ID: 965901720

View in Genome Browser
Species Human (GRCh38)
Location 3:173648874-173648896
Sequence GGATGGTTGGATCTTATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965901720 Original CRISPR GGATGGTTGGATCTTATAGT AGG (reversed) Intronic
901224849 1:7607294-7607316 GGATGGTTGGATGGAATGGTAGG + Intronic
901616649 1:10545353-10545375 GAATGGCTGGATCATATAATAGG + Intronic
906438577 1:45819432-45819454 AGATGATTTGATCTTATATTTGG + Intronic
908079046 1:60555187-60555209 GAATGGTTGGATTCTTTAGTAGG - Intergenic
908917203 1:69142586-69142608 TGATTGGTGGATCATATAGTAGG - Intergenic
910598716 1:89007362-89007384 GGATGGTTGTTTCTGATATTGGG + Exonic
910608280 1:89111378-89111400 AGATGGTATGATCTTATATTTGG + Intronic
910705113 1:90121208-90121230 TGATGATATGATCTTATAGTTGG - Intergenic
912071234 1:105812225-105812247 AGATGATAGGATCTTATATTTGG + Intergenic
912095669 1:106139964-106139986 GAATGGCTGGATCATATGGTAGG - Intergenic
912898849 1:113625613-113625635 AGATGATGGGATCTTATATTTGG - Intronic
916158305 1:161880769-161880791 GGATGGCTGGGTTATATAGTAGG + Intronic
916198264 1:162245495-162245517 GAATGGTTGGATCATATGGTAGG - Intronic
917392631 1:174555941-174555963 CTATGTTTGGATCATATAGTGGG + Intronic
917844935 1:179012888-179012910 GGATTGTTGGGTCAAATAGTAGG - Intergenic
918573163 1:186022983-186023005 GGATTTTTGTATCTTATACTTGG - Intronic
919255831 1:195123133-195123155 GGATTGATGGATCATATGGTAGG + Intergenic
919791796 1:201296045-201296067 GGAGGGTTGGGTCTTAGGGTGGG - Intronic
920303646 1:205005008-205005030 GGATGGTGGAAGCTTAGAGTGGG + Intronic
920987624 1:210905386-210905408 GGATGCCTTGATCTTATATTTGG - Intronic
922529150 1:226329921-226329943 GAATGGTTGGGTCATATGGTGGG + Intergenic
1063946734 10:11183470-11183492 GAATGGCTGTATCATATAGTAGG + Intronic
1066142569 10:32521613-32521635 GTATGGTATGATCTTATATTTGG - Intronic
1067295343 10:44972391-44972413 GGATGGTTTGATCTGATGGGCGG - Intronic
1068469804 10:57447170-57447192 GGATGGTTAGCTCTTCTTGTGGG + Intergenic
1070869442 10:79737397-79737419 GGTTGTTTTGATCTTATACTAGG - Intergenic
1071636360 10:87259603-87259625 GGTTGTTTTGATCTTATACTAGG - Intergenic
1071658881 10:87478348-87478370 GGTTGTTTTGATCTTATACTAGG + Intergenic
1072114777 10:92360133-92360155 AGATGATATGATCTTATAGTTGG - Intergenic
1072398883 10:95076132-95076154 AGATGGTATAATCTTATAGTTGG - Intergenic
1075812915 10:125239671-125239693 GTATAGTTGAATCATATAGTTGG - Intergenic
1079362384 11:19779800-19779822 GAATGGTTGGTTCTTCTAATGGG + Intronic
1085007752 11:73109619-73109641 AGATGATTTGATCTTATATTTGG - Intronic
1088491750 11:110395532-110395554 AGATGATATGATCTTATAGTTGG - Intergenic
1088959508 11:114648709-114648731 GGATAGTTGTATCATATATTAGG - Intergenic
1089123312 11:116157847-116157869 GAATGACTGGATCATATAGTAGG - Intergenic
1091179750 11:133593403-133593425 GAATGGCTGGATCATATGGTAGG + Intergenic
1091925106 12:4340136-4340158 AGATGATAGGATCTTATATTTGG + Intronic
1092137301 12:6158920-6158942 GGATGGCTGGACCTGATACTCGG - Intergenic
1093486392 12:19657300-19657322 GGCTGGTTGGATCCTATTCTTGG + Intronic
1093809909 12:23479309-23479331 AGATTGCTGGATCTTATGGTAGG - Intergenic
