ID: 965906618

View in Genome Browser
Species Human (GRCh38)
Location 3:173715470-173715492
Sequence TATTAAGAGCTTTAATGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965906615_965906618 26 Left 965906615 3:173715421-173715443 CCTTGTTCCATAAGTGATGGGTG 0: 1
1: 0
2: 2
3: 5
4: 98
Right 965906618 3:173715470-173715492 TATTAAGAGCTTTAATGTTTAGG 0: 1
1: 0
2: 1
3: 34
4: 344
965906616_965906618 19 Left 965906616 3:173715428-173715450 CCATAAGTGATGGGTGATTTTCT 0: 1
1: 0
2: 2
3: 19
4: 252
Right 965906618 3:173715470-173715492 TATTAAGAGCTTTAATGTTTAGG 0: 1
1: 0
2: 1
3: 34
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965906618 Original CRISPR TATTAAGAGCTTTAATGTTT AGG Intronic
901903334 1:12386409-12386431 TTCTAAGAACTTTAATGTTTTGG + Intronic
904227373 1:29034230-29034252 TATTGAGAGCTTTCCTGTGTTGG + Intronic
905077359 1:35284397-35284419 TTCTAAGAGTTTTAGTGTTTAGG + Intronic
905204738 1:36336913-36336935 TATTAAAAGCTGGAATGTTAGGG + Intergenic
906904245 1:49871483-49871505 TATCAAGTGTTTTAAAGTTTTGG + Intronic
907708690 1:56855731-56855753 ATTTAAAATCTTTAATGTTTGGG - Intronic
908843597 1:68302482-68302504 TATTAAGGGCTTTAAAGTAGGGG + Intergenic
908987072 1:70037344-70037366 TATTATGAGCATCAATGATTAGG - Intronic
910060127 1:83080835-83080857 TATTAAGAGGTCTAACCTTTGGG - Intergenic
910918645 1:92319280-92319302 TATTATGAGCTTTACTGTCTGGG + Intronic
911319242 1:96392682-96392704 TATCAAGGGCATTAATGCTTAGG - Intergenic
912657302 1:111498519-111498541 TAATATGAGCTTGAAAGTTTGGG + Intronic
913201802 1:116500818-116500840 TATCAAGAGCTTGAATGTACGGG - Intergenic
914688845 1:150007495-150007517 TATTATGAGCTTTAACATTTAGG - Intronic
916268799 1:162918753-162918775 TATTTCTAGCTTTGATGTTTGGG + Intergenic
917472691 1:175339316-175339338 TTTTGAGATCTTTAATCTTTGGG - Intronic
918152141 1:181806719-181806741 GATGAAAAACTTTAATGTTTTGG + Intronic
919323223 1:196070164-196070186 TTTTAATAGCTTTTATTTTTTGG + Intergenic
920329852 1:205198954-205198976 GATTAAGAGCTTTAGTGCCTGGG - Intronic
920958039 1:210637299-210637321 TTTTAAGAGTTTTATAGTTTTGG - Intronic
921474446 1:215589545-215589567 TATTAAGATCTATAAAGTTGAGG + Intronic
921495232 1:215831170-215831192 TATTAAGTGCATACATGTTTAGG - Intronic
922295512 1:224246490-224246512 TATTCAGAGCTTTATAGATTTGG - Intronic
923452289 1:234129928-234129950 TAGTATTAGCTTTTATGTTTAGG - Intronic
923608333 1:235466048-235466070 TATTACGACCTTTGATTTTTTGG + Intronic
923760817 1:236842403-236842425 TATTGAGATATTGAATGTTTTGG + Intronic
923833685 1:237585789-237585811 TATTTATTGCTTTACTGTTTTGG - Intronic
924765025 1:247024406-247024428 TTTTTAGAGGTTTATTGTTTGGG - Intergenic
924912013 1:248523291-248523313 TATTAAGAGTTGTGATGCTTTGG + Intergenic
1063413598 10:5855498-5855520 TATTGAGAGCTTCATTCTTTCGG + Intergenic
1064046115 10:12017272-12017294 TGTTAAGAGAATTAAAGTTTTGG - Intronic
1064531973 10:16319679-16319701 TATTAAGATCTTTAAGATTTGGG - Intergenic
1067860537 10:49842686-49842708 TATAAAGAGATTAAATATTTGGG - Intronic
1068850403 10:61732444-61732466 TATTGATAGATTTAATGTTCTGG - Intronic
1069275568 10:66587118-66587140 TATAAATAGCTTTAGTGTTTTGG + Intronic
1069585379 10:69597265-69597287 TGTTAAGAGCTTTTATATTCAGG + Intergenic
1069845641 10:71369002-71369024 TATTAGGAGGTTGGATGTTTGGG + Intergenic
1072326345 10:94302420-94302442 TAATAATAGCTTTAGAGTTTTGG + Intronic
1073623110 10:105069399-105069421 TATTGAAAGCTCTAATATTTGGG + Intronic
