ID: 965906615

View in Genome Browser
Species Human (GRCh38)
Location 3:173715421-173715443
Sequence CACCCATCACTTATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965906615_965906618 26 Left 965906615 3:173715421-173715443 CCTTGTTCCATAAGTGATGGGTG 0: 1
1: 0
2: 2
3: 5
4: 98
Right 965906618 3:173715470-173715492 TATTAAGAGCTTTAATGTTTAGG 0: 1
1: 0
2: 1
3: 34
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965906615 Original CRISPR CACCCATCACTTATGGAACA AGG (reversed) Intronic
902839701 1:19067131-19067153 CAGCCATCACTTCTGAAACTGGG + Intergenic
923221396 1:231897445-231897467 CAGTTATCATTTATGGAACAAGG + Intronic
923689066 1:236175669-236175691 CCCCCATCACTGAGAGAACATGG + Intronic
1067759862 10:49036758-49036780 CACCCAGCAGATGTGGAACAAGG + Intronic
1068042366 10:51841239-51841261 CATTCATCATTTATTGAACATGG + Intronic
1070378813 10:75860874-75860896 CACCTGCCACTTATTGAACATGG + Intronic
1072407850 10:95171133-95171155 CACCCAGCACTGACAGAACAAGG + Intergenic
1075397755 10:122140276-122140298 CAGCCATGACTTATTGATCAAGG - Intronic
1090066928 11:123511183-123511205 CACCCATTCCTTATACAACAGGG - Intergenic
1090609384 11:128456620-128456642 CACACATCAAATATGGGACAAGG - Intergenic
1101861539 12:108486285-108486307 CACCCATCACTCATTGGATAAGG - Intergenic
1108455959 13:50613845-50613867 CACCCATCACTCAGGAAAGAGGG + Intronic
1109818915 13:67625516-67625538 TACTCATCACTTATTGAATAAGG + Intergenic
1110540508 13:76701893-76701915 CACCCATCCCCTATTGATCAAGG + Intergenic
1111964980 13:94851649-94851671 CACCCATTAATAATTGAACATGG - Intergenic
1113187989 13:107711669-107711691 CACACAGACCTTATGGAACACGG - Intronic
1114678988 14:24467636-24467658 CACCCAGGACTTTTGGAAGATGG + Intergenic
1114909975 14:27179684-27179706 ACCTCATCACCTATGGAACATGG - Intergenic
1117378183 14:55134851-55134873 CACACATCTCTTTTTGAACATGG - Intronic
1124254437 15:28129530-28129552 CACCTACCACCTAGGGAACAGGG + Intronic
1125378373 15:39058937-39058959 CACCCAGCAATGATGAAACATGG + Intergenic
1126096289 15:45093260-45093282 CACCCAACTCTTGTGGAAGAGGG + Exonic
1127644835 15:60947727-60947749 TACCCATGACTTCTGGAAAACGG - Intronic
1128943804 15:71808561-71808583 TTCCCATCTCTTCTGGAACACGG - Intronic
1132578894 16:676220-676242 CTCCCAGCACTTTTGGGACAGGG - Intronic
1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG + Intergenic
1137768355 16:50995147-50995169 CAGACATCACTAATGGATCACGG + Intergenic
1137899035 16:52245212-52245234 CATCCATCAGTTATTGAATAAGG + Intergenic
1144821387 17:18077032-18077054 GCCCCAGCCCTTATGGAACACGG - Intergenic
1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG + Intronic
1155062584 18:22241852-22241874 CACAAATCACGGATGGAACAAGG + Intergenic
1155086918 18:22467724-22467746 AACCCATCGATTCTGGAACATGG - Intergenic
1156121800 18:33852686-33852708 AACACATCACTTACGGATCAAGG + Exonic
1159962613 18:74567387-74567409 CAGCAATCACTTACGGAACCCGG + Exonic
1160473999 18:79166582-79166604 CACCCATCCCTGACTGAACACGG + Intronic
1162554392 19:11377908-11377930 GACTCAAGACTTATGGAACAGGG - Exonic
1164294852 19:23900891-23900913 CATCCATCACCTATGAAATAGGG + Intergenic
1168653336 19:58108201-58108223 CACACATAACTTATTAAACATGG - Intronic
928040610 2:27872833-27872855 CACCCATCAAATAAGAAACATGG + Intronic
932417591 2:71583266-71583288 CCCCCATCTCTTATGTAAAAGGG - Intronic
933875785 2:86620699-86620721 AATCCATCTCTTATAGAACAGGG + Intronic
942997228 2:182277334-182277356 CAGCCAACACTTAGGGAAAATGG + Intronic
943956887 2:194203222-194203244 CAAGCATCATTTATTGAACAGGG + Intergenic
947007738 2:225531333-225531355 CACTCATCCCTCAAGGAACAGGG + Intronic
947090982 2:226511132-226511154 CATCAATCAGTCATGGAACATGG + Intergenic
948535866 2:238646329-238646351 ATCCCATCACTTTTGGACCATGG - Intergenic
1170622630 20:18008275-18008297 AACCCACCAGTTATGGATCAAGG - Intronic
1175945878 20:62558523-62558545 CACCCAGCACTCCTGAAACAGGG - Intronic
1180021681 21:45132522-45132544 CCCCCATAAGTTATAGAACAGGG + Intronic
