ID: 965905365

View in Genome Browser
Species Human (GRCh38)
Location 3:173699045-173699067
Sequence GCGTTATCTCCAGGTTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 805
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 789}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965905362_965905365 7 Left 965905362 3:173699015-173699037 CCCAGCTAATTTTGTAATTTTAG 0: 69
1: 8437
2: 22690
3: 16763
4: 25205
Right 965905365 3:173699045-173699067 GCGTTATCTCCAGGTTGTTCAGG 0: 1
1: 0
2: 0
3: 15
4: 789
965905361_965905365 12 Left 965905361 3:173699010-173699032 CCTTGCCCAGCTAATTTTGTAAT 0: 47
1: 3241
2: 11405
3: 52942
4: 108361
Right 965905365 3:173699045-173699067 GCGTTATCTCCAGGTTGTTCAGG 0: 1
1: 0
2: 0
3: 15
4: 789
965905363_965905365 6 Left 965905363 3:173699016-173699038 CCAGCTAATTTTGTAATTTTAGT 0: 117
1: 15898
2: 11251
3: 8205
4: 13001
Right 965905365 3:173699045-173699067 GCGTTATCTCCAGGTTGTTCAGG 0: 1
1: 0
2: 0
3: 15
4: 789
965905360_965905365 15 Left 965905360 3:173699007-173699029 CCACCTTGCCCAGCTAATTTTGT 0: 35
1: 3309
2: 23213
3: 86507
4: 159922
Right 965905365 3:173699045-173699067 GCGTTATCTCCAGGTTGTTCAGG 0: 1
1: 0
2: 0
3: 15
4: 789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965905365 Original CRISPR GCGTTATCTCCAGGTTGTTC AGG Intronic
900150753 1:1178366-1178388 GGGTTTTCTCCATGTTGGTCAGG - Intronic
900178433 1:1300956-1300978 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
901516246 1:9748678-9748700 GGGTTTTCTCCATGTTGGTCAGG + Intronic
901523233 1:9801745-9801767 GCGGTTTCTCCATGTTGGTCAGG + Intronic
901867416 1:12116170-12116192 GCGGTTTCTCCATGTTGGTCAGG + Intronic
902428217 1:16341777-16341799 GGGTTTTCTCCATGTTGGTCAGG - Intronic
902588253 1:17454865-17454887 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
903417799 1:23196251-23196273 GGGGTATCTCCATGTTGGTCAGG - Intergenic
903819265 1:26088765-26088787 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
903915406 1:26760494-26760516 GGGTTTTCTCCATGTTGGTCAGG - Intronic
904114458 1:28151367-28151389 GGGGTTTCTCCATGTTGTTCAGG + Intronic
904393515 1:30201817-30201839 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
904654080 1:32029464-32029486 GGGTTTTCTCCATGTTGGTCAGG - Intronic
905426663 1:37891033-37891055 GGGTTTTCTCCATGTTGGTCAGG - Intronic
905766036 1:40601996-40602018 GCGTTTTCACCATGTTGGTCAGG + Intergenic
905842511 1:41194938-41194960 GGGGTTTCTCCAGGTTGCTCAGG - Intronic
906216040 1:44040208-44040230 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
906457931 1:46013487-46013509 GGGTTTTCTCCATGTTGATCAGG - Intronic
907064080 1:51462169-51462191 GGGGTTTCTCCATGTTGTTCAGG - Intronic
907369414 1:53991088-53991110 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
908764147 1:67539340-67539362 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
908833927 1:68209585-68209607 GGGTTTTCTCCATGTTGGTCAGG - Intronic
909620199 1:77659025-77659047 GGGGTTTCTCCATGTTGTTCAGG - Intronic
910040648 1:82847840-82847862 GAATTATCTCTAGGTTTTTCAGG + Intergenic
910339573 1:86170324-86170346 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
910403638 1:86862032-86862054 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
910802514 1:91160162-91160184 GGGTTTTCTCCATGTTGTTCAGG - Intergenic
910880570 1:91919093-91919115 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
910905462 1:92173114-92173136 GGGGTTTCTCCATGTTGTTCAGG + Intronic
910925753 1:92396829-92396851 AGGTTTTCTCCAGGTTGGTCAGG + Exonic
911187378 1:94917225-94917247 GGGTTTTCTCCATGTTGGTCAGG + Intronic
911223439 1:95277444-95277466 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
911866053 1:103023546-103023568 GGGTTTTCTCCATGTTGATCAGG + Intronic
912326042 1:108763771-108763793 GGGGTTTCTCCATGTTGTTCAGG + Intronic
912786106 1:112605497-112605519 GGGTTTTCTCCACGTTGGTCAGG - Intronic
912832870 1:112969191-112969213 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
912863264 1:113233979-113234001 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
913300006 1:117360612-117360634 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
913437514 1:118862520-118862542 GGGGTATCTCCATGTTGGTCAGG - Intergenic
913688797 1:121258655-121258677 GAGATTTCTCCATGTTGTTCAGG + Intronic
914148803 1:145021620-145021642 GAGATTTCTCCATGTTGTTCAGG - Intronic
914867467 1:151443521-151443543 GGGTTTTCTCCATGTTGGTCAGG - Intronic
915171756 1:153982932-153982954 GGGTTTTCTCCATGTTGGTCAGG - Intronic
915900400 1:159842621-159842643 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
916050650 1:161034257-161034279 GGGTTTTCTCCATGTTGGTCAGG - Intronic
916433509 1:164755338-164755360 GAGGTTTCTCCATGTTGTTCAGG + Intronic
916720737 1:167483197-167483219 GGGGTTTCTCCATGTTGTTCAGG + Intronic
917115569 1:171599970-171599992 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
917514549 1:175696686-175696708 GGGTTTTCTCCATGTTGGTCAGG - Intronic
917916459 1:179707253-179707275 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
918258364 1:182770799-182770821 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
918259895 1:182786289-182786311 GGGGTATCTCCATGTTGGTCAGG - Intergenic
918321291 1:183367265-183367287 GGGTTTTCTCCATGTTGGTCAGG - Intronic
918741108 1:188131491-188131513 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
918937275 1:190938320-190938342 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
919547355 1:198940457-198940479 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
919637764 1:200019904-200019926 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
920130540 1:203728664-203728686 GCGGTTTCTCCATGTTGGTCAGG - Intronic
920476123 1:206277154-206277176 GAGATTTCTCCATGTTGTTCAGG + Intronic
920864101 1:209737131-209737153 GCCTTATCAACAGGTTGTTTTGG + Intergenic
921127596 1:212191125-212191147 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
921343944 1:214162540-214162562 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
922459802 1:225807150-225807172 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
922599636 1:226839985-226840007 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
922637627 1:227191150-227191172 GGGTTTTCTCCATGTTGGTCGGG - Intronic
923707560 1:236356890-236356912 GTGTTTTCTCCATGTTGTCCAGG - Intronic
924114136 1:240729001-240729023 GCGGTTTCTCCATGTTGATCAGG - Intergenic
924236773 1:242005569-242005591 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
924310155 1:242732527-242732549 GAGTTTTCTCCATGTTGGTCAGG - Intergenic
924511005 1:244729262-244729284 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
924850392 1:247823296-247823318 GGGGTCTCTCCAGGTTGCTCAGG - Intergenic
1063403360 10:5769378-5769400 GAGGTATCTCCATGTTGGTCAGG - Intronic
1063833829 10:9988288-9988310 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1064041673 10:11971443-11971465 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1064338289 10:14463721-14463743 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1064557915 10:16566295-16566317 GCTTGATCTCCATGTTGTACGGG - Intergenic
1064844715 10:19638964-19638986 GCTTTATCTCGGGGTTGTTTGGG + Intronic
1065264493 10:23960446-23960468 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1065764153 10:29010915-29010937 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1066686788 10:37989055-37989077 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1066688868 10:38007154-38007176 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1067003800 10:42642066-42642088 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1067518514 10:46975850-46975872 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1067643736 10:48075978-48076000 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1067960248 10:50839931-50839953 GAGGTTTCTCCAGGTTGGTCAGG + Intronic
1067999223 10:51312061-51312083 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1068245698 10:54364019-54364041 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1068259871 10:54565891-54565913 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1068871943 10:61954813-61954835 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1069473221 10:68711334-68711356 GGGGTATCTCCATGTTGGTCAGG + Intergenic