1073776441 10:106790856-106790878 TATTATTTGCTTTAAAGTTTAGG + Intronic
1076366420 10:129923675-129923697 TTTTAAGAGTTTTATGGTTTTGG - Intronic
1077775484 11:5267155-5267177 TATTAACAGATTTACTTTTTAGG - Intronic
1078060940 11:8043043-8043065 TTCTAAGAGCTTTATAGTTTTGG + Intronic
1078292666 11:10028700-10028722 TACAAAGAACTTAAATGTTTTGG - Intronic
1079686827 11:23369615-23369637 TATTGAGAGCTTTATTGTCTTGG - Intergenic
1081345062 11:41975297-41975319 TATTAACATCTTCAATATTTCGG - Intergenic
1081582460 11:44361518-44361540 TTTTAAGAGCTTGTTTGTTTTGG - Intergenic
1082224408 11:49686561-49686583 TATTAAGAGTTGTTATATTTAGG - Intergenic
1082723354 11:56705956-56705978 TATAAATAACTTTAGTGTTTTGG - Intergenic
1082733813 11:56833006-56833028 TATTAAGTGCATAAATGCTTAGG - Intergenic
1083807833 11:65085421-65085443 AACTAGGAGCTTTAATTTTTAGG - Intronic
1084992745 11:72943522-72943544 TATTAATAGCTTTAATGAAAGGG + Intronic
1085885020 11:80511694-80511716 TGTAAAAAGCTTTAATATTTGGG + Intergenic
1086137826 11:83460412-83460434 TATTAAGGGCTTTGAGGGTTGGG - Intronic
1086549720 11:88041983-88042005 TTTTGGGAGCTTTAATTTTTGGG - Intergenic
1086624637 11:88932648-88932670 TATTAAGAGTTGTCATATTTAGG + Intronic
1087369793 11:97269227-97269249 TATTAACACCTTCAATGTTTTGG + Intergenic
1090651676 11:128812158-128812180 CATTTAGATCTTTAATGCTTTGG + Exonic
1090857913 11:130626661-130626683 AATTATGAGTTTTAATGGTTTGG - Intergenic
1092479372 12:8846347-8846369 TATTTATATCTTTAGTGTTTGGG + Intronic
1092796676 12:12117399-12117421 TATTAAGAGCTGACATATTTCGG + Exonic
1093017812 12:14172046-14172068 TATTATCAGCATTAATGTCTGGG + Intergenic
1094101874 12:26773263-26773285 AATTAAGAATTTTAATATTTAGG + Intronic
1097737127 12:63194700-63194722 TCATAAGGGCATTAATGTTTTGG + Intergenic
1099384131 12:81993749-81993771 TATAAAGAAGTTTGATGTTTTGG + Intergenic
1099495110 12:83337488-83337510 TTTTAAGAGTTTTATAGTTTTGG + Intergenic
1100927780 12:99569476-99569498 TATTAAGTGCTTTTATGTGCCGG - Intronic
1102786297 12:115607788-115607810 TGTTAGGAGTTTTGATGTTTAGG + Intergenic
1103767186 12:123288731-123288753 TGTAAATAGCATTAATGTTTAGG - Intergenic
1104701881 12:130911231-130911253 TATTCAGGTCTTTTATGTTTGGG - Intergenic
1104717856 12:131028476-131028498 TATTCAGTGCTTTTATGTCTTGG + Intronic
1105488936 13:20868329-20868351 TATTAACAGCCTTCATGTTATGG + Intronic
1106307526 13:28526753-28526775 TATTAAGAACTTTATTGGCTGGG + Intergenic
1106427996 13:29651616-29651638 TATTAACAGCTGTAACCTTTGGG - Intergenic
1106917863 13:34534644-34534666 TATTAGGCGCTTTAATGTGTGGG - Intergenic
1107980717 13:45731913-45731935 TTTAAAGAGCTTGAATTTTTAGG + Intergenic
1108967130 13:56322475-56322497 TATTTAGAATTTTAATGCTTAGG + Intergenic
1109401051 13:61829244-61829266 TATTAAGAGCTTAAGCCTTTGGG + Intergenic
1110189118 13:72710085-72710107 TTTTAACAGCTCTAATGCTTTGG - Exonic
1110259980 13:73474127-73474149 TATTAAATGCTTTAATGTGTCGG - Intergenic
1110692671 13:78449961-78449983 TAGTAAGAGGCTTATTGTTTTGG - Intergenic
1110848325 13:80215411-80215433 TCTTAAGTGCTTTAAACTTTGGG + Intergenic
1111488433 13:88936458-88936480 TAATAAGACCTTTAGTTTTTTGG - Intergenic
1113009310 13:105745591-105745613 TATTAAGAAATTTGATGATTTGG - Intergenic
1113482349 13:110630631-110630653 TGTTAAGAGCCTTATTGTTTTGG + Intronic
1113968541 13:114169767-114169789 TATTAAAAGCTTTAAGGACTCGG + Intergenic
1114365880 14:22026679-22026701 TATGAATAGCTTTAGTGTGTTGG - Intergenic
