16:24244113-24244135 CTGAAGGCTGGAGTTCAATGAGG - Intergenic
1137008229 16:35298233-35298255 CTGAAGACTGTGTTTTAATAGGG + Intergenic
1137014932 16:35365184-35365206 CTGAAGACTATGTTTTAATAGGG + Intergenic
1144452499 17:15392608-15392630 CTGAGGCCTTTATTTTATAGAGG + Intergenic
1146107084 17:30049194-30049216 ATAAACCCTGTATTTTTATGGGG - Intronic
1151027689 17:70698135-70698157 CTGAAGACTTTTTTTTAATTGGG - Intergenic
1151709548 17:75794999-75795021 CTGAAGGATCTATTTTAGTGTGG - Intronic
1152126970 17:78452979-78453001 CTCAATTGTGTATTTTAATGTGG + Intronic
1153836986 18:8972140-8972162 CTGAAGGGTGTATTTGACTGAGG + Intergenic
1155277623 18:24204024-24204046 CTGATGCCTTCATTTTAATGGGG + Intronic
1157889563 18:51402862-51402884 CTGAAGCCTGTCTTTAATTCAGG + Intergenic
1158765413 18:60445245-60445267 CTGAAGACAGCATTCTAATGGGG + Intergenic
1158838940 18:61362509-61362531 CTGCAGCTTGCATTTTAGTGGGG + Intronic
1164442878 19:28292759-28292781 CTGAAGCCGTTATTTTACTCAGG - Intergenic
1165552719 19:36602502-36602524 CTGTAGCCTGTATTTTTGTATGG - Intronic
1167530208 19:50011139-50011161 CTTGAGCCTGTGTTTTATTGGGG - Intronic
925617389 2:5756606-5756628 CTTAAGCTTGTGTTTTTATGGGG - Intergenic
926862394 2:17322573-17322595 CAGAAGCCTTTATTTCAAGGTGG + Intergenic
928158279 2:28895593-28895615 CTGAAGTCTGTATTAGGATGTGG + Intronic
928322031 2:30291541-30291563 CTGAAGTCTGTATTTACATTAGG - Intronic
929470129 2:42183278-42183300 ATGAAGCTTGTATTATCATGAGG + Intronic
929625548 2:43403140-43403162 ATAAAGCCTGCATTTTAATTAGG + Intronic
930568869 2:53059331-53059353 CGGAAGTCTTTATTTTTATGAGG + Intergenic
930579856 2:53197224-53197246 CTGAAGCATCATTTTTAATGTGG + Intergenic
930764737 2:55073643-55073665 CTGAAAATTGTATTTTAAAGTGG - Intronic
933280260 2:80325027-80325049 ATGAAGCTTATATTTTAGTGGGG - Intronic
933425817 2:82111059-82111081 CTCAAGCCTCTTTTTTAATGCGG + Intergenic
934884135 2:98009490-98009512 TAGAAGTTTGTATTTTAATGGGG + Intergenic
935511292 2:103978371-103978393 CTGAAGAATATATTTTAATGTGG + Intergenic
936121129 2:109746027-109746049 CTGAATCCTTAATTTTAATTAGG - Intergenic
936223566 2:110625444-110625466 CTGAATCCTTAATTTTAATTAGG + Intergenic
936237740 2:110758497-110758519 CTGATGGCTGTATTTTTGTGGGG + Intronic
936287446 2:111191677-111191699 CTGGGGCCTGTATCTTAAAGAGG - Intergenic
936380509 2:111981197-111981219 CTGTTGCCTGTAGTTGAATGAGG - Intronic
937397671 2:121552507-121552529 CCTTTGCCTGTATTTTAATGGGG - Intronic
937792949 2:125981729-125981751 CTGAACCCTAAATTTAAATGTGG + Intergenic
941018808 2:160386661-160386683 CTGACTGCTGTATTTTCATGTGG - Intronic
941642854 2:168007918-168007940 CTGAATCGTGCATTTTAAAGGGG - Intronic
943118166 2:183699939-183699961 CTGAAGCTTTCATTCTAATGAGG + Intergenic
943620036 2:190139070-190139092 ATGAAGCTTGTAGTTTCATGAGG + Intronic
