ID: 965906638

View in Genome Browser
Species Human (GRCh38)
Location 3:173715967-173715989
Sequence GAGTTGTATTTTAAATTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 573}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965906638 Original CRISPR GAGTTGTATTTTAAATTATT TGG Intronic
900859098 1:5212733-5212755 TATTTGTATTCTAAATTAGTAGG + Intergenic
903484567 1:23680040-23680062 GAGATGTACTGTGAATTATTGGG + Intergenic
904106026 1:28084884-28084906 AATGTGTATTTTAAAATATTAGG - Intronic
904640785 1:31926476-31926498 TAGTTGTATATTACATTATTAGG - Intronic
907592507 1:55689084-55689106 GAGTTTTACTTCCAATTATTTGG + Intergenic
908137365 1:61146957-61146979 AAGTTGTATATTACATTGTTAGG + Intronic
908335003 1:63113319-63113341 GAACTCTATTTTAAATTAGTAGG + Intergenic
908463818 1:64371896-64371918 GAGTAGTTTCTGAAATTATTTGG - Intergenic
909050445 1:70761336-70761358 GTTTTGAATTTTGAATTATTAGG + Intergenic
909111657 1:71486253-71486275 GAGATGTTTGTTAAATTCTTAGG + Intronic
909207242 1:72774680-72774702 ATTTAGTATTTTAAATTATTAGG + Intergenic
909492927 1:76245812-76245834 GAGTTTTATTTCAAATTATGTGG + Intronic
909497686 1:76297421-76297443 GCATTGTATTCTAACTTATTGGG + Intronic
909839026 1:80294736-80294758 AAGTTGTATTCTAAAATAATGGG + Intergenic
910127198 1:83855785-83855807 AATTTCTATTTTAAATTACTAGG + Intergenic
910134021 1:83944770-83944792 CAGTTGTCTTTTAATTCATTAGG - Intronic
910613834 1:89175238-89175260 GAGGTTTATATTAAATTATCTGG + Intronic
910726752 1:90348035-90348057 TTATTTTATTTTAAATTATTGGG - Intergenic
910876567 1:91884360-91884382 GAGTTCTATTTATAATTATTTGG + Intronic
911214803 1:95180897-95180919 AAATTGTATTTTATATTTTTAGG - Intronic
911625195 1:100115849-100115871 AGGTAGTATTTTAAATCATTGGG + Intronic
912055963 1:105598033-105598055 CAATTGTGTTTTAAATTATGAGG + Intergenic
912699670 1:111867758-111867780 GAGTAGAATTTTTGATTATTTGG + Intronic
913694079 1:121307400-121307422 GCATTGTTTTTTAAATTTTTTGG + Intronic
914143484 1:144972666-144972688 GCATTGTTTTTTAAATTTTTTGG - Intronic
914833421 1:151187985-151188007 AAGTTCTATTTTAAACTAGTTGG + Intronic
916615891 1:166439048-166439070 TAGCTGTATTTTGAATTTTTTGG + Intergenic
916870806 1:168912817-168912839 CATTTTTATTTTAAATTTTTTGG - Intergenic
916958769 1:169867830-169867852 GAGTTGTATTGTAAATTGAGAGG - Intronic
917188657 1:172390148-172390170 GACTTGGCTTATAAATTATTTGG + Intronic
918258630 1:182773476-182773498 GCGTTTTATTTAAAAATATTGGG - Intergenic
918598287 1:186319287-186319309 AAGTTGTATTTAAAATTTTGAGG - Intronic
918673288 1:187248380-187248402 TAGTTCTATTTTTAATTTTTTGG - Intergenic
918843914 1:189583821-189583843 GAGTTCTATTTTATATAAATGGG - Intergenic
918900274 1:190407741-190407763 AACTTTTATTTTAAGTTATTAGG - Intronic
918955494 1:191201452-191201474 GTGTTTTACTTTAAATTATGTGG - Intergenic
919427672 1:197452819-197452841 TAGTTCTATTTTTAATTTTTTGG - Intronic
919444949 1:197691555-197691577 TAGTTCTATTTTTAATTTTTTGG - Intronic
919532145 1:198736035-198736057 GAATTTTATTTTTAATTTTTTGG + Intronic
919532495 1:198741466-198741488 GATTTGTGTTTAAAATGATTTGG - Intronic
920104600 1:203543116-203543138 TGGTGGCATTTTAAATTATTGGG - Intergenic
920481402 1:206325780-206325802 GCATTGTTTTTTAAATTTTTTGG + Intronic
920981547 1:210841058-210841080 GAGTTGTTTTTTTAAGTATGAGG - Intronic
922074070 1:222225158-222225180 GAGTTGTTATTGAAAATATTAGG - Intergenic
922392004 1:225153829-225153851 CAGTTGAATTTTGAATTGTTAGG + Intronic
922888517 1:229040966-229040988 TAGTTATATTTTTAGTTATTTGG - Intergenic
923223810 1:231920838-231920860 AAGTTGTGTTTTATTTTATTGGG + Intronic
923275455 1:232391676-232391698 GAATTGTATTTTAAATGAAAAGG - Intergenic
923321037 1:232833513-232833535 TAGTTTTATTTTACATTAATGGG - Intergenic
923527415 1:234783266-234783288 GAGTTGTATTTTAGGTTTTATGG - Intergenic
923927413 1:238648422-238648444 AAGTTGGAGTGTAAATTATTTGG + Intergenic
924454371 1:244207058-244207080 GAGGTCTATTTTAAATAGTTTGG - Intergenic
1063775495 10:9259104-9259126 GTATTGTATTTTAAATTCTGGGG + Intergenic
1063811525 10:9714430-9714452 GAGTTGTATTTTGAATAGTGAGG + Intergenic
1065153853 10:22849869-22849891 GAGTAATATTATAAAATATTAGG + Intergenic
1065732485 10:28722223-28722245 GAGCTGTGTTTTGAATTAATGGG + Intergenic
1066479547 10:35782295-35782317 GATTTGGATTTTTAATTCTTTGG + Intergenic
1067362532 10:45595391-45595413 AAGTTGTATTTTAATTTTTATGG + Intergenic
1067491305 10:46706562-46706584 GAGTGGTATTTTGAAATACTAGG + Intergenic
1067603361 10:47633818-47633840 GAGTGGTATTTTGAAATACTAGG - Intergenic
1068027730 10:51669047-51669069 CAGTTTTATTTTAAAAAATTGGG - Intronic
1068333032 10:55597779-55597801 GAGTGGTATTTTGAAATACTAGG - Intronic
1070209663 10:74302905-74302927 CAGTTTTATTTTAAATTCTGTGG + Intronic
1070933314 10:80275638-80275660 GAGTTCTATGTTAAATGATTTGG + Intronic
1071019900 10:81040883-81040905 GAGTTGTATTCTTCAATATTTGG + Intergenic
1071042577 10:81331674-81331696 GTGTTTTAGTCTAAATTATTAGG - Intergenic
1071061525 10:81575709-81575731 GAATTGTATTTTCATTTATATGG + Intergenic
1071139968 10:82497786-82497808 TAGTTCTATTTTCAATTTTTAGG + Intronic
1071626797 10:87180038-87180060 CAGATATATTATAAATTATTGGG - Intronic
1071687656 10:87777587-87777609 GTTTTTTTTTTTAAATTATTAGG - Intronic
1072050167 10:91696146-91696168 TAGTTCTATTTTTAATTTTTTGG - Intergenic
1072127980 10:92464451-92464473 GAGTTGCATTCTGAATTAATTGG - Intronic
1073569829 10:104570601-104570623 CATTTGTCTTTTAAATTATGTGG + Intergenic
1074005107 10:109413862-109413884 TTGTTTTATTTTAAATTTTTTGG - Intergenic
1074647209 10:115471387-115471409 TAGTTTTATTTTTAATTTTTGGG + Intronic
1076639901 10:131908097-131908119 CTCTTGTATTTTAAAGTATTGGG + Intronic