1114589109 14:23843345-23843367 TAATAAAAGCTTTTAAGTTTGGG + Intergenic
1115187837 14:30711769-30711791 TTTTAAGAGTTTTTATATTTTGG + Intronic
1115579058 14:34740575-34740597 CCTTAAGAGCTTTGATGATTAGG + Intergenic
1116717723 14:48448925-48448947 TTTTAAGGGCTTTAGTATTTTGG - Intergenic
1117305191 14:54467222-54467244 TATTAAGAGGTGTACTCTTTGGG + Intergenic
1117603643 14:57401813-57401835 TATGAAGATTTTTATTGTTTTGG + Intronic
1117832877 14:59770552-59770574 CATTAAGAACCTTAATGTTATGG + Intronic
1117882325 14:60324106-60324128 TTTAAAGAGCTTTATTGTTGGGG + Intergenic
1118028501 14:61796045-61796067 TATTAAGGGATTTAAAGTTTGGG + Exonic
1120185578 14:81390434-81390456 TATAAGGAGCTGTAAGGTTTAGG + Intronic
1120593255 14:86401550-86401572 TATTTAGAGCTTTATTATTAGGG + Intergenic
1121162569 14:91758518-91758540 TATTAATAGCTTTTATTTTTTGG + Intronic
1123206410 14:106717879-106717901 TATTAAGAGCTTTAGTGTGGTGG - Intergenic
1123211494 14:106765288-106765310 TATTAAGAGCTTTAGTGTGGTGG - Intergenic
1123737609 15:23200428-23200450 TGTTAAGGTCTTTAATGTTCTGG + Intergenic
1124183885 15:27503856-27503878 TATTAGGTGCATGAATGTTTAGG + Intronic
1124288820 15:28429090-28429112 TGTTAAGGTCTTTAATGTTCTGG + Intergenic
1124294404 15:28488223-28488245 TGTTAAGGTCTTTAATGTTCTGG - Intergenic
1125244816 15:37622856-37622878 TATTAAAAGTTTAAAGGTTTGGG + Intergenic
1128034545 15:64512689-64512711 CAAAAAGAGCATTAATGTTTTGG + Intronic
1129571213 15:76686716-76686738 TATGAAGAGCTTTAGTTTGTTGG - Intronic
1130511118 15:84590071-84590093 TATTAAGAGGTGGAGTGTTTAGG + Intergenic
1130870462 15:87967362-87967384 TATGAAATGCTTTAATGTCTAGG - Intronic
1133420842 16:5645432-5645454 TTTTAAGAGTGATAATGTTTGGG + Intergenic
1133794010 16:9031838-9031860 TTTTAAGAGCTTTATGTTTTTGG + Intergenic
1134380214 16:13717387-13717409 TTTTAAGATCTTGAAAGTTTGGG + Intergenic
1135238058 16:20776994-20777016 TATTCATAGCTTTTATGTTTTGG + Intronic
1136506124 16:30704528-30704550 TATTAAGAGGTTTAAGTTATAGG + Intronic
1137852632 16:51761953-51761975 TATTAAGAGCTAAAATGGTTTGG - Intergenic
1138132513 16:54492985-54493007 TATAAACAGCTTAAAAGTTTAGG + Intergenic
1138197676 16:55063766-55063788 TGTTAAGTGCATAAATGTTTAGG - Intergenic
1139455756 16:67074679-67074701 TTTAAAAAGCTTTACTGTTTCGG - Intronic
1140077273 16:71712155-71712177 CATTAAGTGCTTTCATGTGTTGG - Intronic
1140644552 16:77015086-77015108 TATTAAGAGGTGGAGTGTTTAGG + Intergenic
1144038251 17:11386464-11386486 TCTTTAGAGTTTTAATGTTAAGG + Intronic
1148284014 17:46372490-46372512 TCTCAAGGGCTTTAATGCTTCGG - Intergenic
1148306235 17:46590411-46590433 TCTCAAGGGCTTTAATGCTTCGG - Intergenic
1152326499 17:79643235-79643257 TATTAAAAGATTTAATTTTTAGG + Intergenic
1152850542 17:82631823-82631845 TACTAAAAGCTTTAATGCTTGGG + Intronic
1153091112 18:1344386-1344408 TTTTAACAGATATAATGTTTAGG + Intergenic
1153400681 18:4681076-4681098 TATTAAGTGCATATATGTTTAGG - Intergenic
1155406213 18:25490712-25490734 TATTAAGAGCTGTGAAGTTCAGG - Intergenic
1155975802 18:32129036-32129058 TATCAAGATGTCTAATGTTTTGG + Intronic
1157509318 18:48258546-48258568 TATTTAGATCTTTAATTTTCTGG - Intronic
1158075168 18:53519704-53519726 TATGAAAAGCGTTCATGTTTAGG + Intronic
1159350467 18:67265957-67265979 TATTCATATTTTTAATGTTTTGG + Intergenic
1159848518 18:73496341-73496363 TATTAATATCTTTAAAGGTTTGG - Intergenic
1159850276 18:73518904-73518926 TATTAAGCACTTTATTATTTAGG - Intergenic
1162915349 19:13871682-13871704 TGTGAACAGCTTTAATGTTGGGG - Intronic