944407371 2:199400213-199400235 GAGTAGCCTGCATTTTAATGGGG - Intronic
944589850 2:201207000-201207022 GTGAAGTCTGAATTTTAATCAGG + Intronic
944644819 2:201768395-201768417 CTGATGCCAAAATTTTAATGAGG + Intronic
944738962 2:202593166-202593188 CTGAAACCTGTATCTAAATAAGG + Intergenic
945496525 2:210513511-210513533 CTGTTGCCTGTTTTTTAATGGGG + Intronic
945884217 2:215357665-215357687 TTGAATCTTTTATTTTAATGAGG + Intergenic
947334905 2:229071725-229071747 CTGAAGCTTATCTTTTACTGTGG - Intronic
948303125 2:236923853-236923875 ATGAAGTGTGTATTTTTATGTGG + Intergenic
1170369399 20:15632239-15632261 CTGAAGACAGTCTTTTAAAGTGG + Intronic
1170773185 20:19351982-19352004 CCGGAGCCTGTGTTTTATTGAGG + Intronic
1170977313 20:21177406-21177428 CTTTAGCCCGTATTTTAATCAGG + Intronic
1174500018 20:50977470-50977492 GTAAAGCCTGGATTTTATTGTGG - Intergenic
1175348555 20:58301265-58301287 CTGAGCCCTGTATTTTCCTGTGG - Intergenic
1176589044 21:8622552-8622574 ATGGAGCTTGCATTTTAATGAGG - Intergenic
1176708188 21:10130329-10130351 CTGAAGCCTGAGTTTTCACGTGG - Intergenic
1176926536 21:14757024-14757046 CTGTAGCCTGTATTATGTTGAGG - Intergenic
1177090896 21:16766838-16766860 ATGAAGGCTGTTGTTTAATGAGG - Intergenic
1177389195 21:20444512-20444534 CTCAAGCATGTATTAAAATGAGG - Intergenic
1177831023 21:26139048-26139070 GTAGAGTCTGTATTTTAATGTGG + Intronic
1178196415 21:30349733-30349755 CAGAAGCTTGAATTTTAATAGGG + Intronic
1180271868 22:10599549-10599571 ATGGAGCTTGCATTTTAATGAGG - Intergenic
1180882189 22:19213140-19213162 CTGTTGCCTGTGTTTTAATTGGG - Intronic
1181839893 22:25647779-25647801 CTGAATCCTGGAAATTAATGAGG + Intronic
1182597739 22:31435187-31435209 CTGAAGCCAGGACTTTCATGGGG - Intronic
1182672657 22:32010233-32010255 CTGAAGGCTGAAATTGAATGAGG + Intergenic
1184009670 22:41737734-41737756 CTGGAGCTTATATTTTAGTGGGG - Intronic
1184548440 22:45189875-45189897 CTGAATCATGTACTTTAAAGGGG - Intergenic
949131592 3:508522-508544 CTGCTGCCAGTATTTTATTGAGG + Intergenic
949373385 3:3360185-3360207 CAGAACCCTGTATTCTCATGTGG + Intergenic
950975553 3:17239109-17239131 ATGAAACTTGTATTTGAATGGGG - Intronic
955272684 3:57517286-57517308 ATGAAGCTTATACTTTAATGAGG - Intronic
955457953 3:59145367-59145389 CTGAATCCTTCATTTTAAAGTGG - Intergenic
955692181 3:61601708-61601730 ATGGAGCTTGTATTTTAGTGGGG + Intronic
955841790 3:63120417-63120439 ATGGAGCCTGAATTTTAATGAGG + Intergenic
957698119 3:83670512-83670534 AAGAAGCTTGTAATTTAATGTGG - Intergenic
958626921 3:96638113-96638135 CAGAAGCCTTTACTTTAATTAGG - Intergenic
960038283 3:113123665-113123687 ATGAGGCCTATATTTTAGTGAGG + Intergenic
960645024 3:119870559-119870581 CTAAAAGCTGGATTTTAATGTGG + Intronic
961629990 3:128289604-128289626 CTCAAGCCTATATTTTAAAATGG - Intronic