1077796555 11:5498466-5498488 CATATGTATTATAAATTATTGGG + Intronic
1078078264 11:8181094-8181116 GTGTTGTATTTTAAATACATTGG - Intergenic
1078289461 11:9993860-9993882 GAGCTGTATTTTTATTTATAGGG - Intronic
1078372282 11:10758516-10758538 GAGTTATATTTTACTATATTTGG + Intronic
1078709589 11:13778037-13778059 GAGTTGTTTTTTTTATCATTGGG + Intergenic
1079182503 11:18205610-18205632 GAGTGGTTTTTAAAATTTTTTGG - Intronic
1080534818 11:33211383-33211405 TAGTTCTATTTTTAATTTTTTGG - Intergenic
1080611113 11:33904752-33904774 GATTTGTTTTTTCAATTATACGG + Intergenic
1081135953 11:39440697-39440719 AACTTGTATTTAAAATTAATTGG + Intergenic
1081227692 11:40544780-40544802 AATTTGTATTTTAGTTTATTTGG + Intronic
1081781661 11:45717176-45717198 GAGGTTTAGTTTATATTATTAGG + Intergenic
1085547744 11:77336052-77336074 CAGTTCTATTTCAAGTTATTTGG - Intronic
1085817183 11:79751631-79751653 GTATTGTATTTTATTTTATTTGG - Intergenic
1086212153 11:84333295-84333317 CAGTTGTATTTTTACTTGTTAGG - Intronic
1086836903 11:91636634-91636656 GATTTGAATTATAAGTTATTTGG + Intergenic
1087449581 11:98301625-98301647 GTTTTCTATTTTATATTATTTGG - Intergenic
1088188719 11:107203636-107203658 TAGTTGTTTTATATATTATTTGG + Intergenic
1088411615 11:109540348-109540370 GAATTGTTTTGTAGATTATTTGG - Intergenic
1088683656 11:112266981-112267003 GATTTTTTCTTTAAATTATTGGG - Intronic
1089628534 11:119768712-119768734 GAGTTGTATTTGATAGAATTTGG + Intergenic
1090364604 11:126195442-126195464 GATGTGTATTTTAACTTCTTGGG - Intergenic
1090396538 11:126423091-126423113 GAGTTGTATATTAAAATGTTAGG + Intronic
1090574721 11:128088491-128088513 GAGATGAATTTTGAATTATAAGG + Intergenic
1091978868 12:4849711-4849733 TATTTGTAATTTAAATCATTTGG - Intronic
1093844243 12:23949522-23949544 GAGTTGTACTTCAATATATTAGG + Intronic
1094211677 12:27899973-27899995 CAGTTCTATTTTTAATTCTTTGG - Intergenic
1095676876 12:44930356-44930378 GACTTGTATTTAAAATATTTTGG - Intergenic
1096431883 12:51551370-51551392 GAGTTGGATCTTACATTCTTAGG + Intergenic
1097679734 12:62637471-62637493 TAGTTGTCTTTTAAATTATATGG - Intergenic
1097952235 12:65444582-65444604 GAGGTTTATTTTAAGATATTTGG - Intronic
1098511936 12:71326111-71326133 TAGTTATATTTTAACTTTTTGGG - Intronic
1098546317 12:71715706-71715728 TAGTTCTATTTTTAATTTTTTGG - Intergenic
1098562902 12:71897494-71897516 GATTTGTATTTACAATTATTTGG + Intronic
1099440699 12:82696055-82696077 CAGTTGTATAGTTAATTATTTGG - Intronic
1099755946 12:86848168-86848190 GAGTTATTTATTAAATTATTGGG - Intergenic
1100059800 12:90560754-90560776 GACATGTTTTATAAATTATTTGG - Intergenic
1100216134 12:92450610-92450632 TAGTTGAATTTATAATTATTTGG + Intergenic
1101183722 12:102250582-102250604 AAGTTGTACTTTTAATTATTAGG + Intergenic
1101215817 12:102581139-102581161 CAGTATTATTATAAATTATTTGG + Intergenic
1101394142 12:104329343-104329365 GAGTTGTACTTTAAAGTAAGGGG + Intronic
1104265436 12:127228184-127228206 TAGTTGGATTGTGAATTATTTGG + Intergenic
1104278139 12:127349678-127349700 GAGGTGTCTTTTAAGATATTGGG - Intergenic
1104630565 12:130397935-130397957 TTGTTGTATTTGAAACTATTTGG + Exonic
1105562011 13:21501112-21501134 AAATAGTATTTTAAATTAGTTGG - Intronic
1106031026 13:26003070-26003092 TAGTTCTATTTTTAATTTTTTGG + Intronic
1106359915 13:29021400-29021422 GAGTTGTATTTTAATTTTTAAGG - Intronic
1106723838 13:32464098-32464120 TAGTTGTCTTTTAAATCATGTGG - Intronic
1106919262 13:34545849-34545871 GTGTTTTTTTTTAAATAATTTGG - Intergenic
1107653647 13:42570047-42570069 GAGTTATATTTATAAATATTTGG - Intronic
1107672700 13:42762310-42762332 GAGTTATATTATATATTATAAGG - Intergenic
1108142417 13:47437744-47437766 GATATTTATTTTAAAATATTTGG - Intergenic
1109184865 13:59255970-59255992 AAATTGCATTTTAAGTTATTAGG + Intergenic
1109595076 13:64541376-64541398 GAGGTGATTTTAAAATTATTTGG - Intergenic
1109807916 13:67468345-67468367 GATTTTGATTTTAAATAATTTGG + Intergenic
1110100142 13:71590314-71590336 ATATTGTGTTTTAAATTATTTGG + Intronic
1110208957 13:72950225-72950247 TAGCTGTATTATAAATAATTCGG - Intronic
1110470226 13:75851717-75851739 AAGTTGTATTTAAATCTATTTGG + Intronic
1110716914 13:78716097-78716119 CACTTGTATTTTAAAGTCTTGGG + Intergenic
1110756475 13:79180410-79180432 GAATTCTATTTTTAATTTTTTGG + Intergenic
1110923728 13:81123504-81123526 TAGTTCTATTTTCAATTTTTGGG + Intergenic
1110963017 13:81654619-81654641 TAGTTCTATTTTAATTTCTTGGG + Intergenic
1110986764 13:81980900-81980922 GAATTTAATTTTACATTATTAGG + Intergenic
1111391341 13:87598933-87598955 CATTTTTATTTTAATTTATTTGG - Intergenic
1111596891 13:90423438-90423460 TAGTGGTATTTCAAATTCTTTGG - Intergenic
1111648249 13:91058737-91058759 GAGTTAGTTTTTAAATTTTTTGG + Intergenic
1111803687 13:93011593-93011615 AAGTTGTTTTTTAAGTTTTTTGG + Intergenic
1112617480 13:101020173-101020195 GAGTGGCATGTTAAGTTATTTGG - Intergenic
1112622168 13:101063974-101063996 GAATTGTATTTTAATATAATTGG - Intronic
1112641639 13:101282104-101282126 TAGTTCTATTTTTAATTTTTTGG - Intronic
1112973038 13:105284276-105284298 GAGTTTTTATTTAAAGTATTTGG + Intergenic
1113603429 13:111587601-111587623 GAGATTTATGATAAATTATTTGG + Intergenic
1113858215 13:113461342-113461364 GATTTGTATATTAAGTTATTTGG + Intronic
1114430151 14:22653865-22653887 AAGTTGTTTTTTAAATTACCAGG + Intergenic
1114682758 14:24500329-24500351 CAATTGTATTTTTAATTTTTGGG + Intergenic
1114703501 14:24703152-24703174 CAGTTCTATTTTTAATTTTTTGG + Intergenic
1114703585 14:24703993-24704015 GATTTGTTATTTAAATTATTAGG + Intergenic
1114727147 14:24950754-24950776 AAGTTGTATTTTAAGTTCTGGGG + Intronic
1115032225 14:28810565-28810587 GACTTGTACTTAAATTTATTTGG - Intronic
