ID: 965904530

View in Genome Browser
Species Human (GRCh38)
Location 3:173687129-173687151
Sequence TAAGGTAAACAACCTGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965904530_965904535 16 Left 965904530 3:173687129-173687151 CCACGATCAGGTTGTTTACCTTA 0: 1
1: 0
2: 0
3: 2
4: 53
Right 965904535 3:173687168-173687190 CTATGTTTGTAGAACCGAGTTGG 0: 1
1: 0
2: 1
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965904530 Original CRISPR TAAGGTAAACAACCTGATCG TGG (reversed) Intronic
901429420 1:9203871-9203893 GAAGGAAGACAGCCTGATCGAGG - Intergenic
908466428 1:64400759-64400781 TATGTTAATTAACCTGATCGTGG - Intergenic
911943882 1:104081676-104081698 TAAGGTAAACAACAAAATGGAGG - Intergenic
919229775 1:194759250-194759272 TAAGTTAAACAACTTGACCAGGG + Intergenic
1068977092 10:63021835-63021857 TTAGGAAAATAACCTGATGGAGG - Intergenic
1070049038 10:72868873-72868895 TAAGGTAAAAAACCTGAGATTGG - Intronic
1073144888 10:101274024-101274046 TAAGGTACACACCCTGTTCTTGG - Intergenic
1083077823 11:60059273-60059295 AAAGGTAAACATCCTGAAAGTGG + Intronic
1091031543 11:132193376-132193398 GAAGTTAAACAACCTGCTCCTGG + Intronic
1092128078 12:6089310-6089332 TCAGGTAAACAACCTGAAACCGG + Intronic
1098484498 12:71005007-71005029 TAAGGTATACAACATGATATGGG + Intergenic
1101932246 12:109024081-109024103 AAAGTTAGACAACCTGCTCGAGG - Intronic
1102490707 12:113288153-113288175 CAACTTAAACAACCTGAGCGAGG - Exonic
1105600692 13:21884499-21884521 TATGGTAAACAAGCTGCTCCTGG + Intergenic
1106376400 13:29192828-29192850 TAACGCAGGCAACCTGATCGTGG - Intronic
1106473718 13:30079470-30079492 TCAGGTAAAGAACTTGATTGCGG - Intergenic
1109377349 13:61514014-61514036 TATGGTAAACAACATTATAGAGG + Intergenic
1118256966 14:64213911-64213933 TAAGTTAAACAACTTTATCTAGG - Intronic
1124586057 15:31008532-31008554 TGGGATAAACTACCTGATCGTGG + Intronic
1134434302 16:14241573-14241595 TAAGTTGAATAACCTGATCATGG - Intronic
1146249412 17:31325350-31325372 TAAGCTAAACTACCTGAACTGGG + Intronic
1155386055 18:25278622-25278644 AAAGATAAACAACCTGAGCAAGG - Intronic
1158118372 18:54022430-54022452 GAAGTTAAACAACCTGTTCATGG - Intergenic
929238685 2:39631359-39631381 TAAGGAAAACAACGTGATGCTGG - Intergenic
939259947 2:139794030-139794052 AAAGGAAAAGAACCTGATTGAGG - Intergenic
939717515 2:145603134-145603156 TTAGGTGAACATCCTGATGGAGG - Intergenic
1168913431 20:1467772-1467794 TACGGTAAACAACCTTCCCGCGG + Intronic
1175047004 20:56116432-56116454 TAAGGCAAACAGCCTGGTCAAGG + Intergenic
950051229 3:9991284-9991306 TTAGGTAAACAAGCTAATTGTGG + Intronic
957268443 3:77998318-77998340 TAATGTAAACAAGCAGATTGTGG + Intergenic
965904530 3:173687129-173687151 TAAGGTAAACAACCTGATCGTGG - Intronic
978449379 4:108814355-108814377 TGACGTAAACAACATTATCGAGG - Intronic
981880848 4:149610491-149610513 TAACATAAACAGCCTGATAGTGG + Intergenic
983973040 4:173897648-173897670 AAAGATAATCAACCTGATCATGG + Intergenic
984922891 4:184781307-184781329 TAGGGTAAAAAACCTAATCATGG + Intronic
986878077 5:12135057-12135079 GAAATTAAACAACCTGATCTTGG + Intergenic
988448742 5:31318013-31318035 TAAGGCATACAGCCTGATCTAGG + Intronic
991591459 5:68256114-68256136 TAATGAAAACAGCCTGAACGTGG + Intronic
996317836 5:122180920-122180942 TGAGGTAAACAACCTGTTTATGG - Intergenic
998586586 5:143433510-143433532 CAAGGTAAACAACCTTGTCTTGG - Intronic
999023172 5:148193115-148193137 TAAAGTAAATCACCTGATCTGGG + Intergenic
1008455000 6:51699573-51699595 TAAGGTAAACAACCTGGACCAGG + Intronic
1015301360 6:131656174-131656196 TTGGGTAAACTACCTGATCCTGG + Intronic
1019865581 7:3707320-3707342 TAAATTAAACAACCTGCTCCTGG - Intronic
1021577628 7:22118620-22118642 TTAGGTAGACACCCTGATGGCGG + Exonic
1039154490 8:34540161-34540183 TAAGGAAAACAGCATGATCCTGG + Intergenic
1040674220 8:49729361-49729383 TACTGTAAAGAACCTGAACGTGG + Intergenic
1041254566 8:55968817-55968839 TGAGGTAAACAACTTGACCAAGG + Intronic
1042902970 8:73746764-73746786 GAAGGTAAATACCCTCATCGGGG - Exonic
1058193968 9:101951942-101951964 TAAGGTAAACAACCACATCCAGG - Intergenic
1058818923 9:108711280-108711302 TAAGGGAAAAAACCTGAACTCGG + Intergenic
1187098093 X:16167780-16167802 CAAGGTAAGGACCCTGATCGTGG + Exonic
1193272687 X:79547253-79547275 TAAGGTAGAAAACCTGTTCTGGG - Intergenic
1196010801 X:110886064-110886086 TATGGTAAATAACTTGATTGTGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1202188224 Y:22211850-22211872 TAAGGCAAAAAACCTGAATGAGG + Intergenic