1069494103 10:68887471-68887493 GAGTTTTCTCCATGTTGGTCAGG + Intronic
1069928003 10:71864615-71864637 GGGTTTTCTCCATGTTGCTCAGG + Intergenic
1070009934 10:72463252-72463274 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1070295533 10:75157966-75157988 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1070336892 10:75463856-75463878 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1071339366 10:84629397-84629419 GGGTTATCTCCATGTTGGTCAGG - Intergenic
1071745677 10:88416442-88416464 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1071829811 10:89360583-89360605 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1072136314 10:92549975-92549997 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1072197451 10:93128564-93128586 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1072214672 10:93278122-93278144 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1072838610 10:98744334-98744356 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1072937037 10:99723331-99723353 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1072982556 10:100111700-100111722 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1073133462 10:101205746-101205768 CCTACATCTCCAGGTTGTTCTGG + Intergenic
1073323397 10:102628962-102628984 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1073741448 10:106412254-106412276 GTTTTGTCTCCAGGTTGATCTGG + Intergenic
1074598749 10:114891805-114891827 GCGGTTTCTCCATGTTGTTCAGG + Intronic
1075041146 10:119107593-119107615 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1075041320 10:119109021-119109043 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1076490776 10:130859830-130859852 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1077760928 11:5096812-5096834 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1078228937 11:9421150-9421172 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1078249867 11:9608118-9608140 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1080083921 11:28255892-28255914 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1080763930 11:35278468-35278490 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1081085465 11:38794882-38794904 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1081329037 11:41781594-41781616 GAGTTAAATCCACGTTGTTCAGG + Intergenic
1081452650 11:43186903-43186925 GCTTTATATCCTGGCTGTTCTGG + Intergenic
1081972825 11:47211769-47211791 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1082035912 11:47645215-47645237 GGGTTATCTCCATGTTGGTCAGG - Intergenic
1082036536 11:47649772-47649794 GAGGTTTCTCCAGGTTGGTCAGG + Intergenic
1082087908 11:48065203-48065225 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1082160030 11:48880500-48880522 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1082162336 11:48899906-48899928 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1082840342 11:57684390-57684412 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1082928137 11:58573052-58573074 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1083030908 11:59591399-59591421 GTGGTATCTGCAGGGTGTTCTGG - Intronic
1083037192 11:59649928-59649950 GGGATTTCTCCATGTTGTTCAGG - Intronic
1083314696 11:61807257-61807279 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1083585838 11:63858544-63858566 GGGTTTTCACCATGTTGTTCAGG + Intronic
1083647374 11:64180261-64180283 GCGTTATTTCCATGTTGGCCAGG - Intergenic
1083653815 11:64219607-64219629 GCTTCACCTCCAGGTTGCTCAGG - Exonic
1083850238 11:65361445-65361467 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1084092916 11:66890689-66890711 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1084100190 11:66942819-66942841 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1084395487 11:68906831-68906853 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1084449116 11:69222396-69222418 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1084508268 11:69584708-69584730 GTGTTTTCCCCATGTTGTTCTGG - Intergenic
1084637848 11:70404809-70404831 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1085070061 11:73535750-73535772 GGGGTATCACCATGTTGTTCAGG + Intronic
1085169741 11:74439481-74439503 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1086023480 11:82261096-82261118 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1086640717 11:89152132-89152154 GGGGTATCTCCATGTTGGTCAGG + Intergenic
1087440692 11:98179575-98179597 GGGATTTCTCCAGGTTGGTCAGG - Intergenic
1087466919 11:98519564-98519586 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1087766882 11:102164911-102164933 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1088033425 11:105280705-105280727 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1089714801 11:120348648-120348670 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1090336040 11:125965941-125965963 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1090679280 11:129036185-129036207 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1090679877 11:129043577-129043599 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1090769932 11:129910965-129910987 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1090816925 11:130306309-130306331 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1091310145 11:134567762-134567784 GGGGTATCTCCATGTTGGTCAGG + Intergenic
1091427620 12:404911-404933 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1091465812 12:683347-683369 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1091490511 12:928318-928340 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1091553986 12:1558218-1558240 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1091723479 12:2829884-2829906 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1092156267 12:6283651-6283673 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1092270944 12:7022845-7022867 ACGGTTTCTCCATGTTGTTCAGG + Intronic
1092338501 12:7655317-7655339 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1092353721 12:7777423-7777445 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1092578624 12:9816007-9816029 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1092874828 12:12838826-12838848 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1093166322 12:15808010-15808032 GGGTTTTCTCCATGTTGTCCAGG + Intronic
1093358084 12:18194619-18194641 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1094667884 12:32539376-32539398 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1095086782 12:38065055-38065077 GGGTTTTCTCCATGTTGTTCAGG - Intergenic
1095493776 12:42763369-42763391 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1095636616 12:44441535-44441557 CAGTTTTCTCAAGGTTGTTCAGG - Intergenic
1096090627 12:48898190-48898212 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1096226900 12:49871855-49871877 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1096256831 12:50067608-50067630 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1096274042 12:50190569-50190591 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1096308657 12:50501399-50501421 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1096309603 12:50508889-50508911 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1096632150 12:52934775-52934797 GGGTTTTCTCCATGTTGATCAGG - Intronic
1096657650 12:53101704-53101726 GGGGTTTCACCAGGTTGTTCAGG - Intronic
1096667892 12:53179042-53179064 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1096676412 12:53228763-53228785 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1096759046 12:53824733-53824755 GAGGTTTCTCCATGTTGTTCAGG + Intergenic
1097089754 12:56495482-56495504 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
1097094703 12:56537110-56537132 GAGTTTTCACCAGGTTGGTCAGG + Intronic
1097217273 12:57423921-57423943 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1097410585 12:59247845-59247867 GCGGTTTCTCCATGTTGATCAGG - Intergenic