1115188601 14:30721627-30721649 GAATTTTATTTTAAAGTAATAGG + Intronic
1116081406 14:40178146-40178168 GATTTCTATTTTAAATTTTGAGG + Intergenic
1116087175 14:40254927-40254949 CAACTTTATTTTAAATTATTGGG - Intergenic
1116278506 14:42869711-42869733 CACTTGGATTTTAATTTATTGGG + Intergenic
1116403882 14:44544305-44544327 TAGTTCTATTTTTAATTTTTTGG + Intergenic
1116453685 14:45093065-45093087 GTTTTGTATTTTATTTTATTTGG + Intronic
1116583275 14:46669963-46669985 TAGTTGTATTTTAAAATAAAAGG - Intergenic
1116652220 14:47607987-47608009 GCTTTGTATTTTTTATTATTAGG - Intronic
1116733965 14:48664887-48664909 GACTCATATTTTAAATTAATAGG - Intergenic
1116825509 14:49669731-49669753 TATTTGTATGTTAAATTATGTGG - Intronic
1118408888 14:65455945-65455967 GTTTTGTACTTTAAATTATGGGG + Intronic
1119096064 14:71832342-71832364 AATTTGTATTTAAATTTATTTGG + Intergenic
1119931075 14:78547672-78547694 GTGTTGTCTTTTAAATTTTTGGG + Intronic
1120540722 14:85747450-85747472 TAGTTCTATTTTTAATTGTTGGG + Intergenic
1120992772 14:90392790-90392812 TGATCGTATTTTAAATTATTGGG + Intergenic
1121668361 14:95689738-95689760 GAGAAGTATTTTAAATTATACGG - Intronic
1122658075 14:103274993-103275015 GATTTTTATTAAAAATTATTTGG - Intergenic
1124062924 15:26311926-26311948 GAGTTCTATTTTAAGATACTTGG - Intergenic
1126498529 15:49319260-49319282 AAGTAGTATTTTAAAGTGTTTGG + Intronic
1126510196 15:49462719-49462741 AAGTTGTATTTTAACTTAATTGG - Intronic
1127030818 15:54859972-54859994 GAGTATTATTCTGAATTATTTGG - Intergenic
1127544851 15:59982634-59982656 GTGTTGAATTTTAGATAATTAGG - Intergenic
1128198581 15:65783866-65783888 GAGCTGTCTATAAAATTATTTGG - Intronic
1128430228 15:67586128-67586150 GTACTGTATTTTCAATTATTTGG + Intronic
1129410193 15:75346711-75346733 GAGATGCATGTTAAAGTATTGGG - Intergenic
1129449571 15:75643214-75643236 GAGTGGTATTTGAAGTCATTCGG + Intronic
1129483637 15:75846618-75846640 GGGTTGGATTTCAAATGATTTGG + Intronic
1130004154 15:80078602-80078624 TAGTTGTGTTTTAAGTTCTTTGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131301600 15:91204282-91204304 GAGTTAAATTTTAATTAATTTGG - Intronic
1131487675 15:92835533-92835555 GATTTTTATTTTAAATGATAGGG - Intergenic
1131648211 15:94369018-94369040 GATTTGTTTTTTAAGTTATGAGG + Intronic
1131856034 15:96595900-96595922 GAGTTGTATGCTGACTTATTGGG + Intergenic
1133586668 16:7202425-7202447 CAGTTCTATTTTTAATTATTTGG - Intronic
1135151964 16:20015534-20015556 GTGTTGTATTTTACACTATCTGG + Intergenic
1135243880 16:20837394-20837416 GGATTGTATTTTCAAGTATTTGG + Intronic
1135248564 16:20879954-20879976 AAGTTGTTTTTAAGATTATTAGG - Intronic
1137245624 16:46701608-46701630 TAGTTATTTTTTAAATTAGTTGG + Intergenic
1137485446 16:48886892-48886914 TAGTTCTATTTTTAATTTTTTGG + Intergenic
1137804287 16:51288727-51288749 GAGTGATATTTTAAAATGTTGGG + Intergenic
1138326621 16:56177123-56177145 GAGATGTCTTTCCAATTATTTGG + Intergenic
1139167298 16:64582264-64582286 GGGTTGTATTTTTAATAATCTGG - Intergenic
1140137761 16:72222943-72222965 AGGTGGTATTTAAAATTATTTGG + Intergenic
1140630693 16:76848573-76848595 GACTTCCATTTTAAATTATCTGG - Intergenic
1141296200 16:82772111-82772133 GAGCTGGATGTTAAATTGTTAGG + Intronic
1141380605 16:83573269-83573291 TATGTGTATTTTAAATGATTTGG + Intronic
1143830762 17:9648618-9648640 GAGTTGAATTTTGAAGGATTAGG + Intronic
1144179188 17:12736002-12736024 AAGCTATACTTTAAATTATTTGG - Intronic
1144325168 17:14172302-14172324 TAGTTCTATTTTTAGTTATTTGG + Intronic
1145052401 17:19673118-19673140 CAGTTGCATTTGAAATCATTTGG + Intronic
1145180530 17:20746742-20746764 TATTTTTATTTTATATTATTCGG + Intergenic
1146007719 17:29171526-29171548 GATATGTATGTTAAAGTATTTGG + Intronic
1148397571 17:47322353-47322375 TAGTTCTATTTTTAATTTTTTGG - Intronic
1149332687 17:55602933-55602955 GAGTAGTATTTTTAAGTATTGGG - Intergenic
1149566422 17:57643787-57643809 CAGTTGTATTAAAAATTATCTGG + Intronic
1150116717 17:62557534-62557556 GTGTTGTATTTTTCATTGTTCGG + Intronic
1150482969 17:65524656-65524678 GAGTTGGGTCTTAAATTATTTGG + Intergenic
1152063578 17:78097393-78097415 GATTTTTATTTTACCTTATTTGG + Intronic
1152765824 17:82138056-82138078 GAGAGGTATTTGAAATAATTAGG + Intronic
1153598333 18:6752333-6752355 GAGCATTATTATAAATTATTGGG + Intronic
1154028649 18:10730196-10730218 GAGTTGTATTGTGAAGTAGTAGG - Intronic
1154278910 18:12982850-12982872 GAATTGTTTTTTAAGTTATGTGG + Intronic
1154332773 18:13443166-13443188 AAGTTGGATTTTATTTTATTTGG - Intronic
1155649451 18:28123113-28123135 GAGTAGTATTTTAGACTATTTGG - Intronic
1156706830 18:39892840-39892862 AAGTTGTCTTGTTAATTATTAGG + Intergenic
1157069787 18:44392703-44392725 AATTTATATTTTAAATTTTTGGG - Intergenic
1157375324 18:47158655-47158677 GAGTTATCTTTTAAAGAATTTGG + Intronic
1158336963 18:56422649-56422671 GATTTGTATTTTATGTTAATGGG - Intergenic
1158349233 18:56548091-56548113 AATTTATATTTTAAATTAATAGG + Intergenic
1158670959 18:59473513-59473535 GTGTGGAATTTTAAATTATTTGG + Intronic
1161472922 19:4469673-4469695 GGGTTTTATTTTAACTTCTTGGG - Intergenic
1163388977 19:17018149-17018171 GAGAATTATTTTAAATTATAAGG - Intronic
1164913812 19:32033698-32033720 CAGTAGTATTATCAATTATTGGG - Intergenic
1166906249 19:46110523-46110545 TAATTGTATACTAAATTATTTGG - Intergenic
925100664 2:1242481-1242503 GGTTTGTATGATAAATTATTTGG - Intronic
925388140 2:3477228-3477250 CAGTTGAATTCTATATTATTTGG + Intronic
925568378 2:5282014-5282036 GAGTTCTATTTTTAGTTTTTTGG - Intergenic
925877329 2:8323830-8323852 GAATTTTATTTTGAATTTTTAGG + Intergenic
926013751 2:9429723-9429745 GAGCTATATTTTAAATTTGTTGG + Intronic
926557649 2:14378452-14378474 TAGTTCTATTTTAAGTTCTTTGG - Intergenic
927359809 2:22219786-22219808 GTGAAGTATTTTAAATTATATGG - Intergenic
