ID: 965906271

View in Genome Browser
Species Human (GRCh38)
Location 3:173710596-173710618
Sequence GACATTGCACTCGTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965906271_965906273 -9 Left 965906271 3:173710596-173710618 CCACAGCACACGAGTGCAATGTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 965906273 3:173710610-173710632 TGCAATGTCTTTGATAGCATGGG 0: 1
1: 0
2: 1
3: 9
4: 179
965906271_965906272 -10 Left 965906271 3:173710596-173710618 CCACAGCACACGAGTGCAATGTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 965906272 3:173710609-173710631 GTGCAATGTCTTTGATAGCATGG 0: 1
1: 0
2: 1
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965906271 Original CRISPR GACATTGCACTCGTGTGCTG TGG (reversed) Intronic
902668839 1:17958018-17958040 GAATTTGCCATCGTGTGCTGGGG + Intergenic
904670966 1:32165264-32165286 GGCCTTGAACTCCTGTGCTGAGG + Intronic
907659536 1:56379082-56379104 GACTTTGCCCTGGAGTGCTGAGG - Intergenic
909796285 1:79740924-79740946 GACATTGCTAACGTGTGTTGAGG + Intergenic
911512813 1:98828006-98828028 AGCCTTGCACTAGTGTGCTGTGG + Intergenic
915218702 1:154356827-154356849 GAACTTGGACTTGTGTGCTGGGG - Intergenic
1068402813 10:56552389-56552411 GTCATTGCAGTAGTTTGCTGAGG + Intergenic
1069896143 10:71681382-71681404 GAGATTTCAGTCGTGTGCAGTGG + Intronic
1075034444 10:119052425-119052447 GCCATTGCACTCCAGTGCTTGGG - Intronic
1077283311 11:1755067-1755089 GACCTGGCACTCTTGTGCTTGGG - Intronic
1083007451 11:59360721-59360743 GACTCTGCATTCGTTTGCTGAGG + Intergenic
1084309526 11:68308699-68308721 GACCTTGCAGTAGTGTGCTTTGG + Intergenic
1087382820 11:97428790-97428812 GACACTGCAATAGTATGCTGTGG + Intergenic
1097185889 12:57196081-57196103 GGCATTGCACTTGTGCTCTGCGG - Exonic
1101158676 12:101952038-101952060 AACATGGCACCGGTGTGCTGGGG - Intronic
1113107635 13:106788625-106788647 GAAATTGCACTGAAGTGCTGGGG + Intergenic
1114899789 14:27043398-27043420 GACATGGAACGTGTGTGCTGTGG + Intergenic
1116184407 14:41578298-41578320 GACATTGCTTACGAGTGCTGTGG - Intergenic
1128055074 15:64693319-64693341 GGTATTGCAGTGGTGTGCTGGGG + Intronic
1138433234 16:56982699-56982721 ACCATAGCACACGTGTGCTGGGG + Intronic
1148785020 17:50141981-50142003 GGCATGTCACTTGTGTGCTGTGG - Intronic
1154361448 18:13665526-13665548 GAAATTGCACTGGTTTGCTGAGG + Exonic
1164456058 19:28408025-28408047 GACATTGGACTTGTTTTCTGTGG - Intergenic
925379075 2:3411872-3411894 GCCAGTGCACTCAGGTGCTGTGG - Intronic
932111277 2:69003356-69003378 GACATTCCAATCTTCTGCTGAGG + Intergenic
932716902 2:74107280-74107302 GACCTTGCATTTCTGTGCTGCGG - Exonic
935558101 2:104532638-104532660 GATATTGCAATGGAGTGCTGAGG + Intergenic
944747714 2:202675151-202675173 GACCTTGAACTCCTGTGCTCAGG - Intronic
1172259737 20:33552714-33552736 GACATTTCACACATTTGCTGGGG - Intronic
1173563392 20:44022070-44022092 GCCATTGCTCACTTGTGCTGTGG - Intronic
1175161822 20:57013913-57013935 GACCTTTCCCTCGGGTGCTGAGG + Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1176035566 20:63034854-63034876 GACCTTGCATGCGTGTCCTGCGG - Intergenic