1097971318 12:65636177-65636199 GGGTTTTCACCATGTTGTTCAGG + Intergenic
1098077648 12:66750028-66750050 GCCTTGTCTCCAGTTTGTTGGGG - Intronic
1098620720 12:72594407-72594429 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1098864214 12:75743630-75743652 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1098965962 12:76788886-76788908 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1100511465 12:95278875-95278897 GGGGTATCTCCATGTTGGTCAGG - Intronic
1101096409 12:101346240-101346262 GGGTTTTCTCCATGTTGATCAGG + Intronic
1101097355 12:101356315-101356337 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1102150749 12:110688044-110688066 CCTTTAACTTCAGGTTGTTCAGG - Exonic
1102276167 12:111583572-111583594 GGGTTTTCGCCATGTTGTTCAGG - Intronic
1102672105 12:114628944-114628966 GAGATTTCTCCATGTTGTTCGGG - Intergenic
1102691008 12:114761067-114761089 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1103406994 12:120682836-120682858 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1103584723 12:121943614-121943636 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1103777396 12:123376442-123376464 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1103866348 12:124054941-124054963 GCGGTTTCTCCATGTTGATCAGG - Intronic
1104094145 12:125541114-125541136 TCGTTCTCTCCAGGGTGATCAGG - Intronic
1105364330 13:19750958-19750980 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1105507608 13:21023780-21023802 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1106069539 13:26395257-26395279 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1106213363 13:27671878-27671900 GCGGTTTCTCCAGGTTGGTCAGG - Intergenic
1106445988 13:29831396-29831418 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1107496013 13:40926840-40926862 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1108214926 13:48174768-48174790 GCGGTTTCTCCATGTTGATCAGG + Intergenic
1108618372 13:52158066-52158088 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1108679793 13:52769749-52769771 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1109068497 13:57733070-57733092 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1110224501 13:73105605-73105627 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1110277425 13:73655761-73655783 GGGTTCTCTCCATGTTGGTCAGG - Intergenic
1110455297 13:75684434-75684456 GCGGTTTCTCCACGTTGGTCAGG + Intronic
1110853174 13:80268025-80268047 GAGTTTTCTCCATGTTGGTCAGG - Intergenic
1111009155 13:82289394-82289416 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1111613964 13:90640807-90640829 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1112022617 13:95384825-95384847 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1112400036 13:99068389-99068411 GGGTTATCTCCATGTTGGCCAGG - Intronic
1112511072 13:100009958-100009980 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1112664471 13:101553963-101553985 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1112890713 13:104227541-104227563 GGGATTTCTCCATGTTGTTCAGG + Intergenic
1113180714 13:107622235-107622257 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1113416324 13:110131375-110131397 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1113846146 13:113392934-113392956 GAGTTTTCTCCATGTTGGTCAGG - Intergenic
1114286108 14:21245302-21245324 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1115231909 14:31169687-31169709 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1115234143 14:31191805-31191827 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1115547997 14:34480293-34480315 GGGATTTCTCCATGTTGTTCAGG - Intergenic
1115551218 14:34506975-34506997 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
1115563725 14:34606641-34606663 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1115615708 14:35092655-35092677 GCGGTTTCTCCAAGTTGGTCAGG + Intronic
1115689731 14:35830258-35830280 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1116961245 14:50970378-50970400 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1117130140 14:52678072-52678094 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1117689078 14:58286752-58286774 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1118193984 14:63607688-63607710 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1118450905 14:65901397-65901419 GCGTGAGCTCCAGGTTGAGCTGG + Intergenic
1118653555 14:67923488-67923510 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1119305658 14:73606163-73606185 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1119829941 14:77693012-77693034 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1120810764 14:88801163-88801185 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1121170740 14:91852234-91852256 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1121316774 14:92965810-92965832 GGGTTTTCTCCATGTTGATCAGG - Intronic
1122169264 14:99858374-99858396 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1122682895 14:103479829-103479851 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1123722219 15:23069527-23069549 GCGGTTTCTCCATGTTGGTCGGG + Intergenic
1123753004 15:23373068-23373090 GGGTTTTCTCCATGTTGCTCAGG - Intergenic
1124160684 15:27266069-27266091 GAGTTTTCTCCATGTTGGTCAGG + Intronic
1124328148 15:28784385-28784407 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1124574557 15:30896279-30896301 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1124599380 15:31119046-31119068 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1125628564 15:41129347-41129369 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1125666417 15:41434034-41434056 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1125703526 15:41710016-41710038 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1125804651 15:42483002-42483024 GCTTTATCTTCTGGTTCTTCAGG + Intronic
1126158223 15:45585124-45585146 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1126198813 15:45961980-45962002 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1126637997 15:50797804-50797826 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1126655728 15:50975212-50975234 GAGGTATCTCCATGTTGGTCTGG - Intronic
1127073752 15:55306968-55306990 GCGTTGTCTCCTGGATTTTCGGG + Intronic
1128169695 15:65500225-65500247 GGGGTATCTCCATGTTGGTCAGG - Intronic
1128196119 15:65757789-65757811 GGGTTCTCTCCATGTTGGTCAGG - Intronic
1128280382 15:66389095-66389117 GGGGTTTCTCCAAGTTGTTCAGG + Intronic
1128687219 15:69695698-69695720 GCGATATTTCAAGGTTCTTCTGG - Intergenic
1128699902 15:69796594-69796616 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1129808785 15:78489026-78489048 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1129989695 15:79951240-79951262 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1130544914 15:84848948-84848970 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1130655619 15:85790277-85790299 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1130893611 15:88153444-88153466 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1131088792 15:89602667-89602689 CAGTTATCTTAAGGTTGTTCTGG - Intronic
1131103923 15:89717249-89717271 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1131396111 15:92087708-92087730 GGGTTGTCTCCATGTTGGTCAGG + Intronic
1131474925 15:92730124-92730146 GAGTTTTCTCCATGTTGGTCAGG - Intronic
1131528410 15:93171462-93171484 GATTTATGTCCAAGTTGTTCTGG + Intergenic
1131542358 15:93285260-93285282 AAGTGATCTTCAGGTTGTTCAGG + Intergenic
1131820879 15:96272293-96272315 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1132004116 15:98210758-98210780 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1132907752 16:2291880-2291902 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1133019339 16:2960259-2960281 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1133361981 16:5181348-5181370 GTGTTTTCTCCATGTTGGTCAGG - Intergenic