1163573352 19:18096525-18096547 TCTTAAGAGTTTTAGTGTTTTGG + Intronic
1164855192 19:31515592-31515614 TGTTAAGAGTTTTAGAGTTTTGG + Intergenic
925245265 2:2377082-2377104 TATTAAGAGACTTTATGTTTAGG + Intergenic
925925987 2:8671016-8671038 TATTTAAAACTTTCATGTTTTGG + Intergenic
928824877 2:35407884-35407906 TATTGTGAACTTTAATATTTGGG + Intergenic
929039930 2:37734491-37734513 TTTTAAGATCTTTCCTGTTTTGG + Intronic
929632516 2:43479087-43479109 AGTTAAGAGCTCTAGTGTTTTGG - Intronic
931612430 2:64116586-64116608 TATTAAGTGATTTAATCTCTGGG + Intronic
933321610 2:80782004-80782026 TAGAAAGAGCTTTAATTGTTTGG + Intergenic
934858617 2:97744879-97744901 TCTTAAGAGTTTTACAGTTTGGG - Intergenic
935126230 2:100225442-100225464 TATTAAGAGTTTTATTGACTCGG + Intergenic
935414883 2:102804707-102804729 TATTAAGAGCTCTGGTGTGTGGG + Intronic
935463986 2:103373282-103373304 TATTAAGAGGTGGAATCTTTTGG - Intergenic
936603560 2:113924508-113924530 TAAGAACAGCTTTAATTTTTAGG - Intronic
937591139 2:123614633-123614655 AATTCAGAGCTTGAATTTTTTGG + Intergenic
938965099 2:136381346-136381368 TATTTACAGCCTTCATGTTTGGG + Intergenic
939036318 2:137135521-137135543 TGTTAAGAATTTTAATGTGTAGG - Intronic
940422026 2:153490248-153490270 TTTTAAAAACTTTAATGTTTTGG + Intergenic
940957705 2:159746942-159746964 TATCAATAGCTTTTAGGTTTTGG + Intronic
941140744 2:161777836-161777858 TTCTAAGAGCTTTATAGTTTTGG + Intronic
941450652 2:165656157-165656179 AATTAGGAGCTTTTAGGTTTAGG + Intronic
941533381 2:166695434-166695456 TATTAATAATTTTAATATTTGGG + Intergenic
943927497 2:193803793-193803815 TCTTAAGAACTTTAAAATTTTGG + Intergenic
944330474 2:198459856-198459878 TATTAGGTGCATAAATGTTTAGG + Intronic
944403624 2:199357133-199357155 TATTAATAGCTTTAGGATTTGGG + Intronic
944560824 2:200935761-200935783 TATTCTGAGCTTGAATCTTTTGG + Exonic
944596960 2:201269616-201269638 TCTTAAAATCTTTAATGTATTGG + Intronic
945646858 2:212507061-212507083 TATTAAGGGCTTTAGGATTTTGG - Intronic
946197312 2:218042295-218042317 TCTTAAGATCTTTAATTTTGGGG + Intronic
946461105 2:219869662-219869684 TTTTAAGAGGTTTCTTGTTTAGG - Intergenic
946640716 2:221780736-221780758 AATAAAGAGATTTAATATTTTGG - Intergenic
946677536 2:222177795-222177817 TATCTAGAGAATTAATGTTTCGG + Intergenic
947364100 2:229376211-229376233 TATTAAGAGATGTAGTCTTTGGG + Intronic
1170650752 20:18238793-18238815 TAGCTAGAGCTTTAAAGTTTTGG + Intergenic
1170946768 20:20898305-20898327 TGTTATAAGCTTGAATGTTTTGG - Intergenic
1171950886 20:31420653-31420675 TATTAAGAGGTATGATCTTTAGG - Intergenic
1176004267 20:62851474-62851496 TAAAAAATGCTTTAATGTTTTGG - Intronic
1176173404 20:63706636-63706658 TATTGAGACCCTTACTGTTTAGG + Exonic
1177580224 21:23012581-23012603 TATTAAGAGATTTAAAGGTTGGG + Intergenic
1181277922 22:21698379-21698401 TATTTAGAGCTTTTCTGTTTTGG - Exonic
1181331971 22:22099734-22099756 TTTTATTAGCGTTAATGTTTGGG + Intergenic
1182140960 22:27957862-27957884 TTTTAAGAGTTTTATAGTTTTGG - Intergenic
1182781812 22:32874329-32874351 TAATATGAGCTATAATATTTGGG + Intronic
1203292210 22_KI270736v1_random:6038-6060 TTTTAAGATCTTTCCTGTTTTGG + Intergenic
949591478 3:5498756-5498778 TAGTACGAGCTTTGATGTTCAGG + Intergenic
950972232 3:17200927-17200949 TATTAAGAGGATTAATAATTAGG + Intronic
951041590 3:17994074-17994096 GATTAAGAGCTTAAATCATTAGG - Intronic
951287366 3:20830461-20830483 TAATAAGAGGTTTAATTTTTTGG - Intergenic