1178488145 21:33031733-33031755 GACAATGCCCTGGGGTGCTGAGG - Intergenic
1181811999 22:25408956-25408978 GACCTTGCAGTAGTGTGCTTTGG - Intergenic
950750514 3:15124448-15124470 GACATTGGACTCATTGGCTGAGG + Intergenic
957071994 3:75574752-75574774 GACATTGGACTCATTGGCTGAGG - Intergenic
960335214 3:116409473-116409495 GAAATTGCACTCATGACCTGAGG + Intronic
965906271 3:173710596-173710618 GACATTGCACTCGTGTGCTGTGG - Intronic
967104849 3:186247340-186247362 GACAGTGCCCTTGGGTGCTGTGG - Intronic
969738384 4:9006288-9006310 GACATTGGACTCATTGGCTGAGG + Intergenic
969797570 4:9537831-9537853 GACATTGGACTCATTGGCTGAGG + Intergenic
971632093 4:29006204-29006226 GACATTGCTCTGGGGTGCTTAGG + Intergenic
971684235 4:29744067-29744089 AGCATTGCACTCTTGTGCTTTGG - Intergenic
977888880 4:102283503-102283525 GACACTGAACTAATGTGCTGAGG + Intronic
979016276 4:115437776-115437798 CACATTGCCCTCGTGTGATTGGG + Intergenic
989957869 5:50376746-50376768 CACAGTGCAGTGGTGTGCTGAGG - Intergenic
992999458 5:82366034-82366056 CACACAGCACTCGTGAGCTGTGG - Intronic
993102962 5:83563847-83563869 GACATTGCATTTGTGTGCTTAGG + Intronic
993140801 5:84030860-84030882 GTCATTGTACTAGTGTGCTAGGG + Intronic
993284327 5:85971580-85971602 GACCTTGCAGTCTTCTGCTGTGG + Intergenic
1000041308 5:157487144-157487166 GAGAGTGTACTCGTGTGCTGAGG - Intronic
1001977574 5:176012665-176012687 GCCATTGCACTCTTGTCCTGGGG + Intronic
1002239847 5:177831104-177831126 GCCATTGCACTCTTGTCCTGGGG - Intergenic
1016231493 6:141810764-141810786 GGGATTTCACTCCTGTGCTGAGG + Intergenic
1016428548 6:143959164-143959186 GACATTGCTCTCAGCTGCTGGGG - Intronic
1018980954 6:168601363-168601385 GACACTGCACAGGGGTGCTGAGG + Intronic
1019806303 7:3128697-3128719 GTCATTCCACTTGTGTTCTGTGG + Intergenic
1024966379 7:55025599-55025621 CACATTGCTCTCCTGTGCTCTGG - Intronic
1029689166 7:102169442-102169464 GACATGGGACACGTGGGCTGAGG - Intronic
1034397475 7:150838216-150838238 GCCCTGGCACTCCTGTGCTGGGG - Intronic
1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG + Intronic
1034828501 7:154288463-154288485 GAGATTGCACTCCTGGTCTGAGG - Intronic
1034835815 7:154350924-154350946 GAAATTGCACTCCTGCGCTGAGG + Intronic
1036288502 8:7465850-7465872 GAAATTGCACACATGTGCAGGGG + Intergenic
1036332973 8:7845678-7845700 GAAATTGCACACATGTGCAGGGG - Intergenic
1037946813 8:22994804-22994826 GCCATTGCACTCCAGTGCAGTGG - Intronic
1038068603 8:23988977-23988999 GCCTTTTGACTCGTGTGCTGTGG - Intergenic
1042876442 8:73444577-73444599 GACATTGTACTCACTTGCTGAGG + Intronic
1047334068 8:123919508-123919530 GCCATTGCAGTGCTGTGCTGTGG - Intronic
1050284768 9:4089970-4089992 GACATTGCACCCCTCTGCCGTGG - Intronic
1055837079 9:80456199-80456221 GTCATTGCATTTGTGTGGTGTGG + Intergenic
1057449479 9:95144020-95144042 GAAATTCCACTGGTGTACTGTGG + Intronic
1060269882 9:122132757-122132779 GACATTGCAATCCTGGGCTACGG + Intergenic
1188980499 X:36722443-36722465 GATATTGCACATGTGTTCTGAGG + Intergenic
1190775138 X:53546565-53546587 GACATCCCACTCTTGTTCTGAGG - Exonic