1133951585 16:10398920-10398942 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1134753379 16:16644925-16644947 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1134992678 16:18714156-18714178 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1135333727 16:21583478-21583500 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1135376043 16:21948233-21948255 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1136156165 16:28383641-28383663 GGGGTATCTCCATGTTGCTCAGG - Intronic
1136206921 16:28731647-28731669 GGGGTATCTCCATGTTGCTCAGG + Intronic
1136378683 16:29880510-29880532 GGGGTTTCTCCAGGTTGATCAGG + Intronic
1136523986 16:30815983-30816005 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1136648267 16:31641934-31641956 GGGTTTTCTCCACGTTGTCCAGG + Intergenic
1136668873 16:31838137-31838159 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1136679448 16:31948258-31948280 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1137040100 16:35603020-35603042 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1137543834 16:49384155-49384177 GGGGTTTCTCCACGTTGTTCAGG - Intronic
1138571524 16:57876906-57876928 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1139198558 16:64949615-64949637 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1139540146 16:67608930-67608952 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1139677921 16:68538101-68538123 GAGCTATCTCCATGTTGGTCAGG + Intronic
1139815266 16:69664834-69664856 GGGTTTTCTCCATGTTGCTCAGG - Intronic
1139877177 16:70155579-70155601 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1139907805 16:70378802-70378824 GGGTTTTCTCCATGTTGGTCAGG - Exonic
1140540670 16:75753799-75753821 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1140581075 16:76231718-76231740 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1140649912 16:77076736-77076758 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1141273706 16:82565288-82565310 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1141459272 16:84167822-84167844 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1141583675 16:85018636-85018658 GGGGTATCTCCATGTTGGTCAGG + Intergenic
1141956854 16:87377964-87377986 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1142342047 16:89530028-89530050 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1142546970 17:711244-711266 GCGTGTTCTTCAGGTTGTTAGGG - Intronic
1142553784 17:757969-757991 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1142631909 17:1230608-1230630 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1143456836 17:7073529-7073551 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1143536011 17:7540322-7540344 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1143996204 17:11008514-11008536 GTGTCATCTGCTGGTTGTTCAGG + Intergenic
1144049149 17:11483108-11483130 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1144612317 17:16732525-16732547 ATGTTATCTCTAGGTTGTGCAGG + Intronic
1144697122 17:17312448-17312470 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1144900412 17:18582777-18582799 ATGTTATCTCTAGGTTGTGCAGG - Intergenic
1144922624 17:18777253-18777275 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1145764993 17:27452583-27452605 GCATCATCTCCAGGTTCTTGAGG - Intergenic
1145881411 17:28355414-28355436 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1146113278 17:30111203-30111225 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1146392248 17:32433340-32433362 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1146767347 17:35535386-35535408 GGGGTTTCTCCACGTTGTTCAGG + Intronic
1147275606 17:39313824-39313846 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1147291860 17:39450003-39450025 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1147624222 17:41888925-41888947 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1148078134 17:44951411-44951433 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1148430874 17:47642458-47642480 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1148495254 17:48049582-48049604 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1148525741 17:48331506-48331528 GGGATATCTCCATGTTGGTCAGG - Intronic
1149159938 17:53680424-53680446 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1149763484 17:59254168-59254190 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1149783653 17:59417906-59417928 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1149875899 17:60232736-60232758 GGGTTTTCTCCAGGTTGGGCAGG + Intronic
1150033922 17:61772625-61772647 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1150100203 17:62416689-62416711 GGGTTATCACCATGTTGGTCAGG + Intergenic
1150460178 17:65343967-65343989 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1151285276 17:73106369-73106391 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1151400838 17:73855047-73855069 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1151908075 17:77062402-77062424 GAGGTTTCTCCATGTTGTTCAGG + Intergenic
1152106931 17:78335722-78335744 GGGGTTTCTCCAGGTTGCTCAGG + Intergenic
1152115376 17:78383415-78383437 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1153041748 18:819358-819380 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1154206606 18:12342754-12342776 GTCTTATCTACAGGTGGTTCTGG - Intronic
1154211234 18:12380251-12380273 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1154438570 18:14365949-14365971 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1155227520 18:23741928-23741950 GGGTTTTCTCCACGTTGGTCAGG - Intronic
1155965736 18:32033627-32033649 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1156045639 18:32874175-32874197 GAGTTTTCTCCATGTTGATCAGG - Intergenic
1156530969 18:37814626-37814648 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1156717714 18:40031362-40031384 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1157431725 18:47633789-47633811 GCCTCATCTCCTGCTTGTTCTGG - Intergenic
1157768698 18:50325421-50325443 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
1157972380 18:52285340-52285362 GCGATTTCTCCATGTTGGTCCGG + Intergenic
1158135941 18:54208299-54208321 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1158594525 18:58804548-58804570 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1160258986 18:77273447-77273469 GGGTTTTCTCCATGTTGGTCAGG - Exonic
1160878140 19:1307303-1307325 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1161019929 19:2004486-2004508 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1161111585 19:2473885-2473907 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1161124901 19:2550415-2550437 GCGGTTTCACCATGTTGTTCAGG + Intronic
1161175086 19:2837250-2837272 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1161181605 19:2886971-2886993 GCGGTTTCTCCAGGTTGGTCAGG + Intergenic
1161240919 19:3223435-3223457 GAGTTTTCTCCATGTTGATCAGG + Intergenic
1161506035 19:4644027-4644049 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1162125090 19:8495289-8495311 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1162210813 19:9090623-9090645 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1162387208 19:10366851-10366873 GAGTTTTCTCCATGTTGGTCAGG - Intronic
1162390801 19:10388886-10388908 GGGTTCTCTCCATGTTGTTCAGG - Intergenic
1162408110 19:10487935-10487957 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1162437960 19:10674132-10674154 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1162473464 19:10886245-10886267 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1162611872 19:11761847-11761869 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1162717077 19:12640891-12640913 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1162905747 19:13822786-13822808 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1163079446 19:14926704-14926726 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1163151016 19:15414246-15414268 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1163545306 19:17937922-17937944 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1163659934 19:18570876-18570898 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1163739520 19:19002702-19002724 GGGATATCTCCATGTTGGTCAGG + Intronic