1094026600 12:25966057-25966079 GAATGGCTGGATCTTATGGTAGG + Intronic
1094128339 12:27047388-27047410 GAATGGCTGGATCATATAATAGG + Intronic
1095853946 12:46840504-46840526 GGATGTTTGGAATTTATATTCGG - Intergenic
1096014742 12:48260060-48260082 GAATTGCTGGATCATATAGTGGG + Intergenic
1097258195 12:57696432-57696454 AGAGGGTTGCATCTTATAGTCGG + Intronic
1097336143 12:58385205-58385227 GCATGGTTGGATACTATATTAGG + Intergenic
1098207373 12:68126109-68126131 GGATGGCTGGATCATATGGTAGG + Intergenic
1098319636 12:69230323-69230345 AGATGGTGTGATCTTATATTTGG + Intergenic
1101378778 12:104194199-104194221 GGATTGCTGGATCATATGGTAGG + Intergenic
1102611662 12:114117720-114117742 GGAAGGTAGGATCTTAGAGGTGG - Intergenic
1104337082 12:127909256-127909278 GGATGGTTGGATCATATGTTAGG - Intergenic
1105582718 13:21715533-21715555 GAATGGCTGGATCGTATGGTAGG - Intergenic
1105628589 13:22138360-22138382 GGATGGCTGGGTCATATGGTAGG - Intergenic
1105698402 13:22914338-22914360 GAATGGCTGGATCATATGGTAGG - Intergenic
1105850061 13:24326577-24326599 GAATGGCTGGATCATATGGTAGG - Intergenic
1106490690 13:30218718-30218740 GGATATTTGGATCTCATAGATGG - Intronic
1106842680 13:33701690-33701712 AGACGGTTGGAACTTATTGTTGG + Intergenic
1107550825 13:41473420-41473442 GGATTGCTGGATCATATGGTAGG + Intergenic
1108610187 13:52077704-52077726 GGATGGATGGATCATATAGTAGG - Intronic
1108921294 13:55677787-55677809 GAATGGTTGGTTCCTATACTGGG + Intergenic
1109317543 13:60768050-60768072 GGATAGTTGTATCATAGAGTAGG + Intergenic
1109452084 13:62529833-62529855 GGATGGCTGGATCATATGGGAGG + Intergenic
1111609738 13:90588105-90588127 GTATGGCTGGAGCTTATAGAGGG - Intergenic
1112148155 13:96724892-96724914 GAATGACTGGATCATATAGTAGG + Intronic
1115868577 14:37775824-37775846 GGATAGTTAGATCTTCTTGTTGG + Intronic
1116885724 14:50219138-50219160 GAGTGGTTGGATCGGATAGTAGG - Intronic
1117567717 14:57012408-57012430 GAATGGCTGGGTCTTACAGTAGG + Intergenic
1117838714 14:59834968-59834990 GAATGGCTGGATCATAAAGTAGG - Intronic
1118033803 14:61844303-61844325 GGATGATATGATCTTATATTTGG - Intergenic
1118041010 14:61917113-61917135 GGATTGCTGGATCATATGGTAGG + Intergenic
1119096379 14:71835721-71835743 GAATGGTTGGGTCATATGGTAGG + Intergenic
1119207886 14:72808291-72808313 GGATGTTTGGATGCTGTAGTGGG - Intronic
1120816251 14:88862002-88862024 GGATTGCTGGATCATATGGTAGG + Intronic
1124316950 15:28678185-28678207 GAGTGGTTGGATCATATGGTAGG - Intergenic
1124566501 15:30819314-30819336 GAGTGGTTGGATCATATGGTAGG + Intergenic
1127686423 15:61349949-61349971 GGAAGGATGGACCCTATAGTGGG - Intergenic
1130280769 15:82519070-82519092 GGAATGTTGGATACTATAGTCGG + Intergenic
1130594440 15:85239890-85239912 GGAATGTTGGATACTATAGTCGG + Intergenic
1130788892 15:87130596-87130618 GGATGGTGGGATCTCATGGCAGG - Intergenic
1131444340 15:92484234-92484256 GGATTGCTGGATCATATGGTAGG - Intronic
1131960017 15:97780218-97780240 GAATTGCTGGATCATATAGTAGG - Intergenic
1132366689 15:101262885-101262907 GAATGGCTGGATCATATGGTAGG + Intergenic
1133308070 16:4823895-4823917 GGATGGTGAGATCCTATAGAGGG + Exonic