950157426 3:10733169-10733191 CATCCATCAGCTATGGAACAAGG + Intergenic
950354571 3:12395731-12395753 AACCCATCATTTCTGGACCATGG + Intronic
952608189 3:35174509-35174531 TACACATCACTTATTGAAAAGGG + Intergenic
955085228 3:55696322-55696344 CAACAATGACTTATGGAAGAAGG - Intronic
956221425 3:66907894-66907916 AGCCCATCACTTATAGAGCAAGG - Intergenic
957871031 3:86090728-86090750 CACCCATCCCTTATGGCACATGG + Intergenic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
963086605 3:141442855-141442877 CAGCCATCACTAATGGGCCAAGG + Exonic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
967295401 3:187959309-187959331 CAGGCATCACTTCTTGAACATGG - Intergenic
974396557 4:61343462-61343484 CACACATCACTTTTGATACAGGG - Intronic
981167535 4:141579703-141579725 TAACCATCATTTCTGGAACAAGG + Intergenic
981891111 4:149738489-149738511 CACCCATCACCTGTGGACCGTGG + Intergenic
982524118 4:156456163-156456185 CACCCATCCCTTATTCAAGATGG - Intergenic
982638746 4:157929731-157929753 CACTCATACCTTATAGAACAGGG + Intergenic
983284499 4:165722092-165722114 CACACATCAGTTAGGGAGCAGGG - Intergenic
984120548 4:175737108-175737130 CACCCACCATTTACAGAACACGG + Intronic
987044142 5:14090760-14090782 CACCCAACAAATATGGAATAGGG - Intergenic
987982317 5:25101917-25101939 CATTCATCATTTATGGAAAAAGG - Intergenic
991306724 5:65184816-65184838 CACCCAGTACTTATGGCAAAAGG - Intronic
992653034 5:78880097-78880119 GGCCAATCTCTTATGGAACAGGG - Intronic
993515130 5:88822854-88822876 CAACCATCTCATATGGATCATGG - Intronic
994038125 5:95225956-95225978 CATCCATCTCTTAGGGAATAGGG - Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
997422459 5:133780084-133780106 CACCCATCAGTCATGGGTCAAGG + Intergenic
1001149057 5:169210897-169210919 CACCCAACATCAATGGAACATGG - Intronic
1003650065 6:7951289-7951311 CACCCTTCAGTTGTGGAACTAGG - Intronic
1005881310 6:30063003-30063025 CACACATGACTTAGAGAACATGG + Intronic
1009553351 6:65129068-65129090 CACCCACCATTTATTGAATATGG - Intronic
1018070610 6:160161399-160161421 CACCCATCACTTGCTGACCAAGG - Intergenic
1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG + Intergenic
1019758683 7:2792417-2792439 CACCCTGCACTGACGGAACAGGG + Intronic
1021001099 7:15331345-15331367 CAGCCATAATTTCTGGAACAGGG + Intronic
1021408974 7:20306579-20306601 AAACCATCACTTGTTGAACAGGG + Intergenic
1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG + Intronic
1023084825 7:36559966-36559988 CCCACATCATTTATTGAACAGGG + Intronic
1027875939 7:83768119-83768141 AACCCATCATTCCTGGAACAAGG - Intergenic
1028278499 7:88890008-88890030 CCAGCATCACTTATTGAACAAGG + Intronic
1031076413 7:117217355-117217377 CAGCCATCATTTATGGGAAATGG + Intronic
1032621804 7:133541882-133541904 CACCCCTCACTCATGACACAGGG - Intronic
1032777262 7:135126776-135126798 CCAGCATCACTTATTGAACAGGG - Intronic
1034335820 7:150323070-150323092 CACCCAACATGTATTGAACAAGG + Intronic
1034376619 7:150650488-150650510 CCCCAATAACTTATGGAAAAAGG - Intergenic
1039203320 8:35121010-35121032 CACTCATCAGTTATGGTACATGG + Intergenic
1042918898 8:73902203-73902225 CACCAATCACTTCTTCAACATGG - Intergenic
1043551326 8:81376206-81376228 CATCCATCCCTTCTGGAATAGGG - Intergenic
1044035146 8:87292832-87292854 CACTCATCACGTGTGAAACAGGG - Intronic
1051074843 9:13220950-13220972 GACCCATCACTAAAGGAACAAGG + Intronic
1055226924 9:74008261-74008283 CAGCCATCACTGAAGGGACAGGG + Intergenic
1185534809 X:852570-852592 CTCCAATAACTTATGGAAAAGGG - Intergenic
1185749151 X:2596771-2596793 CATCCATAAATTATGGAAGAGGG - Intergenic
1186606468 X:11097988-11098010 GAGCTAACACTTATGGAACAGGG + Intergenic
1190052358 X:47159735-47159757 ATCCCAGCACTTATTGAACAGGG - Intronic
1201798270 Y:17925279-17925301 CAGGCATTACTTAAGGAACAAGG - Intergenic
1201803283 Y:17980678-17980700 CAGGCATTACTTAAGGAACAAGG + Intergenic
1202328829 Y:23722979-23723001 CAACCAACACTTAAGGAAAATGG + Intergenic
1202541942 Y:25947075-25947097 CAACCAACACTTAAGGAAAATGG - Intergenic