1163841057 19:19610220-19610242 GAGGTTTCTCCATGTTGTTCAGG - Intronic
1163873609 19:19846743-19846765 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1163879164 19:19902447-19902469 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1164118839 19:22247370-22247392 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1164135671 19:22413677-22413699 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1164238742 19:23364254-23364276 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1164251887 19:23484617-23484639 GGGGTATCTCCATGTTGATCAGG + Intergenic
1164276940 19:23727619-23727641 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1165567322 19:36742161-36742183 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1166196489 19:41209280-41209302 GAGGTTTCTCCAGGTTGGTCAGG + Intergenic
1166819857 19:45571336-45571358 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1166987236 19:46668307-46668329 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1167930985 19:52864603-52864625 GAGTTTTCACCATGTTGTTCAGG - Intronic
1167940137 19:52940067-52940089 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1168055275 19:53860539-53860561 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1168328041 19:55548136-55548158 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1168598149 19:57695725-57695747 GGGGTTTCTCCATGTTGTTCAGG + Intronic
926738569 2:16092792-16092814 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
926978502 2:18539264-18539286 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
928569697 2:32592784-32592806 GGGGTTTCTCCATGTTGTTCAGG + Intronic
929643232 2:43602735-43602757 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
930826685 2:55702575-55702597 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
930836101 2:55794951-55794973 GCGATTTCTCCATGTTGGTCAGG + Intergenic
930971461 2:57399535-57399557 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
931011212 2:57916213-57916235 GGGTTTTCTCCATGTTGGTCAGG - Intronic
931208546 2:60170647-60170669 GAGTAATCTCCAAGTTCTTCTGG - Intergenic
931367474 2:61631384-61631406 GGGTTTTCTCCATGTTGCTCAGG + Intergenic
931423960 2:62153803-62153825 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
931847589 2:66220533-66220555 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
932154124 2:69400062-69400084 GGGTTTTCTCCATGTTGGTCAGG + Intronic
932229226 2:70068740-70068762 GCGTTTTCTCCATGTTGGTCAGG - Intergenic
932256348 2:70290792-70290814 GGGTTTTCTCCATGTTGATCAGG - Intronic
932957864 2:76376668-76376690 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
933270029 2:80223463-80223485 GGGTTTTCTCCATGTTGGTCAGG + Intronic
933433964 2:82221050-82221072 GGGTTTTCTCCATGTTGGTCTGG - Intergenic
934770643 2:96905743-96905765 GAGTTTTCTCCATGTTGGTCAGG - Intronic
934929645 2:98411221-98411243 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
935348700 2:102134567-102134589 GGGTTTTCTCCATGTTGGTCAGG + Intronic
935434932 2:103020041-103020063 GGGTTTTCTCCATGTTGATCAGG - Intergenic
935665716 2:105510312-105510334 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
936771645 2:115920732-115920754 GGGTTGTCTCCATGTTGGTCAGG + Intergenic
937090618 2:119203907-119203929 GAGATATCTCCATGTTGATCAGG - Intergenic
937212274 2:120282285-120282307 GGGTTTTCTCCATGTTGGTCAGG - Intronic
937335764 2:121061520-121061542 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
937583031 2:123512400-123512422 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
938013771 2:127850247-127850269 GGGGTATCTCCATGTTGGTCAGG - Intronic
938129463 2:128699538-128699560 GATTTATCTCTAGGTTGTTAGGG + Intergenic
938415503 2:131100600-131100622 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
938424449 2:131172998-131173020 GCATTTTCTCCATGTTGGTCAGG + Intronic
939037517 2:137150048-137150070 GTGTTTTCTCCATGTTGGTCAGG - Intronic
939399831 2:141677678-141677700 GGGGTTTCTCCATGTTGTTCAGG + Intronic
939796688 2:146654516-146654538 GGGTTTTCACCATGTTGTTCAGG - Intergenic
939922729 2:148136951-148136973 GTGTTTTCTCCATGTTGGTCAGG + Intronic
939965697 2:148608098-148608120 GGGTTTTCTCCACGTTGGTCAGG + Intergenic
940926651 2:159370997-159371019 GCGGTTTCTCCATGTTGGTCAGG + Intronic
941031410 2:160516021-160516043 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
941771901 2:169353797-169353819 GAGGTTTCTCCATGTTGTTCAGG - Intronic
942104134 2:172615430-172615452 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
942268924 2:174254577-174254599 GAGTTTTCTCCATGTTGCTCAGG + Intergenic
942272000 2:174285690-174285712 GGGGTATCTCCATGTTGGTCAGG + Intergenic
943907583 2:193519063-193519085 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
944296467 2:198068828-198068850 GGGGTTTCTCCATGTTGTTCAGG - Intronic
944595069 2:201253888-201253910 GGGTTTTCTCCATGTTGGTCAGG - Intronic
944724077 2:202451943-202451965 GCGGTTTCTCCATGTTGGTCAGG + Intronic
945602494 2:211885649-211885671 GCGGTTTCACCAGGTTGTCCAGG + Intronic
945708647 2:213267419-213267441 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
946098737 2:217300604-217300626 GGGTTTTCTCCATGTTGTTTAGG - Intronic
947573850 2:231257004-231257026 GGGTTTTCTCCATGTTGGTCAGG + Intronic
947615200 2:231551664-231551686 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
947624211 2:231609517-231609539 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
947646144 2:231742312-231742334 GGGGTTTCTCCATGTTGTTCAGG + Intronic
948175893 2:235942484-235942506 GGGGTATCTCCATGTTGGTCAGG - Intronic
1169429725 20:5525707-5525729 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1169470084 20:5877647-5877669 GGGTTTTCTCCATGTTGATCAGG + Intergenic
1171067248 20:22029744-22029766 GAGGTTTCTCCATGTTGTTCAGG - Intergenic
1171844216 20:30254609-30254631 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1172236925 20:33383546-33383568 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1172564624 20:35919206-35919228 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1173810253 20:45951081-45951103 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1174015916 20:47488133-47488155 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1174329075 20:49803289-49803311 GGGTTTTCGCCATGTTGTTCAGG - Intergenic
1174381914 20:50161428-50161450 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1174587991 20:51623587-51623609 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1175089548 20:56490621-56490643 GCGGTGTCTCCATGTTGGTCAGG - Intronic
1175442222 20:59000184-59000206 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1177559117 21:22728084-22728106 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1177643879 21:23877617-23877639 GAGGTTTCTCCAGGTTGGTCAGG - Intergenic
1178420686 21:32440907-32440929 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1178498776 21:33109200-33109222 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1178553557 21:33564667-33564689 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1179278087 21:39909985-39910007 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1179767884 21:43587472-43587494 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1180701659 22:17784593-17784615 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1181130694 22:20729976-20729998 CAGTTATGTCCAGGTTGCTCCGG + Exonic
1181384958 22:22537900-22537922 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1181507747 22:23372011-23372033 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1181738449 22:24900586-24900608 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1181837530 22:25623131-25623153 GGGGTATCTCCATGTTGTCCAGG + Intronic
1182214029 22:28700978-28701000 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1182228783 22:28820676-28820698 GGGATTTCTCCATGTTGTTCAGG - Intergenic
1182618225 22:31603039-31603061 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1182648270 22:31828257-31828279 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1182744422 22:32594677-32594699 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1182746616 22:32610771-32610793 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1182824943 22:33257012-33257034 GCGTTTTCTCCATGTTGGTTAGG - Intronic