952037762 3:29223238-29223260 TATTATGAGGTTTCCTGTTTGGG - Intergenic
952105277 3:30062904-30062926 CATTAATAGTTTTAATGTTCTGG - Intergenic
952196722 3:31083439-31083461 GATGAAGAGCTTTAGAGTTTTGG - Intergenic
954098349 3:48349432-48349454 TATTTATAGCTGTAAAGTTTTGG - Intergenic
955369773 3:58340921-58340943 TCATAAGAGCTTAAGTGTTTGGG + Intronic
956060777 3:65346032-65346054 TATTAAGGGTTTTTCTGTTTTGG + Intergenic
956938070 3:74126524-74126546 TATTAAGAGATTTAACGTAAAGG - Intergenic
958986816 3:100789941-100789963 TAAAAAGAGATTGAATGTTTAGG + Intronic
960361266 3:116714677-116714699 TTTTAAAAGATTTAATTTTTAGG + Intronic
961000719 3:123372195-123372217 GATTACGAGCATCAATGTTTAGG - Intronic
961672557 3:128545115-128545137 TATTAGGTGCATTAATATTTAGG - Intergenic
962079802 3:132126008-132126030 GATTAAAAGCTTAAATATTTTGG - Intronic
963425947 3:145123756-145123778 TATAAAGAGCTTCAATGAATGGG + Intergenic
964913263 3:161808299-161808321 TCTTAAGAGTTTTTATATTTGGG - Intergenic
965552770 3:169986186-169986208 TTCTAAGACCTTTAATGTTAAGG - Intronic
965606028 3:170498417-170498439 TAATAATAGATTCAATGTTTTGG - Intronic
965906618 3:173715470-173715492 TATTAAGAGCTTTAATGTTTAGG + Intronic
966796350 3:183717876-183717898 TTTAAATAGCTTTCATGTTTTGG + Intronic
966953000 3:184841064-184841086 AAATAAGAGTTTTATTGTTTGGG + Intronic
967044925 3:185727638-185727660 TATTAAGAAATTGAATTTTTAGG - Intronic
967482651 3:189991740-189991762 TAATAAGAACTTTCATGATTGGG - Intronic
967491177 3:190092615-190092637 TATTAAGAGGATTATTCTTTCGG + Intronic
967809969 3:193750320-193750342 TATTAGGTGCATAAATGTTTAGG + Intergenic
968498906 4:935484-935506 TATTAGGTGCATAAATGTTTAGG - Intronic
970263806 4:14258697-14258719 GATTAAAAGCTCTTATGTTTAGG - Intergenic
972209882 4:36823957-36823979 TATAAATAGCCTTAGTGTTTTGG - Intergenic
972352386 4:38248032-38248054 TAGTAAGAGGTTTTATATTTGGG + Intergenic
972980428 4:44693348-44693370 TTTTAAGATTTTTAATATTTTGG + Intronic
974123665 4:57669083-57669105 CATTAAGAGATTTAATATATAGG + Intergenic
974658185 4:64852516-64852538 TAGTAAGATCTCTAATATTTGGG + Intergenic
976100475 4:81557325-81557347 TATTAAGTGCTTTAAAATGTTGG - Intronic
976357831 4:84140598-84140620 TTTTAAGTACTTTATTGTTTAGG - Intergenic
976957738 4:90923194-90923216 TATTTAGAGCTTTAATTTTTAGG - Intronic
976994020 4:91407232-91407254 CTTTGAGAGCTTTAATGATTTGG - Intronic
978871812 4:113587741-113587763 TATTTAGACCTTTAAAATTTAGG - Intronic
978951592 4:114566816-114566838 TATTAAGAGAAGTAATGTGTAGG + Intergenic
979521312 4:121670386-121670408 TATTATTTGCTTTAATGTCTTGG - Intronic
980672125 4:136023669-136023691 TATTATGTCCTTTCATGTTTTGG - Intergenic
980886883 4:138772461-138772483 TAGTAATAGCTTCAATGTTCAGG + Intergenic
981134351 4:141192969-141192991 TATGAAGAGATTGAATTTTTTGG - Intronic
981881588 4:149619565-149619587 TATTAATAACTTAAAAGTTTTGG + Intergenic
982507754 4:156241266-156241288 TTTTCCGAGCTTGAATGTTTGGG + Intergenic
984576023 4:181449202-181449224 AATTAAGAGCATGAATGATTTGG + Intergenic
988010956 5:25485033-25485055 TATTAAGCATTTTAATGTGTAGG - Intergenic
988903352 5:35758274-35758296 TATCAGGAGCTTCAATATTTAGG + Intronic
989063056 5:37429227-37429249 TATTTTGAGCTTAAATATTTTGG + Intronic
989120521 5:37999949-37999971 TATTAAAATTTTAAATGTTTAGG + Intergenic
989203634 5:38790328-38790350 CATAAAGAGTTTTAATGTTTGGG + Intergenic
989341465 5:40380103-40380125 TATTAAGAGGTAGAATCTTTGGG - Intergenic
989362138 5:40614036-40614058 TGTTAAGAGCTCTAATCTTGTGG - Intergenic