1135156482 16:20057499-20057521 GGATGGATGGATGGTATAGATGG - Intronic
1135204113 16:20467942-20467964 GGTGGGTTGGAGCTTTTAGTTGG - Intronic
1138184474 16:54965708-54965730 GGATGGATGGATGGGATAGTGGG - Intergenic
1138698481 16:58838118-58838140 GGTTGGTTGGACCTAAGAGTCGG + Intergenic
1143957905 17:10688607-10688629 GAATGGTTAGATCATATAGTAGG - Intronic
1144116695 17:12100585-12100607 GAATGGCTGGATCATATGGTAGG + Intronic
1144297733 17:13894596-13894618 GAATGGTTGGCTCATATGGTAGG - Intergenic
1144418040 17:15070138-15070160 GGATGGTTGCAGCTTCTAGCTGG - Intergenic
1144937213 17:18909577-18909599 GAATGGCTGGATCATATAGTAGG - Intronic
1145054252 17:19689208-19689230 AGATGATAGGATCTTATATTTGG + Intronic
1148986175 17:51623695-51623717 GGATTGTCGGATCATACAGTAGG - Intergenic
1149091100 17:52780976-52780998 GAATAATTGGATCTTATGGTAGG + Intergenic
1149108907 17:53002295-53002317 GGATGATGAGATCTTATATTTGG + Intergenic
1151404097 17:73875734-73875756 GGATAGGTGGCTCTTATAGGGGG + Intergenic
1151426528 17:74034426-74034448 GGATGGGTGGGTCTCAGAGTGGG - Intergenic
1153607709 18:6851536-6851558 GAACGGTTGGGTCTTATAGTAGG - Intronic
1154230945 18:12555892-12555914 AGATGGTATGATCTTATATTTGG + Intronic
1155255158 18:23990009-23990031 GGATGGCTGGATCATATGGTAGG - Intergenic
1155457005 18:26028431-26028453 GAATGGTTGGATCATATGATAGG - Intronic
1155652649 18:28160002-28160024 GGGTGGCTGGTTTTTATAGTTGG + Intronic
1155731584 18:29166415-29166437 GGATTGCTGGATCATATGGTAGG + Intergenic
1157328102 18:46683662-46683684 GTATGGTTGGATCATAAAGTAGG - Intronic
1158267419 18:55675733-55675755 AGATGATAGGATCTTATATTTGG - Intergenic
1159301572 18:66578591-66578613 GAATGGCTGGATCATATGGTAGG - Intronic
1162178616 19:8850592-8850614 GGATGGTAGGGTCTTACGGTAGG + Intronic
925062844 2:906088-906110 GGATGGGTGGATCTGAGAGCTGG + Intergenic
926781064 2:16472227-16472249 GGATGGTAGGATATTGTACTAGG + Intergenic
926906904 2:17814454-17814476 GGATTGCTGGATCAAATAGTAGG - Intergenic
927251665 2:21000264-21000286 GGATTGTTGGATATTATATTTGG + Intergenic
927568551 2:24137305-24137327 GAATTGTTGGGTCTTATGGTAGG + Intronic
928477325 2:31642632-31642654 GAATTGTTGGATCATAAAGTAGG - Intergenic
929128918 2:38546732-38546754 GAATGGTTGGGTCATATGGTAGG + Intergenic
930103892 2:47624922-47624944 AGATGATAGGATCTTATATTTGG - Intergenic
930271886 2:49266980-49267002 GGATGGTTGGTCTCTATAGTTGG + Intergenic
930570639 2:53081854-53081876 GGATTGCTGGATCATATGGTAGG - Intergenic
932233592 2:70102913-70102935 GAATGGTTGTATCTTATGGAAGG + Intergenic
933134085 2:78710087-78710109 GGATGGCTGGGTCATATGGTGGG - Intergenic
936252960 2:110881998-110882020 GAATGGTTAGATCATGTAGTCGG + Intronic
936868510 2:117106282-117106304 GGATAGTTGGATCTTCTTGTTGG + Intergenic
937983045 2:127626096-127626118 GTTCGGTTGGATATTATAGTCGG + Intronic
938918695 2:135971663-135971685 GGATGCTATGATCTTATATTTGG + Intronic
941302634 2:163823101-163823123 GGATGATATGATCTTATATTTGG - Intergenic
941851391 2:170186049-170186071 AGATGGTATGATCTTATATTTGG - Intronic
942856240 2:180552702-180552724 GGATCTTTGAATATTATAGTTGG - Intergenic
942902129 2:181133508-181133530 GAATGGCTGGATCATATGGTAGG + Intergenic