962743972 3:138383779-138383801 ATGAAGCTTATATTTTAGTGGGG + Intronic
963430298 3:145192832-145192854 TTGAAGCCTGTAATACAATGAGG + Intergenic
963438356 3:145302603-145302625 CTCAATTCTGTCTTTTAATGTGG + Intergenic
964484794 3:157176125-157176147 CTTAAGCCTGTTTTTTGGTGGGG + Intergenic
965900889 3:173640236-173640258 CTGAAGCCTGTATTTTAATGAGG + Intronic
966174271 3:177118724-177118746 CTGAAGTTTGTATTTTAATGGGG + Intronic
966364248 3:179165556-179165578 CTGGAACCTGAATTTTAATAAGG + Intronic
966624905 3:182005419-182005441 CTGGAGCCTTTATTACAATGAGG + Intergenic
966799901 3:183753349-183753371 TCTAAGCCTATATTTTAATGTGG + Intronic
967222881 3:187263301-187263323 CTGTAGCTTATATTCTAATGTGG - Intronic
968251839 3:197224469-197224491 GTTAAGCCTGTTTTTTCATGTGG - Intronic
970542105 4:17090357-17090379 CTGGAGCTTGTATTATAGTGGGG + Intergenic
970558328 4:17258063-17258085 CTGATAGCTGTGTTTTAATGTGG - Intergenic
971216644 4:24668222-24668244 CTTATTCCTGTCTTTTAATGAGG + Intergenic
971276416 4:25201981-25202003 CTGAAGAGTGTACTTTAATAAGG + Intronic
972669443 4:41200471-41200493 CTGAAAATTGCATTTTAATGTGG - Intronic
972942011 4:44207445-44207467 CTGGAGCTTTTATTATAATGGGG - Intronic
973116797 4:46470952-46470974 CTGAAGCCTGTAGTATAAAGTGG + Intronic
974210078 4:58761273-58761295 CTGGAGCCTTTATATTGATGAGG - Intergenic
974618125 4:64316739-64316761 CTGAAGACTATATTCTAAAGAGG + Intronic
975288117 4:72644507-72644529 CAGAAGACTATTTTTTAATGAGG + Intergenic
978467569 4:109025647-109025669 ATGAAGCCTGTTTTAAAATGAGG + Intronic
978779529 4:112535997-112536019 CTGAACCCTGAATATTAATATGG - Intergenic
979243446 4:118470712-118470734 CTGTAGCCTACACTTTAATGGGG + Intergenic
980330554 4:131404712-131404734 CTGAAGACATTTTTTTAATGTGG - Intergenic
980702435 4:136450217-136450239 CTCAGGCAAGTATTTTAATGGGG - Intergenic
981689678 4:147493787-147493809 CTGAAGCATCTATTTAAATTTGG + Intronic
982199519 4:152946687-152946709 CTGCAGCCTGTGTTGTAATATGG - Intronic
982325222 4:154123017-154123039 CTGAAGCTTCTGTTTAAATGTGG - Intergenic
982680566 4:158424077-158424099 ATGTAGCCTAGATTTTAATGTGG + Intronic
983471692 4:168164221-168164243 TTGAAGCTAGTATTTCAATGAGG - Exonic
984729225 4:183051460-183051482 TTGTAGCCTGGATTTTACTGTGG - Intergenic
985305623 4:188536031-188536053 ATGAAGCCTGCAGTTTAGTGTGG - Intergenic
988633039 5:32951645-32951667 CAGAACTCTGAATTTTAATGAGG + Intergenic
988685579 5:33522134-33522156 CTGAAGCCGATATTTTGATCTGG + Intergenic
989658171 5:43767878-43767900 ATGGAGCTTATATTTTAATGAGG + Intergenic
990679499 5:58225782-58225804 CTTTTGGCTGTATTTTAATGTGG - Intergenic
990945247 5:61242597-61242619 CTGCTGCCAGTATTTTATTGAGG - Intergenic
991253743 5:64592615-64592637 CTGAAGCTTTTATTCCAATGGGG - Intronic
992775157 5:80082808-80082830 AGGAAGCCTTTATTTTCATGTGG + Intronic