989958492 5:50382648-50382670 TACTAAGAGTTTTACAGTTTGGG - Intergenic
989965570 5:50462566-50462588 TACTAACCCCTTTAATGTTTTGG - Intergenic
992000137 5:72428310-72428332 TAATAAGAGCTAATATGTTTTGG + Intergenic
992607684 5:78476280-78476302 TATTAAAAGAATTAGTGTTTTGG + Exonic
993171961 5:84430839-84430861 TATAAATAGCCTTAATGTGTTGG + Intergenic
993174538 5:84466637-84466659 TCTTAAGTGCTTTAATTTTAAGG - Intergenic
994110450 5:95997268-95997290 TATCTAGAACTTTAATGCTTGGG + Intergenic
994496322 5:100517723-100517745 TATAAATAGCTTTCATGTGTTGG - Intergenic
994867511 5:105295335-105295357 TATCAATAGGTTTAATATTTTGG - Intergenic
994965260 5:106661901-106661923 TTTTCAGAGCTTTCATATTTTGG + Intergenic
995401869 5:111751334-111751356 TATTAACAGCCCTAATGGTTTGG - Intronic
997557297 5:134811642-134811664 TAGTAAAAACTTTAATGTTTAGG - Intronic
998258432 5:140608609-140608631 TTCTAAGAGCTTTATGGTTTTGG + Intergenic
998602344 5:143597902-143597924 TATAAAGAGTTATAATATTTGGG + Intergenic
998846896 5:146319189-146319211 TATTGAGGGCCTAAATGTTTTGG + Intronic
999223760 5:150002719-150002741 TACTAACAGCTTTTATGTCTAGG - Intronic
999352699 5:150891117-150891139 TATTAAGTGCATAAGTGTTTAGG + Intronic
1000163416 5:158623618-158623640 TATCAAGAACTTTAACTTTTAGG + Intergenic
1000851876 5:166350378-166350400 TATGCTGAGCTTTAATGTTTAGG - Intergenic
1002874022 6:1194840-1194862 TATTAGGGGCATTTATGTTTAGG - Intergenic
1002977739 6:2100416-2100438 TATTAATTGTTGTAATGTTTAGG - Intronic
1003702722 6:8487571-8487593 TATTAAAAGTATTAATGTTGAGG + Intergenic
1003787189 6:9499653-9499675 TATTTAAAGCTGTCATGTTTAGG - Intergenic
1004746921 6:18519392-18519414 TTTTAATAACTTTAATGTATAGG - Intergenic
1004892414 6:20114087-20114109 TATTAATAGCAATAATGTTGAGG + Intronic
1004949786 6:20655847-20655869 TATTAAGAGATGACATGTTTTGG + Intronic
1005041527 6:21604636-21604658 TACTAACAGTTTTAATTTTTTGG + Intergenic
1005096728 6:22124514-22124536 TTTTAAATGCTTTAATATTTGGG + Intergenic
1005109512 6:22265117-22265139 TTTTTAAAGCTTTAATGTTTGGG + Intergenic
1005333888 6:24774583-24774605 TATTAGGGGCTTTTATATTTTGG - Intergenic
1006649682 6:35541036-35541058 TATTTAGATCTGTAATTTTTTGG + Intergenic
1008296122 6:49780002-49780024 TTTTATGAGCCTTAATTTTTTGG + Intergenic
1008497400 6:52146780-52146802 TATTGAGTGCTTTGATGTCTGGG + Intergenic
1009164818 6:60327964-60327986 TATTAAGAGATTTATTTTCTTGG - Intergenic
1009542393 6:64978257-64978279 TATTAAGGGCCTTAGTATTTGGG - Intronic
1010089389 6:71962230-71962252 TAATAAGAGATTTTAAGTTTTGG - Intronic
1010642651 6:78348294-78348316 TATTAAGACCTATACTTTTTTGG - Intergenic
1010956305 6:82094416-82094438 TATTAGGAGCTGTGATGTTGAGG + Intergenic
1011601810 6:89066581-89066603 TATTTTGAGCTATTATGTTTTGG - Intergenic
1012191709 6:96287767-96287789 TATAAATAGCCTTAATGTGTTGG - Intergenic
1012325310 6:97909011-97909033 TATTCAGAGCTCTAGTGTATGGG + Intergenic
1012626347 6:101408064-101408086 TTTTCAGAGCTTTAATATTTAGG + Intronic
1012674292 6:102095572-102095594 TATTAAGAGCTGCAGTGGTTTGG + Intergenic
1012755699 6:103227732-103227754 TCTTAAGAGCTTTGCTGTTTAGG - Intergenic
1014205797 6:118653799-118653821 AATTAGGATATTTAATGTTTTGG + Intronic
1014853331 6:126368460-126368482 AATTAAAAACTTTAATGTATTGG + Intergenic
1014861570 6:126474274-126474296 AAACAAGAGCTTTACTGTTTGGG - Intergenic
1015096970 6:129427525-129427547 TCTTAGGAACTTCAATGTTTAGG - Intronic