944006470 2:194914264-194914286 AGATTGCTGGATCTTATGGTAGG + Intergenic
944377499 2:199064077-199064099 GGATTGCTGGATCATATGGTGGG - Intergenic
944463482 2:199976813-199976835 GGATTGCTGGATCCTATGGTAGG + Intronic
944769924 2:202903576-202903598 AGATGATTTGATCTTATATTTGG + Intronic
947674817 2:231968735-231968757 GAATGGCTGGATCATATAATAGG + Intronic
947686684 2:232092809-232092831 AGATGGTATGATCTTATATTTGG - Intronic
947867661 2:233411214-233411236 GAATCGCTGGATCATATAGTAGG + Intronic
1169259985 20:4130224-4130246 GGATTGCTGGGTCATATAGTAGG - Intronic
1169536724 20:6552039-6552061 GAATGGTTAGATCATATGGTAGG - Intergenic
1169823328 20:9738283-9738305 AAATGGCTGGATCATATAGTAGG - Intronic
1170236428 20:14110453-14110475 AGATGGTATGATCTTATATTTGG + Intronic
1174827292 20:53780024-53780046 GAATGGTTGGAAATTACAGTTGG - Intergenic
1175726076 20:61319556-61319578 GGATTGCTGGATCATATGGTAGG + Intronic
1176899697 21:14425018-14425040 AGATGATAGGATCTTATATTTGG + Intergenic
1177678005 21:24327722-24327744 GGATTGCTGGATCATATGGTAGG + Intergenic
1178372366 21:32037180-32037202 GGATGATTGGATCTCAGAATTGG - Intronic
1179056466 21:37939896-37939918 GAATGTCTGGATCATATAGTAGG + Intergenic
1182032344 22:27169072-27169094 GGATGTATGGATTTTATGGTAGG + Intergenic
1183758467 22:39792956-39792978 GGTTTGCTGGATCATATAGTAGG + Intronic
1183808144 22:40229983-40230005 GAATGGCTGGGTCATATAGTAGG + Intronic
1183874938 22:40772110-40772132 GGATGGCTGGGTCCTATAATAGG + Intronic
950102824 3:10368623-10368645 GGATGGGTGGATGTGATGGTTGG - Intronic
952811269 3:37405796-37405818 AGATGGTATGATCTTATATTTGG - Intronic
955323800 3:57994254-57994276 GAATGGTTGGATCATAGAGTAGG + Intergenic
956954642 3:74322610-74322632 TGATTGCTGGATCTTATGGTAGG - Intronic
957097466 3:75789807-75789829 AGATGATTTGATCTTATATTTGG + Intergenic
957160991 3:76609637-76609659 AGATGATAGGATCTTATATTGGG - Intronic
959078039 3:101771810-101771832 GAATGATTGGATCTTACAGTAGG + Intergenic
959404830 3:105948395-105948417 GAATGGCTGGATCATATAGTAGG + Intergenic
960841215 3:121961605-121961627 AGATGGTATGATCTTATATTTGG + Intergenic
961175039 3:124828156-124828178 GGATGGTTGGGTCATATGGTAGG - Intronic
962450476 3:135511990-135512012 GAATGGCTGGATCATATAGTAGG - Intergenic
962663562 3:137630300-137630322 GGATGGTTTGATCTTCTATCCGG + Intergenic
963745600 3:149121584-149121606 GAATGGTTGGATCATGTGGTAGG + Intergenic
964901653 3:161666761-161666783 TGATGATATGATCTTATAGTAGG - Intergenic
965674249 3:171178205-171178227 GAATGGCTGGATCAGATAGTAGG + Intronic
965901720 3:173648874-173648896 GGATGGTTGGATCTTATAGTAGG - Intronic
967907195 3:194511287-194511309 GGCTGCTTGGATCAGATAGTGGG - Intergenic
973212228 4:47629062-47629084 GGATTGATGGATCATATGGTAGG + Intronic
974584821 4:63859162-63859184 GGATGATCAGATATTATAGTAGG + Intergenic
978217895 4:106228767-106228789 GGATTGCTGGATCATATGGTAGG + Intronic
979912871 4:126392123-126392145 AGATGGTATGATCTTATATTTGG - Intergenic
979973844 4:127171205-127171227 GGCTGGTTTGATCTTCTATTTGG - Intergenic
980657896 4:135813616-135813638 AGATGGTATGATCTTATATTTGG + Intergenic