927373938 2:22391107-22391129 GAGTTGTATTATTAGTAATTAGG - Intergenic
928323603 2:30302788-30302810 GGGTTGGATGATAAATTATTTGG - Intronic
928800905 2:35090475-35090497 TAGTTCTATTTTCAATTTTTTGG - Intergenic
928924080 2:36559074-36559096 TACTATTATTTTAAATTATTGGG + Intronic
929639719 2:43565617-43565639 CTTTTTTATTTTAAATTATTGGG - Intronic
930210165 2:48628267-48628289 TAGTTCTATTTTAAGTTCTTAGG + Intronic
931072708 2:58671528-58671550 GCATTGTATTCTAAGTTATTGGG + Intergenic
932275308 2:70447316-70447338 GAGTTGTACTGTACCTTATTTGG - Exonic
932373658 2:71214846-71214868 AAACTGTTTTTTAAATTATTTGG - Intronic
932743431 2:74310190-74310212 GAGTTGTTTGGTAAATTCTTTGG + Intronic
932857489 2:75252046-75252068 TAGTTCTATTTTTAATTTTTGGG + Intergenic
932884290 2:75534069-75534091 AAGTGCTTTTTTAAATTATTGGG - Intronic
933092676 2:78140628-78140650 GAATTTTATTTTCAATTTTTAGG - Intergenic
935483209 2:103619047-103619069 GAGTTGTATTTATATTTATGAGG - Intergenic
935979862 2:108616029-108616051 GAATTTCATTCTAAATTATTTGG + Intronic
936963082 2:118097285-118097307 AAGTGTTATTTTAAGTTATTTGG + Intronic
937819684 2:126295514-126295536 GAGATGTGTTTTGAAATATTTGG - Intergenic
938626465 2:133114393-133114415 GTGATGTAATTTAAATAATTTGG - Intronic
938773098 2:134517770-134517792 GATTTTTATTTTAAATCAATAGG + Intronic
938875164 2:135524798-135524820 AAATTATATTTTAAATTAATGGG + Intronic
939079647 2:137644355-137644377 CAATTTCATTTTAAATTATTGGG - Intronic
939169004 2:138672302-138672324 GAGGTATATTTTGAATTAATAGG + Intronic
939292414 2:140213388-140213410 TGGTTGTATTTTCAATTATTGGG + Intergenic
939941753 2:148359906-148359928 CAGTTTTATTATAGATTATTAGG + Intronic
940227335 2:151413365-151413387 GATTTGTACCTGAAATTATTTGG + Intronic
940657733 2:156508654-156508676 GAGGTATATTTTAAATAATCTGG + Intronic
940743816 2:157544368-157544390 TAGTTATATTTTAATTTATTAGG - Intronic
941172144 2:162151850-162151872 GAGTTGTATTTTAAAATAATTGG - Intronic
941948504 2:171127741-171127763 GAGAGGTATTTTAAATTAGTGGG - Intronic
942333446 2:174853545-174853567 TAGTTCTGTTTTAAATTATTTGG - Intronic
942667736 2:178338339-178338361 TAGTTTTCTTTTAAATTTTTTGG - Intronic
943165737 2:184323029-184323051 GAGATTTATTTTAAAGGATTTGG - Intergenic
943847275 2:192668000-192668022 GAGTTGTACTTTATTTTAATCGG - Intergenic
944275398 2:197831756-197831778 GAGTTTTATTTCCAATTATGTGG - Intronic
945328138 2:208506998-208507020 TAGTTCTGTTTTAAGTTATTTGG + Intronic
945707463 2:213253840-213253862 GAATTGGATTTTAAATCATGAGG + Intergenic
946786444 2:223249674-223249696 GAGTTCTTGTTTAATTTATTTGG + Intergenic
947302936 2:228708676-228708698 GACTTGTAATTTTAATTACTTGG - Intergenic
947885173 2:233563665-233563687 GAATAGTATTTTAAATAATAGGG - Intronic
1169478764 20:5957754-5957776 GTGTTCTTTGTTAAATTATTAGG + Intronic
1169667280 20:8051425-8051447 GACTTGAATTTTTAATTATATGG - Intergenic
1169722710 20:8696629-8696651 GAGATGTATTTCCATTTATTTGG + Intronic
1169989550 20:11485781-11485803 TAGTTCTATTTTAAGTTATTTGG + Intergenic
1170509087 20:17058507-17058529 GAGTAGTAATTTAAATAAATTGG + Intergenic
1172171629 20:32938778-32938800 GAGATGTATTTCCATTTATTTGG - Intronic
1172831811 20:37842354-37842376 GAGTTGCATTTTAAATATCTGGG + Exonic
1173263648 20:41459060-41459082 GAGTTGGATTTGAAGTTACTGGG + Intronic
1173683446 20:44904770-44904792 AAGTTGTATATTAAATGCTTTGG - Intronic
1173699098 20:45051302-45051324 TGGTTGTATTTTATATAATTTGG + Intronic
1173900649 20:46586142-46586164 CATATGTATTTTAAATTTTTTGG - Intronic
1174854163 20:54027046-54027068 GAGACTTATTTTAAATTATACGG + Intronic
1175112650 20:56659495-56659517 TATTTGTTTTTTAAATTCTTAGG - Intergenic
1175350944 20:58317489-58317511 GAGGTGTATTTAAAATGCTTAGG + Intronic
1175396610 20:58668464-58668486 AAGTTGTTTTTTCAATTATGAGG - Intronic
1175513343 20:59550725-59550747 TAGTTGTGTTTTAAGTTCTTTGG - Intergenic
1175666712 20:60867731-60867753 GAGTTTTATTTTTATTTATGTGG - Intergenic
1175672281 20:60915074-60915096 TAGTTGTATTTTAAATCAGGTGG + Intergenic
1176512716 21:7760689-7760711 TAGTTTGATGTTAAATTATTGGG + Intronic
1177215396 21:18121583-18121605 GATTTTTAGTTTAAGTTATTTGG - Intronic
1177219247 21:18169544-18169566 AAGTTGTATTTTGAATCATGTGG - Intronic
1177277321 21:18929307-18929329 TTGTTGTATTTTAAAACATTAGG - Intergenic
1177466875 21:21496159-21496181 TAGTTCTGTTTTAAGTTATTTGG + Intronic
1177747113 21:25230195-25230217 TAGTTCTATTTTTAATTTTTTGG - Intergenic
1177887810 21:26766751-26766773 GACTTTTTTTTTAAATAATTAGG - Intergenic
1177938172 21:27376031-27376053 GAGTTGTTTTTTAAGTAATTTGG - Intergenic
1178267048 21:31153134-31153156 GAGTTCTCTTTTCAATTCTTAGG - Exonic
1178646829 21:34391213-34391235 TAGTTTGATGTTAAATTATTGGG + Intronic
1178879662 21:36439215-36439237 GAGTGGCATTTTAAATTGATTGG - Intergenic
1179121814 21:38554279-38554301 TAGTTCTATTTTAAGTTCTTTGG - Intronic
1179153712 21:38831490-38831512 GATTTGAATTTTAAATTATCAGG + Intergenic
1179270991 21:39850875-39850897 GGGTTGTATTTAATTTTATTTGG - Intergenic
1179434639 21:41351780-41351802 GAATTGAATTTTAAAGTATAAGG + Intronic
1181529060 22:23505850-23505872 TAGTAGTGTTTTAAATTCTTTGG + Intergenic
1182498618 22:30729183-30729205 TAGTTCTATTTTTAATTTTTTGG - Intronic
1182710126 22:32316912-32316934 GAGTTGTTAATTAGATTATTTGG - Intergenic
1183042750 22:35194656-35194678 GAGCTGTTTTTTAAACAATTCGG + Intergenic
1183197217 22:36361765-36361787 GATTTGTATTTTAAAGTAATTGG + Intronic
1184054642 22:42036476-42036498 GTGTTCTATTTTTAATTTTTTGG + Intronic
949567350 3:5257279-5257301 GAGTTGAATTTTGAAAGATTGGG + Intergenic
949842705 3:8337496-8337518 ATGTTGTTTGTTAAATTATTTGG - Intergenic