1015335846 6:132037060-132037082 TGTGAATAGCTTTAATATTTAGG + Intergenic
1015839611 6:137462703-137462725 TTTTAAGAGCATAAATATTTGGG - Intergenic
1016161798 6:140891680-140891702 TATTTAGAAATTAAATGTTTGGG - Intergenic
1016766662 6:147801931-147801953 TAGTTATAGCTTTTATGTTTAGG - Intergenic
1016913273 6:149220514-149220536 TATTAATAGATGTAATCTTTGGG - Intronic
1017569086 6:155723374-155723396 TATTTAAAGCTTTAATGATAAGG - Intergenic
1017864204 6:158428685-158428707 AACTTAGAGCTTTACTGTTTTGG + Intronic
1020404891 7:7821547-7821569 TATTAAAAGCTTATATGATTTGG + Intronic
1020692306 7:11371064-11371086 TATGAAGAGCTTTAGTTTGTGGG - Exonic
1020711735 7:11614528-11614550 AATCAAGAGCATTAAAGTTTGGG + Intronic
1020760825 7:12266682-12266704 TATTAAGAACTTCATTGGTTTGG - Intergenic
1020873414 7:13663378-13663400 TATTAAGTGCATATATGTTTAGG - Intergenic
1021271155 7:18588062-18588084 TATTAAAATCTTTGGTGTTTTGG - Intronic
1021428201 7:20528141-20528163 TAGTAATAGCTTTCATATTTTGG - Intergenic
1021547049 7:21825698-21825720 TAAAAAGTGCTTTGATGTTTGGG + Intronic
1022061284 7:26798115-26798137 TATTAAATGCTTTAACCTTTGGG - Intronic
1022159633 7:27696594-27696616 TATTATGAACATTAATATTTTGG + Intergenic
1022224835 7:28352473-28352495 TAATAAGAGGTTTAAAGATTGGG + Intronic
1022320495 7:29283582-29283604 TATAAAGAGCTTGCATATTTAGG - Intronic
1023242230 7:38160826-38160848 TAGTAACATCTTTAATGTTATGG + Intergenic
1023413493 7:39910470-39910492 TATAAATAGCCTTAATGTGTTGG - Intergenic
1024733280 7:52275443-52275465 TATTAAAAGATTTAAACTTTTGG - Intergenic
1027690083 7:81333873-81333895 AATTAACAGATTTTATGTTTAGG + Intergenic
1028005430 7:85560234-85560256 TTTTAAGAGCTTACATGATTTGG - Intergenic
1028038502 7:86017737-86017759 TTTTTAGAGCTTTACTGTATGGG + Intergenic
1028129933 7:87159251-87159273 TTTTAACAGCCCTAATGTTTTGG - Intronic
1028491055 7:91412635-91412657 CATTCAGAATTTTAATGTTTTGG + Intergenic
1028491108 7:91413383-91413405 CATTCAGAATTTTAATGTTTTGG + Intergenic
1028843225 7:95451308-95451330 TATTAAAATCTTTAATTTATAGG - Intergenic
1030665741 7:112276276-112276298 TGTTAATAGCTTTAATATTTTGG + Intronic
1031672165 7:124563156-124563178 TCTTAAGGGCTTTAATATTGTGG - Intergenic
1031788724 7:126071036-126071058 TATTAAATACTTTTATGTTTTGG - Intergenic
1032608007 7:133378615-133378637 CATGAAGAGGTATAATGTTTAGG + Intronic
1032924911 7:136592647-136592669 AATTAAGAGCTTTAAATTTCTGG + Intergenic
1034981576 7:155481758-155481780 TATAAAGTTCTTTCATGTTTTGG + Intronic
1035843382 8:2836480-2836502 TATTAAGAAATCTAAGGTTTGGG - Intergenic
1036102561 8:5802780-5802802 TAGTAACATCTTTAATGTTGTGG - Intergenic
1037356325 8:18023589-18023611 TATTAAGATCTTTTAAATTTGGG - Intronic
1037549942 8:19960799-19960821 TATAAATAGCTTTATTATTTAGG - Intronic
1038314731 8:26474472-26474494 AATTAATAGATTTTATGTTTTGG + Intronic
1038473923 8:27848689-27848711 TCTTAAGTGCTTTCAAGTTTTGG + Intergenic
1040633360 8:49241672-49241694 TATGAAAAGCTTTTATGTTTAGG + Intergenic
1041746000 8:61210167-61210189 TATTAAGAGGTGGAATCTTTTGG + Intronic
1041967128 8:63691464-63691486 TATAAAGAACTTAAATGTTCTGG + Intergenic
1042088819 8:65135915-65135937 TATTAAGTGCGTGTATGTTTAGG - Intergenic
1042154127 8:65822903-65822925 TAATAAGTGCTTTAAAATTTTGG - Intronic
1042330829 8:67579016-67579038 TATTAAAGGTTTTATTGTTTGGG - Intronic
1042855000 8:73257748-73257770 GATTAAGAGGTTAAAGGTTTGGG + Intronic
1042898215 8:73694154-73694176 TATTAGGTGCCTAAATGTTTAGG - Intronic