993201487 5:84821691-84821713 CTAAATTCTGCATTTTAATGTGG - Intergenic
994849051 5:105029883-105029905 CTCAATCTTGTATTTTAATATGG + Intergenic
995344759 5:111099357-111099379 ATGAACCCAGTATTTTATTGAGG - Intronic
998622623 5:143811684-143811706 CTGGAGCCTGCATTCTAGTGTGG + Intergenic
999602849 5:153285752-153285774 CTTAATCCTGAATTTTAATTTGG - Intergenic
1000266709 5:159645073-159645095 CAGAAGCCTGTATTAGAATGTGG + Intergenic
1001192297 5:169642330-169642352 CTGGAGCCTGTAGTCTAATAGGG + Intronic
1002040386 5:176509259-176509281 GTGCAGCCTGTATTTGACTGAGG - Exonic
1004237123 6:13883907-13883929 CTGAAGCTTGTATTCTCCTGGGG - Intergenic
1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG + Intergenic
1005042470 6:21611483-21611505 CAGAAGCCTGTCTTTGAAAGAGG + Intergenic
1008852851 6:56045463-56045485 TTTAAGTCTGTATTTTGATGGGG - Intergenic
1010510290 6:76709831-76709853 CTGAAGGCAGGATTCTAATGTGG + Intergenic
1011896554 6:92234363-92234385 CTCAATCCTGTATTTGAATGTGG + Intergenic
1012511955 6:100012556-100012578 CAGAAGCTTCTATTTTAGTGGGG - Intergenic
1013860118 6:114625611-114625633 CTAAAGCCTGTATTTTCCTTTGG + Intergenic
1016501534 6:144726048-144726070 CTGAAGCACGGAGTTTAATGTGG + Intronic
1017308915 6:152954079-152954101 TTGAAGCCTTTATTCTAATGAGG - Intergenic
1018006359 6:159625998-159626020 CTGCAGCCTGTAGATTCATGGGG - Intergenic
1018522145 6:164661962-164661984 CTGAAGCCAGTATTTTCCTCAGG - Intergenic
1020669884 7:11093696-11093718 CTGAAGGCTGAGTTTGAATGAGG - Intronic
1022227400 7:28377518-28377540 CTGAAGGCTGCATTTTAAAGAGG - Intronic
1024387374 7:48768261-48768283 CTGCAGCCTGGATGTGAATGTGG + Intergenic
1025301597 7:57822950-57822972 CTGCAGACTGTATTGTAGTGTGG - Intergenic
1027008881 7:74724450-74724472 CTGAAGCCTGTATTATCTTTAGG + Intronic
1028130835 7:87170733-87170755 ATGGAGCCTGTATTCTAGTGGGG - Intronic
1030505460 7:110416609-110416631 CTGAAGCTCGCATTCTAATGGGG - Intergenic
1030740854 7:113108161-113108183 CTGAGCCCTGTATGTGAATGAGG - Intergenic
1031131546 7:117838778-117838800 CTGAAATCTTTATTTTAGTGCGG - Intronic
1033383447 7:140847235-140847257 TTTAAGCTTATATTTTAATGAGG - Intronic
1033518666 7:142137160-142137182 CAGAAGCTTGTATTTTTATGTGG + Intronic
1033827519 7:145209676-145209698 CCCAAGCATTTATTTTAATGTGG - Intergenic
1037037822 8:14189796-14189818 ATGAAGCATGTATTTTAGTGAGG - Intronic
1037716396 8:21404800-21404822 CTGAAGCTTATATTCTAACGGGG - Intergenic
1038065572 8:23960158-23960180 GTGAAGCTTGTATTTTGTTGTGG + Intergenic
1038538265 8:28370080-28370102 CTGAAGCCTGATTTTTAAAAAGG + Intronic
1038578205 8:28723607-28723629 CTGATACCTGTATTAGAATGAGG + Intronic
1038930799 8:32191578-32191600 CTGAAGCCTGTATTCTGCTAAGG - Intronic
1039313196 8:36342569-36342591 CTGAAGGCCATATTTGAATGGGG + Intergenic