1182974404 22:34609571-34609593 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1183072823 22:35408271-35408293 GGCTTATCTCCAGCTTATTCTGG + Intronic
1183645207 22:39122103-39122125 GCGGTCTCTCCATGTTGCTCAGG - Intronic
1184351853 22:43949541-43949563 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1185133061 22:49051664-49051686 GCTTTTCCTCCAGGCTGTTCTGG - Intergenic
949407472 3:3729734-3729756 GTAATATCTCCAGGTTTTTCAGG + Intronic
950280545 3:11704187-11704209 GGGTTTTCTCCATGTTGTTCAGG - Intronic
950796976 3:15518135-15518157 GGGTTTTCTCCATGTTGGTCAGG + Intronic
951656978 3:25020172-25020194 GGGTTCTCACCAGGTTGCTCAGG + Intergenic
952261687 3:31746485-31746507 GGGGTTTCTCCACGTTGTTCAGG - Intronic
952408844 3:33028856-33028878 GGGTTTTCTCCATGTTGGTCAGG + Intronic
952921320 3:38286039-38286061 GGGTTTTCTCCATGTTGGTCAGG - Intronic
953001595 3:38938753-38938775 GCGGTTTCTCCATGTTGGTCAGG + Intronic
953323479 3:41992838-41992860 GGGGTCTCTCCATGTTGTTCAGG + Intergenic
953323920 3:41996563-41996585 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
953681662 3:45043514-45043536 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
953684192 3:45063397-45063419 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
954042107 3:47896336-47896358 GGGGTTTCTCCATGTTGTTCAGG - Intronic
954067959 3:48121912-48121934 GAGTTTTCTCCATGTTGGTCAGG - Intergenic
954250227 3:49361687-49361709 GGGTTTTCTCCATGTTGGTCAGG - Intronic
954258775 3:49424040-49424062 GGGGTTTCTCCAGGTTGGTCAGG + Exonic
954549783 3:51471674-51471696 GGGGTTTCTCCATGTTGTTCAGG - Intronic
954585836 3:51735627-51735649 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
954683529 3:52358566-52358588 GCGTGATCTCCAGGTCCTCCTGG - Exonic
955282175 3:57603811-57603833 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
955375253 3:58389806-58389828 GGGGTTTCTCCATGTTGTTCAGG - Intronic
956481709 3:69679379-69679401 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
956598729 3:70996173-70996195 GGGTAATCTCCATGTTGGTCAGG + Intronic
958031509 3:88116327-88116349 GAGTTTTCTCCATGTTGGTCAGG - Intronic
959523168 3:107343532-107343554 GGGTTTTCTCCACGTTGGTCAGG - Intergenic
960811118 3:121628351-121628373 GGGCTTTCTCCATGTTGTTCAGG + Exonic
960830362 3:121840297-121840319 GGGCTTTCTCCATGTTGTTCAGG - Intronic
962222751 3:133577549-133577571 GGGGTTTCTCCATGTTGTTCAGG + Intronic
962450723 3:135514302-135514324 GCGTTATCTGATGGCTGTTCAGG + Intergenic
962690136 3:137887541-137887563 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
963633383 3:147762098-147762120 GAGTTTTCTCCATGTTGGTCAGG - Intergenic
964283103 3:155088490-155088512 GGGTTTTCTCCATGTTGGTCAGG - Intronic
964669667 3:159210861-159210883 GGGATATCTCCATGTTGGTCAGG + Intronic
964949801 3:162276437-162276459 GGGGTATCTCCATGTTGGTCAGG + Intergenic
965593614 3:170385981-170386003 GGGTTTTCTCCATGTTGGTCAGG + Intronic
965905365 3:173699045-173699067 GCGTTATCTCCAGGTTGTTCAGG + Intronic
966185470 3:177223032-177223054 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
966185529 3:177223428-177223450 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
966202057 3:177367735-177367757 GGGGTATCTCCATGTTGGTCAGG + Intergenic
966646090 3:182247653-182247675 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
966771788 3:183510681-183510703 GGGGTATCTCCATGTTGGTCAGG - Intronic
966931180 3:184676783-184676805 GGGTTTTCTCCATGTTGGTCAGG + Intronic
966987440 3:185194419-185194441 GGGTTTTCTCCATGTTGGTCAGG - Intronic
967027579 3:185578247-185578269 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
967847732 3:194057399-194057421 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
968147236 3:196309759-196309781 GGGATTTCTCCATGTTGTTCAGG - Intronic
968270399 3:197399090-197399112 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
970123535 4:12784068-12784090 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
970578668 4:17452785-17452807 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
972178959 4:36441471-36441493 GCGTTGTCTCCTGGATTTTCGGG + Intergenic
972569700 4:40299439-40299461 GGGTTCTCTCTATGTTGTTCAGG + Intergenic
974038470 4:56837816-56837838 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
974051130 4:56943087-56943109 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
974054189 4:56969379-56969401 GGGCTTTCTCCATGTTGTTCAGG - Intronic
974394231 4:61314398-61314420 GGGGTTTCTCCACGTTGTTCAGG + Intronic
976103703 4:81593671-81593693 GGGGTTTCTCCATGTTGTTCAGG - Intronic
976262765 4:83161490-83161512 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
976556593 4:86457968-86457990 GAGTTTTCTCCATGTTGGTCAGG - Intronic
976599052 4:86920972-86920994 GGGGTATCTCCATGTTGGTCAGG - Intronic
977896719 4:102373655-102373677 GGGGTTTCTCCATGTTGTTCAGG + Intronic
978167882 4:105630769-105630791 ACTTTATCCCCAGGTTATTCAGG - Intronic
978172681 4:105692505-105692527 AAGTTATTTCCAGGTTGTTCTGG + Intronic
978326761 4:107566409-107566431 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
978602197 4:110440456-110440478 GGGGTTTCTCCATGTTGTTCAGG + Intronic
978794514 4:112695857-112695879 GGGTTTTCTCCATGTTGATCAGG - Intergenic
978805574 4:112796539-112796561 GGGTTCTCACCATGTTGTTCAGG + Intergenic
979433920 4:120666227-120666249 GCCTTTTCTCCAGATTGTGCTGG - Intergenic
979813710 4:125071989-125072011 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
980570910 4:134618907-134618929 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
980847576 4:138342507-138342529 GGGTTATCTCCATGTTGGTCAGG + Intergenic
980944502 4:139305723-139305745 GGGGTTTCTCCATGTTGTTCAGG + Intronic
981095157 4:140771783-140771805 GCAATTTCTCCAGGTTGTTTTGG - Intergenic
981213326 4:142134602-142134624 GGGGTTTCTCCATGTTGTTCAGG - Intronic
982178278 4:152727061-152727083 GGGGTATCTCCATGTTGGTCAGG + Intronic
982314680 4:154020280-154020302 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
982585472 4:157231366-157231388 GGGTTATCACCATGTTGATCAGG + Intronic
983181683 4:164656061-164656083 GCGTTGTCTCCTGGGTTTTCGGG - Intergenic
984404130 4:179304891-179304913 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
985097906 4:186430959-186430981 GCGGTTTCTCCATGTTGGTCAGG + Intronic
985227385 4:187777244-187777266 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
986566506 5:9120967-9120989 GGGTTTTCTCCATGTTGGTCAGG + Intronic
987770525 5:22297210-22297232 GGGGTTTCTCCATGTTGTTCAGG + Intronic
987859280 5:23463616-23463638 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
988084658 5:26459592-26459614 GCGCCATCTCCAGGGTGTACTGG + Intergenic
989053875 5:37347502-37347524 GGGTTTTCTCCATGTTGGTCAGG - Intronic
989234278 5:39126865-39126887 GGGTTTTCTCCATGTTGGTCAGG - Intronic
989321443 5:40139170-40139192 CAGTTATCTCCAGGTTTTTTTGG - Intergenic
990029797 5:51243600-51243622 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
990258870 5:53999719-53999741 GGGTTTTCTCCATGTTGGTCGGG - Intronic
990441536 5:55850897-55850919 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
990573400 5:57101814-57101836 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
990581563 5:57171678-57171700 GGGGTTTCTCCAAGTTGTTCAGG + Intergenic
991914391 5:71591626-71591648 GAGTTTTCTCCATGTTGGTCAGG + Intronic
992314755 5:75541090-75541112 GGGGTTTCTCCATGTTGTTCAGG - Intronic
992681720 5:79160018-79160040 GTGGTTTCTCCATGTTGTTCAGG - Intronic
992689832 5:79231499-79231521 GGGTTTTCTCCATGTTGGTCAGG + Intronic
993191390 5:84686757-84686779 GGGGTATCTCCATGTTGGTCAGG + Intergenic
993428384 5:87799242-87799264 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
993696454 5:91067332-91067354 GGGGTTTCTCCATGTTGTTCAGG + Intronic
994570066 5:101504577-101504599 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
995045775 5:107644890-107644912 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
995403850 5:111771569-111771591 GAGTTTTCTCCATGTTGGTCAGG - Intronic