951747105 3:25990840-25990862 GATTTTTCTTTTAAATTTTTTGG - Intergenic
952268570 3:31810519-31810541 CAGTTGTTTTTTGATTTATTTGG - Intronic
952475612 3:33706987-33707009 GAGTTAGATTTTATTTTATTTGG - Intronic
952547916 3:34441864-34441886 TAGTTATATTTTAAGTTTTTGGG + Intergenic
954547546 3:51451304-51451326 TATTTTTATTTAAAATTATTTGG - Intronic
955099303 3:55831472-55831494 GAGACTTATTTTAGATTATTTGG - Intronic
955859278 3:63310416-63310438 CATATGTATTTAAAATTATTTGG + Intronic
957193742 3:77041093-77041115 GAGTTGGATAATAAATGATTGGG + Intronic
957205408 3:77192303-77192325 GAATTACATTTTAAATTCTTAGG - Intronic
957742969 3:84298403-84298425 GAGATGTATTTTAAAGCACTCGG - Intergenic
958000682 3:87745110-87745132 GTATTATATTTTAAAATATTTGG + Intergenic
958076252 3:88683476-88683498 GAGTTGTATTTCAATTGATTGGG + Intergenic
958776683 3:98492640-98492662 AAGTTCTATTTTTAATTGTTTGG - Intergenic
958785958 3:98596402-98596424 AATTTGTATTTTAAACTTTTAGG + Intergenic
959139488 3:102468683-102468705 TCTATGTATTTTAAATTATTTGG + Intronic
959664249 3:108903859-108903881 GACATTTATTTTAAAATATTCGG + Intergenic
960117338 3:113909711-113909733 GAATATTAATTTAAATTATTGGG + Intronic
960344041 3:116510612-116510634 GAGTTGTAGTCACAATTATTTGG - Intronic
960572847 3:119202645-119202667 GAGTTTTATTTTAGTTTATTTGG - Intronic
960634153 3:119767482-119767504 GAGTTGTATTTACAAATACTTGG + Intergenic
961252145 3:125516354-125516376 CAGTTCTATTTAAAATAATTTGG - Intronic
962236030 3:133707931-133707953 GAGTTGGGTTTTTAAATATTGGG + Intergenic
962470286 3:135701670-135701692 TAGTTCTGTTTTAAGTTATTTGG - Intergenic
962562800 3:136625038-136625060 GAGTTAAATATTAAATTTTTAGG - Intronic
962623712 3:137203955-137203977 GAATTGTTTTTTAAATAATGAGG - Intergenic
962803175 3:138907658-138907680 AAGTTGTTTTGTCAATTATTTGG + Intergenic
962888839 3:139653329-139653351 CAGTTTTTTTTTAAATTATGGGG - Intronic
963698354 3:148591689-148591711 GAGATGTATTTTAAGGTCTTTGG - Intergenic
963910039 3:150808970-150808992 GATTTTTATTTTACTTTATTTGG + Intergenic
964188363 3:153974468-153974490 GAATTCTATTTTAAATTCCTTGG - Intergenic
964301974 3:155298515-155298537 CAGTTGTCTTTTAAATTAGGAGG - Intergenic
964333469 3:155629532-155629554 GGTTTGGATTTTAAATAATTAGG - Intronic
964597703 3:158455442-158455464 AAGTTAGATTTTAAATGATTTGG - Intronic
964832484 3:160900201-160900223 GAGTTGTCTTTTATATTAACAGG + Intronic
964926874 3:161969540-161969562 AAGATGAATTTTAAATAATTTGG + Intergenic
964978002 3:162642458-162642480 GAATTGTATTTAAAAACATTTGG + Intergenic
965116005 3:164489537-164489559 CATTTTTATTTTTAATTATTTGG + Intergenic
965284598 3:166801898-166801920 AAGTTGCATTTTTCATTATTGGG - Intergenic
965697520 3:171425037-171425059 GAGTTCGGTTTTAAATGATTTGG - Intronic
965879251 3:173368977-173368999 GAGTGATATCTTACATTATTAGG - Intergenic
965906638 3:173715967-173715989 GAGTTGTATTTTAAATTATTTGG + Intronic
966060277 3:175746279-175746301 GATTTGTAGTTTCAATTTTTAGG + Intronic
966096347 3:176208270-176208292 GTGTTCTATTTTAAATTAGAAGG + Intergenic
966583384 3:181593554-181593576 TTGTTTTATTTTAAATTATGAGG + Intergenic
966594625 3:181714267-181714289 TAGTTGTATTTTAAAAGATTCGG + Exonic
966999620 3:185320791-185320813 AATTTGTATTTTAATTTATTTGG + Intronic
967283633 3:187847462-187847484 TATTTCTATTTTAAATAATTAGG + Intergenic
967651111 3:191988387-191988409 TAGTTCTATTTTTAATTTTTTGG + Intergenic
967881547 3:194305374-194305396 GACTAGTAGTTTAAATTGTTTGG + Intergenic
969949098 4:10815522-10815544 GAGTTAAATTTTAAAAAATTCGG + Intergenic
970199342 4:13586999-13587021 TATTTATATTTTATATTATTTGG - Intronic
970379859 4:15495775-15495797 TAGTTCTATTTTAAGTTCTTTGG + Intronic
970381783 4:15515638-15515660 GAGTTACATATTAAATTTTTAGG + Intronic
970656767 4:18239683-18239705 CAATTGTATTATAAATGATTGGG - Intergenic
971517584 4:27508238-27508260 CAATTGTTTTTCAAATTATTGGG - Intergenic
971877390 4:32324007-32324029 GAGCTGCATTTTAAAGCATTGGG + Intergenic
972112950 4:35588506-35588528 TAGTTGTATTTTACATTAAATGG - Intergenic
972824593 4:42742603-42742625 GACTTGTATTTAAGATTAATAGG - Intergenic
972891446 4:43561067-43561089 TAGTTTTATTTTAAATATTTAGG - Intergenic
972951395 4:44327895-44327917 TGTTTGTATTTTAAATTACTTGG - Intronic
974257759 4:59483687-59483709 TAGTCGTATTTTTAATTTTTAGG - Intergenic
974554864 4:63433238-63433260 AATTTATATTTTAATTTATTTGG + Intergenic
974570095 4:63634554-63634576 GACTGGTATTTTAAATCATGAGG + Intergenic
974992492 4:69111891-69111913 GACATTTATTTTGAATTATTTGG + Intronic
975878028 4:78867595-78867617 GTATTGTATTTTAAAATATTCGG + Intronic
976035421 4:80813444-80813466 GAGTTGTATATTAAACTATGGGG + Intronic
976076281 4:81302606-81302628 GTTTTGCATCTTAAATTATTTGG - Intergenic
976561619 4:86508338-86508360 GAGTTCTTTTTTACTTTATTTGG + Intronic
976826627 4:89267749-89267771 GAGTTGGACTTTAAATGATAGGG + Intronic
976888475 4:90014818-90014840 TAGTTGAATTTTTAATCATTAGG - Intergenic
976903315 4:90206599-90206621 GTGTTTTATTTCCAATTATTTGG + Intronic
977069134 4:92360928-92360950 GTGTTCTATTTTAAATTGCTTGG + Intronic
977248574 4:94662679-94662701 AAGTTGTTTATTAAATTTTTTGG + Intronic
977476649 4:97519109-97519131 TATTATTATTTTAAATTATTCGG - Intronic
977503437 4:97870842-97870864 AAGTTGTATTTTAGAGTATCAGG - Intronic
978153881 4:105467875-105467897 GAGTTGTATCTTAAACATTTAGG + Intronic
978560452 4:110028418-110028440 GGCTAATATTTTAAATTATTTGG + Intergenic
978655176 4:111057437-111057459 CAGTTTTATTTTTAATTTTTGGG - Intergenic
978954977 4:114601252-114601274 ATGTTTTAATTTAAATTATTGGG - Intronic
978982324 4:114962666-114962688 GGGTTGTCTTTTCATTTATTTGG - Intronic