981412394 4:144448286-144448308 GGTTGGTTTGATCTTCTAATTGG + Intergenic
983658266 4:170105509-170105531 AGATGGTATGATCTTATATTTGG + Intergenic
985185828 4:187314662-187314684 GGATTGCTGGATCATATGGTAGG - Intergenic
985287125 4:188347441-188347463 GGATTGCTGGATCATATGGTAGG - Intergenic
985769198 5:1798551-1798573 GAATGGTTGTATCTTATGGAAGG - Exonic
987030735 5:13974593-13974615 GGATGGATGGGACTTATAGCGGG - Intergenic
988247034 5:28699219-28699241 GAATGGTTTGGTCATATAGTGGG + Intergenic
988814288 5:34817460-34817482 GGATGGCTGGATCATATATTAGG - Intronic
989629891 5:43470813-43470835 GGATGATATGATCTTATATTTGG + Intronic
992344039 5:75858022-75858044 AGATGATTCGATCTTATATTTGG - Intergenic
992701483 5:79345588-79345610 GAATGGCTGGATCATATGGTAGG + Intergenic
993958871 5:94271782-94271804 GGATTGTTGGATCATAGGGTAGG - Intronic
994539947 5:101081886-101081908 GGAGGGTTGGTTCTTATAAATGG - Intergenic
997143827 5:131410947-131410969 GGATTGTTGGATCCTACTGTTGG - Intergenic
999402470 5:151276611-151276633 GAATAGTTGGATCATATGGTAGG + Intergenic
1000599055 5:163250147-163250169 GAATGGCTGAATCATATAGTAGG - Intergenic
1006306843 6:33227345-33227367 GTATGGTTTGTTCTTATAATGGG + Intergenic
1007759605 6:44126449-44126471 GGGGGTTTGGATCTTGTAGTTGG - Intronic
1008102384 6:47405899-47405921 GGATGGTTGTGTCATCTAGTAGG + Intergenic
1008172288 6:48223286-48223308 GGATTGCTGGATCATATGGTAGG + Intergenic
1009977821 6:70691984-70692006 GGATTGCTGGATCGTATGGTAGG + Intronic
1010480236 6:76342843-76342865 GGATGGTTGGAGCACATTGTTGG + Intergenic
1010833765 6:80561954-80561976 GAATGGCTGGATCTTATAGTAGG + Intergenic
1011593883 6:88997534-88997556 GGATGGTTTGATCACAGAGTAGG + Intergenic
1011740146 6:90351275-90351297 GGAAGGTTGGATCTGATATGAGG - Intergenic
1011923015 6:92606055-92606077 GGATGATATGATCTTATATTTGG + Intergenic
1012095850 6:94959244-94959266 GAATGGCTGGATCATATGGTAGG - Intergenic
1013382161 6:109585707-109585729 GGATGGTTGAATGTTCTAGCTGG - Intronic
1013567638 6:111383351-111383373 CGATGGTATGATCTTATATTAGG + Intronic
1014005317 6:116410958-116410980 GGATGGTGGGATCTCTCAGTGGG + Intronic
1015517756 6:134101323-134101345 GGATTGATGGATCATATGGTAGG - Intergenic
1017555730 6:155564748-155564770 TGATTGCTGGATCATATAGTAGG + Intergenic
1017965802 6:159264613-159264635 GAATGGATGGATTTTGTAGTAGG + Intronic
1019055348 6:169219272-169219294 GGATGGATGGATGAGATAGTTGG + Intronic
1019090333 6:169525715-169525737 GGATGGCTGGATCATATATATGG - Intronic
1019161459 6:170069688-170069710 GAATGGCTGGATCATATAGTAGG + Intergenic
1020352581 7:7237449-7237471 GATTGGTTGGTTCTGATAGTAGG + Intronic
1023032803 7:36105638-36105660 GGATGGTTGGGTTGTATTGTAGG - Intergenic
1026049816 7:66935981-66936003 AGATGGTATGATCTTATATTTGG - Intronic
1026337431 7:69406661-69406683 GAATGGCTGGATCTTATGGTGGG - Intergenic
1026390032 7:69891501-69891523 GAACGGTTGGATCATATGGTCGG + Intronic
1029173981 7:98650995-98651017 GGATGGTTGGGTCATAAAGTGGG + Intergenic
1029263723 7:99322675-99322697 TGATGGTTGGCTTTTATAGCAGG + Intergenic
1030728149 7:112950894-112950916 GGATGGCTGGATCATACAGTAGG - Intergenic