995564632 5:113421215-113421237 GGGGTTTCTCCAGGTTGTTCAGG + Intronic
995834332 5:116385370-116385392 GGGGTTTCTCCATGTTGTTCAGG + Intronic
996002607 5:118382605-118382627 GCGGTTTCTCCATATTGTTCAGG - Intergenic
996066908 5:119089815-119089837 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
996553254 5:124751734-124751756 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
997131657 5:131283116-131283138 GGGGTTTCTCCATGTTGTTCAGG + Intronic
997131722 5:131283682-131283704 GAGGTTTCTCCATGTTGTTCAGG + Intronic
997494334 5:134309271-134309293 GCGGTTTCTCCATGTTGGTCAGG + Intronic
997502719 5:134389736-134389758 GGGTTTTCTCCATGTTGGTCAGG + Intronic
998078402 5:139255088-139255110 GGGTTATCACCATGTTGGTCAGG + Intronic
998240556 5:140439476-140439498 GCGTTTTCACCATGTTGTCCAGG - Intronic
998839517 5:146238315-146238337 GGGTTTTCTCCATGTTGGTCAGG - Intronic
998969841 5:147579283-147579305 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
999764201 5:154726029-154726051 GGGTTATCTCCATGTTGCCCAGG + Intronic
999836550 5:155379770-155379792 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1001497188 5:172197296-172197318 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1001819812 5:174701234-174701256 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1002510419 5:179712614-179712636 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1002611597 5:180422464-180422486 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1002722392 5:181270752-181270774 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1002758316 6:182127-182149 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1003401213 6:5792809-5792831 GCTTTGTCTCCAGGCTGTTTGGG - Intergenic
1003937282 6:10988371-10988393 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1003948571 6:11097027-11097049 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1004911908 6:20293824-20293846 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1005032748 6:21526504-21526526 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1005623551 6:27642512-27642534 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1005935204 6:30515930-30515952 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1006012056 6:31051046-31051068 GAGTTTTCTCCAAGTTGGTCAGG - Intergenic
1006494420 6:34411516-34411538 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1008173990 6:48243809-48243831 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1008247956 6:49202492-49202514 GCATTATCTCAAGGTTATTATGG - Intergenic
1008845742 6:55961659-55961681 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1011035907 6:82974361-82974383 TTGTTATCTGCAGGTTGTTGTGG - Intronic
1011127649 6:84024040-84024062 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1011180604 6:84615615-84615637 TTGTTATCTCTAGGTTGTTGTGG - Intergenic
1011561304 6:88619357-88619379 GGGGTATCCCCATGTTGTTCAGG + Intronic
1011574185 6:88776524-88776546 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1013004434 6:106058759-106058781 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1013122294 6:107151551-107151573 GAGGTTTCTCCATGTTGTTCAGG + Intergenic
1013137798 6:107299422-107299444 GCGTTGTCTCCTGGATTTTCGGG - Intronic
1013202971 6:107919100-107919122 GAGTTTTCTCCATGTTGGTCAGG + Intronic
1013491797 6:110654747-110654769 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1014183822 6:118412771-118412793 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1015128449 6:129782155-129782177 CTGTAATCTCCATGTTGTTCAGG - Intergenic
1016047182 6:139492942-139492964 GGGTTTTCTCCACGTTGGTCAGG - Intergenic
1016072021 6:139750262-139750284 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1016575789 6:145568512-145568534 GCGGTTTCTCCAGGTTGACCAGG + Intronic
1017492351 6:154955657-154955679 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1017867768 6:158459237-158459259 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1018010456 6:159665294-159665316 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1018189282 6:161294474-161294496 GGGTTTTCACCATGTTGTTCAGG - Intergenic
1018770171 6:166963461-166963483 GGGCTTTCTCCAGGTTGGTCAGG - Intergenic
1019543889 7:1563771-1563793 GCGGTTTCACCATGTTGTTCAGG - Intergenic
1020038002 7:4977093-4977115 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1020159705 7:5760323-5760345 GGGGTTTCTCCACGTTGTTCAGG - Intronic
1021460164 7:20877896-20877918 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1021491924 7:21228345-21228367 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1021724373 7:23535097-23535119 GGGGTTTCTCCAGGTTGGTCCGG + Intergenic
1021882841 7:25110970-25110992 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1022264070 7:28736358-28736380 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1023942385 7:44777846-44777868 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1024362885 7:48487117-48487139 GGGGTATCTCCATGTTGGTCAGG - Intronic
1024567082 7:50690103-50690125 GGGGTATCTCCATGTTGGTCAGG - Intronic
1025050950 7:55734168-55734190 TTGTTATCTCCATGCTGTTCTGG + Intergenic
1025687109 7:63727391-63727413 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1025945794 7:66103490-66103512 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1026196619 7:68178899-68178921 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
1026199460 7:68201658-68201680 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1026763154 7:73141693-73141715 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1026815301 7:73506658-73506680 GGGTTCTCTCCATGTTGGTCAGG - Intronic
1026815931 7:73511827-73511849 GGGGTATCTCCATGTTGCTCAGG - Intronic
1026919897 7:74147686-74147708 GGGATTTCTCCATGTTGTTCAGG - Intergenic
1026930051 7:74218887-74218909 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1027039619 7:74951475-74951497 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1027084023 7:75250909-75250931 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1027136715 7:75629731-75629753 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1027258813 7:76449143-76449165 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1027280065 7:76603002-76603024 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1027310178 7:76947213-76947235 GGGTTTTCTCCATGTTGATCAGG + Intergenic
1027864786 7:83631962-83631984 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1028556638 7:92133456-92133478 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1028588031 7:92470467-92470489 GCGTTGTCTCCTGGATTTTCAGG + Exonic
1029127771 7:98306575-98306597 GAGCTCTCACCAGGTTGTTCAGG - Intronic
1029191915 7:98778029-98778051 GAGTTTTCTCCATGTTGTTCAGG + Intergenic
1029560216 7:101297880-101297902 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1031042772 7:116856061-116856083 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1031411572 7:121445683-121445705 GGGTTTTCTCCATGTTGATCAGG - Intergenic
1031822645 7:126523687-126523709 GCGGTATCGCCAGGTTGGCCAGG + Intronic
1032029337 7:128469545-128469567 GGGTTATCACCATGTTGGTCAGG + Intergenic
1032212544 7:129929125-129929147 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1032251069 7:130257832-130257854 GAGTTTTCTCCATGTTGGTCAGG + Intergenic
1032407647 7:131668264-131668286 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1032442305 7:131951299-131951321 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1033526140 7:142215567-142215589 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1034123399 7:148649249-148649271 GGGGTGTCTCCAGGTTTTTCAGG - Intergenic
1034250698 7:149688270-149688292 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1034253433 7:149710825-149710847 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1034352956 7:150429127-150429149 GGGTTCTTTCCAGGTTGCTCAGG - Intergenic
1035237017 7:157504192-157504214 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1035615184 8:994389-994411 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1035712932 8:1732172-1732194 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1037216799 8:16464399-16464421 GGGTTTTCTCCATATTGTTCAGG - Intronic