979105795 4:116685595-116685617 GAATTCTATTTTTAATTCTTTGG - Intergenic
979535531 4:121815968-121815990 GAGTTTTATTTTTATTTTTTGGG + Intronic
979890876 4:126092538-126092560 GAGTTTTATGGTCAATTATTGGG + Intergenic
979929678 4:126615885-126615907 TAGTTCTATTTTTAATTTTTTGG - Intergenic
980383304 4:132055821-132055843 TAATTGCATTTTAAAGTATTTGG + Intergenic
980799242 4:137727602-137727624 TAGTTCTATTTTAAGTTTTTTGG + Intergenic
981242160 4:142491107-142491129 TAGTTCTATTTTTAATTTTTTGG + Intronic
981245446 4:142531754-142531776 GACTTGTATTTTACTATATTTGG - Intronic
981892805 4:149758660-149758682 GAGGTGTCTGTTAAAATATTTGG - Intergenic
982248209 4:153377020-153377042 GAGTTTTATTTAAAGTTAATGGG + Intronic
982356714 4:154477589-154477611 GATTTGTGTTATAGATTATTTGG + Intronic
982552205 4:156816923-156816945 GAGATTTATTTTAATTAATTTGG + Intronic
983791468 4:171802652-171802674 GTGTTTTATTTTCAATTATGTGG + Intergenic
983984700 4:174044250-174044272 AATTTGTATTATAAAATATTTGG + Intergenic
984336053 4:178392642-178392664 CATTTATATTTTAAAATATTTGG - Intergenic
984392643 4:179156539-179156561 AAGTTATATTTTAATTTTTTAGG + Intergenic
985046238 4:185942962-185942984 CAGTTGTATATTTAATAATTAGG + Intronic
985118276 4:186613895-186613917 GAGTTATATTTTAATTTCTGAGG + Intronic
985755941 5:1716996-1717018 GAGTTTTAGTTTAAATTATGAGG + Intergenic
986565415 5:9108850-9108872 GAGTGGTCTTTTAAATTGTTTGG - Intronic
987110079 5:14677649-14677671 GAGTTGTATTTTTAATTTTGGGG + Intronic
987256455 5:16158272-16158294 CAGTTCTATTTTTAATTTTTGGG - Intronic
988136233 5:27174939-27174961 GATTTTTATTTTCAATTAATTGG + Intergenic
988140492 5:27232847-27232869 TAGTTAAATTTAAAATTATTTGG - Intergenic
988193811 5:27974735-27974757 GAGTTTTATTTTATATTTCTTGG + Intergenic
988411592 5:30893043-30893065 AAGTTGAAATTTAAATTATTTGG - Intergenic
988793814 5:34633866-34633888 CAGTTGCATTTTGAAGTATTGGG + Intergenic
988947294 5:36218368-36218390 GAGATGTTATTTAAATTTTTAGG - Intronic
989806583 5:45614868-45614890 AATTTGAATTTCAAATTATTGGG - Intronic
990872056 5:60442839-60442861 GAATTTTGTTTTAAATTATACGG + Intronic
990907200 5:60816735-60816757 CACATGCATTTTAAATTATTGGG + Intronic
991179034 5:63727247-63727269 AAGGTGGATTTTAATTTATTTGG + Intergenic
991269362 5:64761251-64761273 GAGTTGGATTCAAAATTATATGG - Intronic
991478911 5:67055507-67055529 GAGTTGTCTGTTATATTACTGGG + Intronic
992057777 5:73009244-73009266 GTTTTGTCTTTTAAATCATTAGG + Intronic
992847774 5:80770942-80770964 TAATTGTATTAAAAATTATTAGG + Intronic
993265747 5:85724049-85724071 GTGTTTTATTTTGAATTATGTGG - Intergenic
993408228 5:87539575-87539597 GAATTTTATTTTAAATTACCTGG - Intergenic
993624001 5:90201702-90201724 GATTTGTATTTTTCATAATTGGG - Intergenic
994319696 5:98378851-98378873 CAATTGTATTTGACATTATTAGG - Intergenic
994672121 5:102775140-102775162 AAGTGGTATTTTAAATCAATAGG - Intronic
994685526 5:102946730-102946752 AACTTGTGTTTTAAAATATTTGG + Intronic
994934319 5:106234293-106234315 AAGTTGTCTTGTAAATCATTGGG - Intergenic
995518021 5:112973630-112973652 GATTTGATTTTTAAATAATTAGG - Intergenic
995672344 5:114620676-114620698 GAGTTATATTTTAAAACAATTGG - Intergenic
995752492 5:115468423-115468445 CAGGAGTATTTTAAATTAGTAGG + Intergenic
996183312 5:120447479-120447501 GTGTTGTATTTTAAAATATCTGG + Intergenic
996459722 5:123727107-123727129 GAGCTCTATTTTATATTATTTGG - Intergenic
997036576 5:130199866-130199888 GGGTTTCATTTTAAATTATTAGG - Intergenic
997058187 5:130469471-130469493 TAATTCTATTTTTAATTATTTGG - Intergenic
997075116 5:130665273-130665295 TTGTTGCATTTTAAATTCTTAGG - Intergenic
997155771 5:131555136-131555158 GAGAAATATTTAAAATTATTGGG - Intronic
998294089 5:140949855-140949877 CTGTTGTCTTTTGAATTATTTGG + Intronic
998654986 5:144168802-144168824 GTTTTGTTTTTTAAATTCTTGGG + Intronic
998691347 5:144592136-144592158 GTGTTTTACTTTCAATTATTTGG + Intergenic
999057912 5:148600867-148600889 GGGTTGCATTTTCATTTATTTGG - Intronic
999313173 5:150566206-150566228 GAGTTGTTCTTTATATTTTTTGG - Intergenic
999334678 5:150705409-150705431 GAGTAGTATTTTACATTTTATGG + Intergenic
999689198 5:154131808-154131830 AAGTTGTATTTTTTATTTTTAGG - Intronic
999883381 5:155892057-155892079 GAATTGTATTTTGAGTTATTTGG + Intronic
1000210563 5:159103571-159103593 GATCTGTATTTAAAGTTATTTGG + Intergenic
1000445892 5:161319486-161319508 GAGTGCTATTTCAAATTATAAGG - Intronic
1000481348 5:161779181-161779203 GAGGTGTATTTTCTGTTATTAGG - Intergenic
1000741739 5:164976823-164976845 CAGTTCTCTTTTAAGTTATTTGG + Intergenic
1000846655 5:166290241-166290263 GAGTTTTGTTTTCAAGTATTTGG + Intergenic
1000866008 5:166515562-166515584 GATTTGATTTTTAAAATATTGGG - Intergenic
1001162602 5:169334355-169334377 ATGTTTTATCTTAAATTATTAGG + Intergenic
1001423674 5:171608581-171608603 GAGTTTTTCTTAAAATTATTTGG + Intergenic
1004582284 6:16965766-16965788 GACTTCAATTTTAAATTTTTCGG + Intergenic
1004786130 6:18969449-18969471 TAGTTCTATTTTTAATTTTTTGG - Intergenic
1005188682 6:23192997-23193019 GAGTAGTATGTGAAAATATTTGG - Intergenic
1005376827 6:25191330-25191352 TAGTTCTATTTTAAATTTTGGGG + Intergenic
1008151923 6:47963432-47963454 TAGTTCTATTTTTAATTTTTAGG - Intronic
1008905798 6:56676468-56676490 TAGTTCTATTTTTAATTTTTTGG - Intronic
1008974813 6:57412453-57412475 GATTTATAAATTAAATTATTGGG + Intronic
1009163699 6:60313959-60313981 GATTTATAAATTAAATTATTGGG + Intergenic
1009500165 6:64403225-64403247 CATTTATATTTTATATTATTTGG + Intronic
1009891776 6:69693327-69693349 TAGTTGTGTTTAAAATGATTAGG - Intronic
1010256571 6:73765097-73765119 TAGTTGTGTTTTAAATGCTTGGG + Intronic
1010328620 6:74594718-74594740 CATTTTTATTTTAAATAATTTGG - Intergenic