1030812577 7:113992297-113992319 AGATGGTATGATCTTATAATTGG + Intronic
1031190496 7:118543390-118543412 AGATGGTATAATCTTATAGTTGG + Intergenic
1034023286 7:147669511-147669533 GGATGGTGGTAGCATATAGTTGG - Intronic
1037194623 8:16173543-16173565 GGTTGGTTGGTTGTTATGGTTGG + Intronic
1038879873 8:31597327-31597349 GGATGGCTAGAACATATAGTGGG + Intergenic
1041580462 8:59453280-59453302 GAATAGCTGGATCATATAGTAGG + Intergenic
1043281971 8:78479540-78479562 GGATTGTTGGATCATATGGTAGG - Intergenic
1043461395 8:80463899-80463921 GGGTGGGTGGATATTTTAGTAGG + Intergenic
1043642569 8:82473749-82473771 GGATTGCTGGATCATATGGTAGG - Intergenic
1043804530 8:84654957-84654979 GGATTGCTGGATCATATGGTGGG + Intronic
1045884197 8:107076971-107076993 GGATTGCTAGATCATATAGTAGG + Intergenic
1046903910 8:119552395-119552417 GGATGGCTTGATCATATGGTAGG - Intergenic
1047108006 8:121756324-121756346 GGATGGTTGGTTCCTTTATTGGG - Intergenic
1048781207 8:138004032-138004054 GAATGGTTGAATTATATAGTCGG - Intergenic
1049848265 8:144815782-144815804 GGATTGCTGGATCATATGGTAGG - Intergenic
1050759300 9:9046990-9047012 AGATGGTATGATCTTATATTTGG + Intronic
1051693673 9:19744745-19744767 GGATAGGTGAAACTTATAGTTGG - Intronic
1052728188 9:32255345-32255367 GAATGGCTAGATCATATAGTAGG - Intergenic
1053875800 9:42543693-42543715 GGATTGCTGGATCATATGGTAGG + Intergenic
1054235899 9:62558032-62558054 GGATTGCTGGATCATATGGTAGG - Intergenic
1056225923 9:84495284-84495306 GGATTGTTGGGTCGTATGGTAGG + Intergenic
1058526927 9:105868346-105868368 GGATTGCTGGATCATATGGTAGG + Intergenic
1060255483 9:122025761-122025783 GAATTGCTGGATCATATAGTAGG - Intronic
1203689145 Un_GL000214v1:26135-26157 AGATGATTTGATCTTATATTTGG - Intergenic
1203647130 Un_KI270751v1:77918-77940 AGATGATTTGATCTTATATTTGG + Intergenic
1186692100 X:11989073-11989095 GGATTGCTGGATCATATGGTAGG - Intergenic
1186877564 X:13831309-13831331 AGATGGTTGGCTCTGATGGTTGG + Intronic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1188947248 X:36320995-36321017 GGATTGCTGGATCATATGGTAGG - Intronic
1191776484 X:64820259-64820281 GGATTGTTGGATCATATGGCTGG - Intergenic
1191926901 X:66322656-66322678 GGATTGTATGATCTTATATTTGG + Intergenic
1192530532 X:71879283-71879305 GGATGATATGATCTTATATTTGG + Intergenic
1192758554 X:74071003-74071025 AGATGATATGATCTTATAGTTGG - Intergenic
1193579057 X:83240083-83240105 AGATGATTTGATCTTATATTTGG + Intergenic
1193781576 X:85709143-85709165 GGATGATATGATCTTATATTTGG + Intergenic
1194575082 X:95602568-95602590 AGATGATAGGATCTTATATTTGG + Intergenic
1196213834 X:113027368-113027390 GGATTGCTGGATCATATGGTAGG + Intergenic
1196217000 X:113064882-113064904 GAATTGCTGGATCCTATAGTAGG + Intergenic
1196901842 X:120391312-120391334 GCATTGTTGGATCATATCGTAGG - Intergenic
1196981997 X:121224680-121224702 GGATTGCTGGATCTTATGGTAGG + Intergenic
1197077484 X:122370069-122370091 ACATGGTTGGATCATATGGTAGG - Intergenic
1199029269 X:142977500-142977522 AGATGGTTGAAAGTTATAGTAGG + Intergenic
1202339943 Y:23853252-23853274 GGAGGGTTGGATGTTAAAATTGG - Intergenic
1202530823 Y:25816830-25816852 GGAGGGTTGGATGTTAAAATTGG + Intergenic