1038775933 8:30530651-30530673 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1038794690 8:30699415-30699437 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1038813642 8:30878576-30878598 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1039016581 8:33156338-33156360 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1039177395 8:34825272-34825294 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1040985346 8:53287964-53287986 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1041224880 8:55688222-55688244 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1042454466 8:68984581-68984603 GAGTTATCTCAAGGTAGTTTAGG - Intergenic
1042509286 8:69594240-69594262 GGGTTTTCTCCATGTTGTTCAGG + Intronic
1042828120 8:72998630-72998652 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1042922167 8:73930702-73930724 GGGTTTTCACCAGGTTGGTCAGG + Intergenic
1043435057 8:80229875-80229897 GGGATTTCTCCATGTTGTTCAGG - Intronic
1043468206 8:80535236-80535258 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1043475403 8:80600865-80600887 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1044189644 8:89299769-89299791 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1044663070 8:94610483-94610505 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1044740564 8:95322203-95322225 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1044928896 8:97233230-97233252 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1045025374 8:98081734-98081756 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1045516703 8:102866034-102866056 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1045605791 8:103773536-103773558 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1046601578 8:116323244-116323266 GAATTATCTCAAGTTTGTTCTGG - Intergenic
1046914589 8:119666587-119666609 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1047089386 8:121556856-121556878 AGGTTTTCTCCATGTTGTTCAGG + Intergenic
1047530307 8:125668067-125668089 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1047683112 8:127275348-127275370 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1047818820 8:128495582-128495604 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1047975048 8:130121588-130121610 GAGTTTTCTCCATGTTGATCAGG - Intronic
1048147822 8:131862717-131862739 GGGATTTCTCCAGGTTGGTCAGG - Intergenic
1048435558 8:134413733-134413755 GGGTTTTCACCATGTTGTTCAGG + Intergenic
1049088436 8:140495527-140495549 GGGTTTTCTCCACGTTGGTCAGG + Intergenic
1050077318 9:1878438-1878460 GGGGTTTCTCCAGGTTGGTCAGG + Intergenic
1050462068 9:5885562-5885584 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1051623919 9:19079981-19080003 GGGTTTTCTCCATGTTGGTCAGG - Intronic
1051800416 9:20926590-20926612 GCGGTTTCTCCATGTTGGTCAGG - Intronic
1052285811 9:26784382-26784404 GCGTTTTCCCCATGTTGATCAGG + Intergenic
1052392833 9:27901151-27901173 GCTGTATCTCCACGTGGTTCTGG - Intergenic
1052815222 9:33097735-33097757 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1053048483 9:34939087-34939109 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1053165049 9:35838427-35838449 GCTTGATCTCCAGGTTGTAGTGG + Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1054904505 9:70402956-70402978 GGGTTTTCACCAGGTTGGTCAGG - Intronic
1055045900 9:71923457-71923479 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1055056845 9:72031763-72031785 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1055927291 9:81523684-81523706 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1055930436 9:81554540-81554562 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1055946721 9:81698222-81698244 GGGTTTTCTCCATGTTGATCAGG + Intergenic
1055967180 9:81876889-81876911 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1055971412 9:81916086-81916108 ATGTTATCTCTAGGTAGTTCTGG + Intergenic
1057197577 9:93123473-93123495 ACGGTATCTCCATGTTGGTCAGG + Intronic
1057377138 9:94535370-94535392 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1058563083 9:106250346-106250368 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1058589501 9:106547569-106547591 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1058668542 9:107341700-107341722 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1059706391 9:116827116-116827138 GGGTTTTCTCCATGTTGCTCAGG - Intronic
1060351139 9:122861297-122861319 GGGGTATCTCCATGTTGGTCAGG - Intronic
1060370209 9:123062074-123062096 GGGTTTTCTCCACGTTGGTCAGG - Intronic
1060649201 9:125310727-125310749 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1061142340 9:128775270-128775292 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1061238364 9:129354836-129354858 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1061554676 9:131359838-131359860 GGGGTATCTCCATGTTGGTCAGG - Intergenic
1185497783 X:570822-570844 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1185585343 X:1238700-1238722 GGGGTTTCTCCAGGTTGGTCAGG - Intergenic
1185805705 X:3055149-3055171 GGGGTTTCTCCATGTTGTTCAGG - Intronic
1185955424 X:4483864-4483886 GCGGTTTCACCATGTTGTTCAGG - Intergenic
1186743272 X:12539823-12539845 GGGTTTTCTCCATGTTGGTCAGG + Intronic
1186867895 X:13739552-13739574 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1186973792 X:14877531-14877553 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1186994192 X:15102169-15102191 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1187055044 X:15734922-15734944 GGGGTTTCTCCAGGTTGGTCAGG + Intronic
1188219360 X:27522216-27522238 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1188374389 X:29410011-29410033 GGGTTTTCTCCATGTTGATCAGG + Intronic
1188701736 X:33272736-33272758 TGGTTATCTCCACATTGTTCTGG + Intronic
1189694830 X:43653964-43653986 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1189846028 X:45139251-45139273 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1190169025 X:48096854-48096876 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1190410417 X:50131593-50131615 GCGGTTTCTCCATGTTGGTCAGG - Intergenic
1191246547 X:58232749-58232771 GGGGTATCTCCATGTTGGTCAGG + Intergenic
1191615338 X:63163980-63164002 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1191620960 X:63214943-63214965 GGGGTTTCTCCATGTTGTTCAGG + Intergenic
1192344311 X:70288893-70288915 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1192497903 X:71628483-71628505 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1193017549 X:76752581-76752603 ACGTTTTCTCCATGTTGCTCAGG - Intergenic
1194060879 X:89196194-89196216 GGGTTTTCTCCACGTTGGTCAGG - Intergenic
1194246520 X:91518922-91518944 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1194258983 X:91670729-91670751 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1194481128 X:94425374-94425396 GCGGTTTCTCCATGTTGGTCAGG + Intergenic
1197163696 X:123352269-123352291 GGGGTTTCTCCATGTTGTTCAGG + Intronic
1197217990 X:123884290-123884312 GGGGTTTCTCCAGGTTGGTCAGG - Intronic
1197523246 X:127526139-127526161 GGGGTTTCTCCATGTTGTTCAGG - Intergenic
1197954266 X:131929833-131929855 GCGTTGTCTCCTGGATTTTCGGG + Intergenic
1198224138 X:134630160-134630182 GCGGTTTCTCCATGTTGGTCAGG + Intronic
1198985302 X:142444711-142444733 GGGTTCTCACCATGTTGTTCAGG + Intergenic
1200183732 X:154168229-154168251 GGGTTTACTCCATGTTGTTCAGG + Intergenic
1200189386 X:154205357-154205379 GGGTTTACTCCATGTTGTTCAGG + Intergenic
1200195141 X:154243166-154243188 GGGTTTACTCCATGTTGTTCAGG + Intergenic
1200200791 X:154280287-154280309 GGGTTTACTCCATGTTGTTCAGG + Intronic
1200565482 Y:4760166-4760188 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1202065650 Y:20936735-20936757 GGGGTATCACCACGTTGTTCAGG - Intergenic
1202360461 Y:24104387-24104409 GCGGTTTCACCATGTTGTTCAGG - Intergenic
1202391124 Y:24371547-24371569 GGGTTTTCTCCATGTTGGTCAGG - Intergenic
1202479660 Y:25298569-25298591 GGGTTTTCTCCATGTTGGTCAGG + Intergenic
1202510317 Y:25565731-25565753 GCGGTTTCACCATGTTGTTCAGG + Intergenic