1039628001 8:39075466-39075488 CTGAAGCAATTATTTTACTGAGG + Intronic
1040620605 8:49088156-49088178 CTGAATCCTGCTTTTTAATAGGG + Intergenic
1042193510 8:66212112-66212134 CTGTATTCTGTATTTTAATATGG + Intergenic
1043330749 8:79115663-79115685 CAGATGCCAGTATTTTATTGAGG - Intergenic
1044863806 8:96549552-96549574 CTGGAGCCAGTAGTTTAAGGGGG + Intronic
1045244849 8:100434000-100434022 GGGAAGCCTTTATTTTTATGGGG + Intergenic
1045879049 8:107015599-107015621 CTGGAGCCTGAATTTACATGGGG - Intergenic
1047276922 8:123412876-123412898 CTTAAGCAGGCATTTTAATGGGG - Intronic
1047922514 8:129650178-129650200 GTGAAGCCAGAATTTGAATGCGG - Intergenic
1047995024 8:130326453-130326475 TTGAAACCTGTATTTTATTTGGG - Intronic
1048107364 8:131426400-131426422 CTGATTTCTTTATTTTAATGTGG - Intergenic
1048726711 8:137393827-137393849 CTTTAGCCTGTCTTTTAATTGGG + Intergenic
1048737407 8:137517111-137517133 CTGAGGCCTGTACCTGAATGAGG + Intergenic
1050187556 9:2991018-2991040 AGGAGGCCTGAATTTTAATGAGG - Intergenic
1050948770 9:11561425-11561447 ATGAAGTTTGTATTTTAATGTGG - Intergenic
1054326175 9:63713741-63713763 CTGAAGCCTGAATTTTCACCTGG - Intergenic
1054783424 9:69187601-69187623 CTGAAGCCTGTATCTAATTGAGG - Intronic
1055762897 9:79628526-79628548 TTGTAGCTTGTTTTTTAATGGGG + Intronic
1056290341 9:85136731-85136753 CAGAAATCTGTATTTTAATCAGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057768057 9:97941026-97941048 ATGAAACCTACATTTTAATGGGG + Intronic
1058747957 9:108010068-108010090 CTGAAGCTTGTATTTAAAAAGGG + Intergenic
1059287428 9:113186973-113186995 CAGCAGCTTTTATTTTAATGAGG + Intronic
1060717335 9:125944742-125944764 CTGGAGCCTGTGTTATTATGTGG + Intronic
1061769013 9:132903316-132903338 CTGAAGCGTGTATTGTACAGCGG - Intronic
1202792949 9_KI270719v1_random:99298-99320 CTGAAGCCTGAGTTTTCACGTGG - Intergenic
1203619048 Un_KI270749v1:101132-101154 ATGGAGCTTGCATTTTAATGAGG - Intergenic
1185553163 X:999917-999939 ATTAAGGCTGTATTTTAATTTGG - Intergenic
1185824565 X:3237424-3237446 TTGAAACCTATATTTAAATGAGG - Intergenic
1188075256 X:25768082-25768104 CTTTTGCCTATATTTTAATGGGG - Intergenic
1189174402 X:38940559-38940581 CACAAGCCTGGATTTTAATCTGG + Intergenic
1192106058 X:68318337-68318359 CTGAAACCTGTATATCAATTTGG - Intronic
1194530175 X:95037495-95037517 CTTTAGCCTCTATTTTAATTGGG + Intergenic
1194747361 X:97642705-97642727 GTGAAGCTTGTATTCTAGTGGGG - Intergenic
1195475118 X:105276613-105276635 CTGAAGTCTGGATTTTTGTGTGG + Intronic
1197150082 X:123210558-123210580 CTAAACCCTTTATTTTACTGAGG - Intronic
1197813431 X:130471520-130471542 CTGAGGCCTATATTTTCATATGG - Intergenic
1197874594 X:131089750-131089772 ATGAAGACTGTATTGTATTGAGG + Exonic
1200692055 Y:6316179-6316201 CTGATGCCTGGATTTCAATCTGG - Intergenic
1201043217 Y:9858548-9858570 CTGATGCCTGGATTTCAATCTGG + Intergenic