1044539090 8:93390203-93390225 TATTAAAAGCTCAAAGGTTTTGG - Intergenic
1045160473 8:99536746-99536768 TATTCAGAACTTTAATGACTGGG - Intronic
1045682481 8:104677599-104677621 TTTTTAGAGTTTTAAGGTTTGGG - Intronic
1046084309 8:109412913-109412935 TATTAAGAACTTTGAATTTTAGG - Intronic
1046829116 8:118724381-118724403 AATTATGAGTTTAAATGTTTTGG + Intergenic
1050983203 9:12047190-12047212 TATTAATAGCTTTATTCTTGAGG + Intergenic
1051707997 9:19900733-19900755 TATCATGATCTTTATTGTTTAGG + Intergenic
1053325684 9:37147592-37147614 TATTCAGAGCTTTAACATTTTGG + Intronic
1053343389 9:37359388-37359410 TATACAGATCTTTACTGTTTTGG - Intergenic
1053565440 9:39245286-39245308 TATTAAGTGTTTGCATGTTTAGG - Intronic
1053831208 9:42083142-42083164 TATTAAGTGTTTGCATGTTTAGG - Intronic
1054131710 9:61373753-61373775 TATTAAGTGTTTGCATGTTTAGG + Intergenic
1054599339 9:67104296-67104318 TATTAAGTGTTTGCATGTTTAGG + Intergenic
1054974502 9:71126495-71126517 TATAAAGAGATCTAATATTTTGG - Intronic
1054989684 9:71309213-71309235 TTTTAATAGCTGTAACGTTTAGG + Intronic
1055402574 9:75940173-75940195 TTTTAAGAGATTTAACGTGTTGG + Intronic
1055789096 9:79902261-79902283 TATTATGAGTTTTATTATTTAGG + Intergenic
1057024774 9:91726454-91726476 AATTAAGACATTTAATGTTGGGG + Intronic
1057299163 9:93866417-93866439 TTTTAAAAGCTTTATTTTTTGGG + Intergenic
1058003537 9:99891810-99891832 AATTATGTCCTTTAATGTTTAGG + Intergenic
1059979430 9:119753585-119753607 TGTTCACAGCTTTCATGTTTTGG + Intergenic
1061230126 9:129310967-129310989 TATTTAAAGCTTCTATGTTTGGG - Intergenic
1185964838 X:4588899-4588921 TTTGAAGAGCTTTAATTTTGAGG + Intergenic
1186113663 X:6282415-6282437 TAGAAGGAGGTTTAATGTTTTGG + Intergenic
1186289151 X:8077804-8077826 CTTTAAGAGCATTAATGTATTGG + Intergenic
1188585199 X:31765956-31765978 TATTATTACCTTTAATGTTAGGG - Intronic
1188649608 X:32615704-32615726 TTTTAACAGATTTAATTTTTTGG + Intronic
1190524846 X:51318498-51318520 TATTAAGATCAGAAATGTTTGGG - Intergenic
1190545382 X:51520411-51520433 TATTAAGATCAGAAATGTTTGGG + Intergenic
1191811747 X:65196654-65196676 CAGTAACAGCTTTAATGTTATGG + Intergenic
1192682620 X:73267633-73267655 TATAAATAGCTTTAGTGTATTGG - Intergenic
1193549357 X:82871614-82871636 TATTGATAGCTTTATTGTGTTGG + Intergenic
1193579974 X:83252316-83252338 TATAAATAGCTTTAGTGTATTGG - Intergenic
1193944442 X:87716576-87716598 TATTTAGAATTTTAATTTTTGGG + Intergenic
1193976519 X:88126713-88126735 AATTGAGAGCTTTATTGTTTAGG + Intergenic
1194090134 X:89575383-89575405 TATTGATAGCCTTAGTGTTTTGG + Intergenic
1194243153 X:91476587-91476609 TATTAAAACCTGTATTGTTTCGG - Intergenic
1194412147 X:93570383-93570405 TATTAAGAACTTGAAAGTTCAGG - Intergenic
1194794225 X:98190275-98190297 TATAACGATCTTTGATGTTTGGG + Intergenic
1195226235 X:102796930-102796952 CATTAACAGCATTAATGTTAAGG + Intergenic
1197316138 X:124968158-124968180 AATTAATAGATTTAATTTTTTGG - Intergenic
1197371192 X:125628071-125628093 TATAAATAGCGTTAATGTGTTGG - Intergenic
1197448095 X:126577572-126577594 AATTAAAAGCTTTACTGTATTGG - Intergenic
1197578602 X:128254753-128254775 TAATAAAAGCCTTAATCTTTAGG + Intergenic
1197614859 X:128679699-128679721 GATTAAGAGATCTTATGTTTGGG + Intergenic
1198228337 X:134667064-134667086 TTCTAAGAGCTTTATAGTTTGGG - Intronic
1198321793 X:135525087-135525109 TTTTAAAAGTGTTAATGTTTTGG + Intronic
1200442781 Y:3231436-3231458 TATTGATAGCCTTAGTGTTTTGG + Intergenic
1201889281 Y:18923966-18923988 TTTGAAGAGCTTTAATTTTGAGG + Intergenic