1010807341 6:80253459-80253481 GAGTTTTATTTATAATTCTTGGG + Intronic
1010859712 6:80894263-80894285 TAGTTCTATTTTTAATTTTTAGG + Intergenic
1010888635 6:81275516-81275538 GATTTGTAGTATAAAATATTTGG + Intergenic
1011650400 6:89500842-89500864 TTGTTGTATTTTGATTTATTAGG + Intronic
1011795821 6:90949980-90950002 AACTTGTATTACAAATTATTAGG - Intergenic
1012287789 6:97414401-97414423 GAGTTTTTTTTTTAAATATTAGG - Intergenic
1012575999 6:100799302-100799324 AAATTTTATTTTAAAGTATTGGG - Intronic
1013806439 6:114001072-114001094 GAGTTCAAATTTCAATTATTAGG + Intronic
1014069201 6:117161727-117161749 GATTAGAATTTTAAATAATTTGG - Intergenic
1014884483 6:126763256-126763278 GAGTTTAAATTTAAAATATTAGG + Intergenic
1017265379 6:152439527-152439549 AATTTTTAATTTAAATTATTTGG - Intronic
1017379167 6:153807446-153807468 GAGTTTTATTTAAGAATATTAGG - Intergenic
1018783790 6:167092540-167092562 GAATATTATTTTATATTATTTGG + Intergenic
1019075245 6:169381767-169381789 AACTTGTATTTTAAATTTTGAGG + Intergenic
1020205379 7:6110423-6110445 GAGTCCTATTTTAAAATATTAGG - Intronic
1020247081 7:6437993-6438015 TAGTTACATTTTAAAATATTAGG + Intronic
1020412295 7:7906288-7906310 CATTTCTATTTTAAATAATTTGG - Intronic
1020451087 7:8321209-8321231 CAGATGCAATTTAAATTATTTGG + Intergenic
1020647082 7:10827690-10827712 GAATTCTATTTTAAAATATCAGG + Intergenic
1020703119 7:11508543-11508565 TAGTTGTATTTTTAATTTTCTGG - Intronic
1020775790 7:12452175-12452197 TAGTTCTATTTTTAATTATTTGG - Intergenic
1020877692 7:13718872-13718894 AATCTGTATTTTAAATTTTTAGG + Intergenic
1020992056 7:15210710-15210732 AAGATTTATTTTGAATTATTGGG - Intronic
1021063177 7:16139602-16139624 CATTTCTATTTTAAATTATTAGG - Intronic
1021095249 7:16528018-16528040 AAGTCGGATTTTAAATTAGTTGG - Intronic
1022956160 7:35382648-35382670 GAGATTTAATTTAAATTTTTGGG - Intergenic
1023747695 7:43337085-43337107 TAGTTCTATTTTTAGTTATTTGG + Intronic
1024705564 7:51955477-51955499 TAGTTCTATTTTTAATTTTTGGG - Intergenic
1024763027 7:52623489-52623511 TAGATGTATTTTTCATTATTAGG - Intergenic
1024967562 7:55037718-55037740 GAGATGTAATTTCAATTATTTGG + Intronic
1025298404 7:57795542-57795564 GTGTTGTATATTACATAATTTGG - Intergenic
1025623089 7:63192217-63192239 GATATGTATTTTTAATTAATAGG - Intergenic
1026475018 7:70727783-70727805 GAGTAGGATTTTAACTTGTTAGG - Intronic
1026542561 7:71293245-71293267 TAGTTCTATTTTTAATTTTTGGG + Intronic
1026587811 7:71670989-71671011 GAGTAAAATTTCAAATTATTAGG - Intronic
1029057019 7:97756913-97756935 GATTTATATTATAAATTATTAGG + Intergenic
1029351309 7:100015096-100015118 GAGTGGTATTTTCAAATACTTGG - Intergenic
1030260098 7:107554948-107554970 GAGCTGTTTTTTACATTTTTTGG - Intronic
1030275563 7:107717766-107717788 AAGTTGTCTTTTAAACTACTCGG + Exonic
1030877253 7:114830031-114830053 TAGTTACATTATAAATTATTGGG - Intergenic
1031407484 7:121404109-121404131 GAGATGTATTTCAAATTTTCAGG - Intergenic
1031767042 7:125793466-125793488 GAATATTATTTTAAATAATTTGG - Intergenic
1032046447 7:128613375-128613397 GTGTTGTATTTTTCATTGTTCGG + Intergenic
1032180238 7:129669788-129669810 TAGTTCTATTTTTAATTTTTTGG - Intronic
1032281689 7:130508247-130508269 CAGTTTTATTTAAAATGATTTGG - Intronic
1032532177 7:132631177-132631199 GAATATTATTTTAAATTACTTGG + Intronic
1032683155 7:134206212-134206234 GATATGTATTTTAAATTAAGGGG - Intronic
1032870406 7:135978614-135978636 GATTTGTATTTCTAATTATCAGG - Intergenic
1033379478 7:140800224-140800246 GAGTGGTATGATAAGTTATTTGG + Intronic
1033634417 7:143197673-143197695 TAGTTCTATTTTTAATTTTTTGG - Intergenic
1036009230 8:4702243-4702265 TATTTTTATTTTAAGTTATTGGG - Intronic
1036014365 8:4765739-4765761 TAGTTGGGGTTTAAATTATTGGG + Intronic
1036112921 8:5925325-5925347 TTGTTGTATTTCCAATTATTTGG - Intergenic
1036674718 8:10820980-10821002 GAAGTGAATTTTAAATTAGTTGG - Intronic
1037083973 8:14823676-14823698 TAGTTCTATTTTTAATTTTTTGG - Intronic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1038252025 8:25913879-25913901 CAATTGTATTTTAATTTATTGGG - Intronic
1039190289 8:34965990-34966012 AATTTGTATTTTGAATTATGTGG - Intergenic
1039338120 8:36616952-36616974 GACTTATATATTAAATTGTTTGG - Intergenic
1039353264 8:36786152-36786174 GAGTTATTTTAAAAATTATTTGG + Intronic
1040043853 8:42941674-42941696 GAGTTTTATTCTAAATAATAAGG - Intronic
1040732076 8:50460053-50460075 TAGTTCTATTTTAAATTTTTTGG + Intronic
1040760623 8:50838029-50838051 GACTTTAATTATAAATTATTGGG - Intergenic
1040850461 8:51896356-51896378 TATTGGTATTTTAAAATATTTGG - Intronic
1041211505 8:55556250-55556272 TAGTTCTATTTTTAATTTTTTGG - Intergenic
1041446550 8:57957620-57957642 GCCTTGTATTTTAAAATAATAGG + Intergenic
1041645867 8:60251930-60251952 TAATTCTATTTTAGATTATTAGG - Intronic
1042073733 8:64965466-64965488 GTGTTTTATTTTAAAATATTTGG + Intergenic
1042158741 8:65870672-65870694 AAGTAGTATTTTAAATAACTTGG + Intergenic
1042443691 8:68858761-68858783 GAGTTGTATTTTTAAATTTATGG + Intergenic
1043132447 8:76478391-76478413 GAGTTGTCTGTTAAAGTCTTTGG + Intergenic
1043214435 8:77568580-77568602 GCTTTTTATTTGAAATTATTTGG - Intergenic
1043401443 8:79888945-79888967 TATTTGTTTTTTAAATTACTTGG + Intergenic
1043465454 8:80502184-80502206 TAGTTCTATTATAAATTAATTGG + Intronic
1043771471 8:84207115-84207137 AAGTTCTATTTTTAATTTTTTGG - Intronic
1044084200 8:87923816-87923838 AAGTTGAGTTTTAAATTATCTGG + Intergenic
1044107580 8:88230352-88230374 GAGTTATCTTTTAAAATGTTAGG - Intronic
1044115972 8:88334367-88334389 CAGTGGTATTTCATATTATTTGG + Intergenic
1044160601 8:88909678-88909700 GAGTCCTATTTTTAATGATTAGG + Intergenic
1044301463 8:90588594-90588616 AATTTGTTTTTTAAATGATTGGG - Intergenic
1045029337 8:98120142-98120164 AAGTTGTTTTGTAAAATATTTGG + Intronic
1045159475 8:99522421-99522443 GAGTTGTATTTTTACTTTCTGGG + Intronic
1045566161 8:103317973-103317995 GAGTTGTATTTTGCATACTTTGG + Intronic
1045667679 8:104507501-104507523 AAGTTGTAAGTTAAATTTTTAGG + Intronic
1046478903 8:114787175-114787197 AAGTTATATTTTATATTATTGGG + Intergenic
1047376571 8:124303499-124303521 TAGTTGTATTTTAAAAGATTCGG + Intergenic
1048804219 8:138224613-138224635 TAGTTGTATTTTAACTGTTTAGG - Intronic
1048944828 8:139435048-139435070 GAGTAGCATTTTAAATTAGCAGG + Intergenic
1050155327 9:2661237-2661259 GAAATGTATTTTTAATTAGTGGG + Intergenic
1050208290 9:3222869-3222891 GAGTTGTATAATAAAAAATTTGG + Exonic
1050262472 9:3854960-3854982 GAGTTATACTTGAAATTAATGGG - Intronic
1050939039 9:11436144-11436166 ATGTTGTATAATAAATTATTTGG + Intergenic
1050980107 9:11999642-11999664 TAGTTTAATTTTAATTTATTTGG - Intergenic
1051981062 9:23017632-23017654 AGTTTTTATTTTAAATTATTTGG - Intergenic
1052678830 9:31662254-31662276 TACTTGCTTTTTAAATTATTTGG + Intergenic
1053097820 9:35344297-35344319 CAGTTGTACTTAAAATTATCTGG - Intronic
1053521766 9:38787634-38787656 TAGTTCTATTTTTAATTATTTGG - Intergenic
1054193933 9:62011623-62011645 TAGTTCTATTTTTAATTATTTGG - Intergenic
1054644474 9:67577068-67577090 TAGTTCTATTTTTAATTATTTGG + Intergenic
1054948523 9:70823316-70823338 GAGTGATGTTTTAAATAATTAGG + Intronic
1055162308 9:73145189-73145211 ACATTTTATTTTAAATTATTTGG + Intergenic
1056298680 9:85220000-85220022 GAGATGAATTTTAATTTGTTTGG + Intergenic
1057289489 9:93794075-93794097 CATTTGTCTTTTAAATTTTTAGG + Intergenic
1057538008 9:95934677-95934699 GCATTGTATTTCAAATTATAGGG - Intronic
1058219701 9:102282792-102282814 TATTTATATTTTAAATAATTTGG + Intergenic
1058246946 9:102638582-102638604 GAGTTCTAGTTTAAATTGTAAGG - Intergenic
1058267438 9:102920473-102920495 TAGTTCTATTTTTTATTATTGGG + Intergenic
1060536530 9:124393641-124393663 AAGTGGTGTTTTAAATTATTAGG - Intronic
1061255056 9:129450371-129450393 TAGTGGTGTTTTAAATTCTTTGG - Intergenic
1185628544 X:1499688-1499710 ATGTAGTATTTTAAATTATAGGG - Intronic
1185911796 X:3987981-3988003 CAGATGTATTTTAAGTTCTTTGG - Intergenic
1186263041 X:7801503-7801525 GAGTTTTATTTTTTGTTATTTGG + Intergenic
1186470453 X:9817318-9817340 GAATTGTAATTTAAATCATAAGG + Intronic
1187715574 X:22098878-22098900 TAGTTGCATCTTGAATTATTAGG + Intronic
1187759222 X:22561585-22561607 GAAATGTAATTTAAAATATTGGG + Intergenic
1187916404 X:24156527-24156549 GAGTTGCATTATAAATCAGTGGG - Intronic
1188165109 X:26852872-26852894 TAGCTGTCTTTTAAATTGTTTGG - Intergenic
1188524459 X:31074126-31074148 GGGATGTCTTTTAATTTATTTGG + Intergenic
1189605003 X:42667754-42667776 AAGTTGGATTTTAAATTGTAAGG - Intergenic
1189951704 X:46238937-46238959 GAATATTAATTTAAATTATTGGG + Intergenic
1190420475 X:50225428-50225450 GATTTTTATTTTAAATTCTGTGG + Intronic
1191029061 X:55947822-55947844 GAAATGTTTTTTAAAATATTGGG - Intergenic
1191153521 X:57245465-57245487 GTGTTTTACTTTCAATTATTTGG - Intergenic
1191966479 X:66764501-66764523 GTGTTTTATTTTCAATTATGTGG + Intergenic
1192994247 X:76495367-76495389 GTGTTTTATTTTCAATTATGTGG - Intergenic
1193032558 X:76915092-76915114 TAGTTCTGTTTTAAGTTATTTGG - Intergenic
1193171069 X:78336316-78336338 TAGTTCTATTTTAAGTTCTTTGG + Intergenic
1193782169 X:85717058-85717080 GTGTTTTATTTTTAATTATGTGG + Intergenic
1194042210 X:88955617-88955639 TATTTCTATTTTAAATTAATAGG + Intergenic
1194172357 X:90602714-90602736 CAATTGCATTTTAAATTCTTAGG - Intergenic
1194369455 X:93054240-93054262 GAATAGTATTTTATATCATTGGG - Intergenic
1194446182 X:93989504-93989526 GTGTTTTACTTTCAATTATTTGG - Intergenic
1194702085 X:97127043-97127065 TATTAGTATTTTAAATTTTTTGG + Intronic
1195238061 X:102921482-102921504 TAGTTCTATTTTAAGTTACTTGG + Intergenic
1195901649 X:109803999-109804021 GAGTACTATTTTATATTTTTAGG - Intergenic
1195953249 X:110301038-110301060 TGGTTGTATTTTAATTTTTTTGG + Intronic
1196185670 X:112742519-112742541 GAGTTGTATTTTTACTTTTCAGG - Intergenic
1196189086 X:112776308-112776330 AAAGTGTTTTTTAAATTATTTGG + Exonic
1196204304 X:112921730-112921752 GAATTGCATTTTAAATTAGTTGG + Intergenic
1196231656 X:113230758-113230780 TAATTGTATTTTTAATTTTTGGG + Intergenic
1196304177 X:114081781-114081803 GTGTTATAATTTTAATTATTTGG + Intergenic
1196354132 X:114769788-114769810 GAGTTGTCTTTTAAACCATTTGG + Intronic
1196737395 X:118991967-118991989 AAGTTGTATGTTAAAGTATGTGG + Intronic
1197321057 X:125031508-125031530 CATTTGTATTTTAAGTTATAGGG + Intergenic
1197888679 X:131245473-131245495 GAGTTTTTTTTTTATTTATTTGG + Intergenic
1197919002 X:131569370-131569392 GGGTTGTCTTTTCAATTTTTTGG + Intergenic
1198754257 X:139966382-139966404 GAGTTGTATTTTTTTTTTTTTGG - Intergenic
1198945186 X:142004183-142004205 GCATTGTATTTTAAATCACTTGG + Intergenic
1199164540 X:144656061-144656083 GTGTTGTCATTTTAATTATTTGG + Intergenic
1199313792 X:146352360-146352382 GAGCTGTATTTTCTACTATTTGG - Intergenic
1199415981 X:147583749-147583771 GAGTTGTATCTTCAAACATTTGG + Intergenic
1199418635 X:147617107-147617129 AAATTGTATTTAAAATTATATGG - Intergenic
1199523638 X:148766950-148766972 GAATTGTATTTTTATTTGTTTGG + Intronic
1199868593 X:151876408-151876430 CAGTTCTATTTTAAGTTTTTTGG - Intergenic
1200334789 X:155338722-155338744 GAGTTTTATTGTACATTATTTGG + Intergenic
1200351677 X:155502499-155502521 GAGTTTTATTGTACATTATTTGG - Intronic
1200518582 Y:4180451-4180473 CAATTGCATTTTAAATTCTTAGG - Intergenic
1201508474 Y:14731341-14731363 TAGTTCTATCTTAAGTTATTTGG + Intronic
1201694323 Y:16808062-16808084 GAGTTTTATTATTAATCATTTGG - Intergenic
1202016024 Y:20407573-20407595 GAGTTATATTTCCAATTACTAGG + Intergenic