ID: 965908613

View in Genome Browser
Species Human (GRCh38)
Location 3:173742305-173742327
Sequence AGGGCTGATGTCGCTGTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965908613 Original CRISPR AGGGCTGATGTCGCTGTACT AGG Intronic
900471194 1:2855808-2855830 AGGGCCGGTGTGGCTGTAATTGG + Intergenic
900539395 1:3195259-3195281 AGGGCTGATGTCACGGTGCCGGG - Intronic
901002706 1:6156579-6156601 AGGGCTGACGTAGCTATACCTGG - Intronic
903870349 1:26429589-26429611 ATGGTTGATTTTGCTGTACTGGG + Exonic
906142082 1:43539869-43539891 AGGGCTGATGTGGGGGTACAGGG + Intronic
908333182 1:63092075-63092097 AGCTCTGATGGCGATGTACTAGG - Intergenic
908466125 1:64397404-64397426 AGGGCTCATATCTATGTACTGGG - Intergenic
911341957 1:96650318-96650340 AGGCCTGCTGCTGCTGTACTGGG - Intergenic
921049136 1:211498715-211498737 AGGGCTGATGAGGCTGTAGAGGG + Intergenic
922497160 1:226066801-226066823 AAGGCTGCTGTTGCTGTGCTGGG + Intronic
923497734 1:234539873-234539895 AGAGCTGATGAGGCTGTGCTTGG + Intergenic
1063006129 10:1972339-1972361 AGGGGTGAAGTGGCTGTACGAGG - Intergenic
1066464194 10:35639417-35639439 AGTGCTGACGTCGCTGTAGAGGG + Exonic
1071448972 10:85776633-85776655 AGGGCTGCGGTCGCTGCGCTTGG - Intronic
1078566194 11:12416563-12416585 AGGGCAGATGGCGCTGGAGTCGG - Intronic
1081942368 11:46954925-46954947 ACGGTTGATTTTGCTGTACTGGG - Intronic
1083859265 11:65411353-65411375 AGGGCTGAGGACGCTGCACCCGG + Exonic
1092090497 12:5799836-5799858 AGGGCTCATTTTGCTGGACTAGG - Intronic
1093944625 12:25093396-25093418 AGGGCTGAAGATGCTGTAGTTGG + Intronic
1102928651 12:116845820-116845842 ATAGCTGATGTGGCTGTAGTTGG - Intronic
1103356589 12:120325992-120326014 AGGGCTGATGCCGCTGTCGGCGG + Exonic
1103359809 12:120346850-120346872 ATGGCTGATGCTGCTGCACTAGG - Intronic
1114223607 14:20718583-20718605 CGGGCTGATTTCGATGTACTGGG + Intergenic
1114666613 14:24381115-24381137 AGGGCAGATGCTCCTGTACTGGG - Intergenic
1128417106 15:67457057-67457079 ACGGCAGTTGTCGCTGTACAGGG - Intronic
1130553790 15:84908904-84908926 TGGGCAGAGGTCGCCGTACTGGG + Intronic
1136524698 16:30821437-30821459 AAAGCTGCTGTCGCTGTCCTGGG + Intergenic
1142978483 17:3658646-3658668 AGGGCTGAAGTTGCTGCACCCGG + Intronic
1144479603 17:15617993-15618015 AGTGCTGATGTTGCTGGACTGGG - Intronic
1144918700 17:18745746-18745768 AGTGCTGATGTTGCTGGTCTGGG + Intronic
1145159795 17:20566868-20566890 AGCCCAGATGTCGCTGTCCTCGG - Intergenic
1149010376 17:51850491-51850513 AGGGGTGAGGTCTCTGTAATAGG + Intronic
1151320258 17:73348650-73348672 AGGGATGAGGTCGTTGTATTTGG + Exonic
1157266232 18:46225229-46225251 AGGGCTGCTGTGGCAGTACTTGG - Intronic
1165161145 19:33817178-33817200 TGGGCTGATGTAGCTGTTGTAGG + Intergenic
1166267857 19:41696097-41696119 AGGGCTGATGGCGCTGTCCTGGG - Intronic
1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG + Intergenic
927130415 2:20053914-20053936 AGGGCTGTTCTCCCTGTACTGGG + Intergenic
929029357 2:37636239-37636261 AGGGCTGTTGTGGCTGGCCTGGG - Intergenic
932817861 2:74876175-74876197 AGCCCTGATGCTGCTGTACTCGG + Intronic
934130093 2:88939510-88939532 CAGGCTGATGTCTCTGTACTGGG + Intergenic
934134830 2:88985306-88985328 CAGGCTGATGTCTCTGTCCTGGG + Intergenic
934235476 2:90228448-90228470 CAGGCTGATGTCTCTGTCCTGGG - Intergenic
938254975 2:129850574-129850596 ATGGCTGATGCTGCTGTGCTAGG - Intergenic
938595272 2:132782597-132782619 AGTGCCAATGTGGCTGTACTTGG - Exonic
940352752 2:152707227-152707249 CAGGCTGATGTTGATGTACTGGG - Intronic
943081870 2:183265819-183265841 ATGGTTGATTTTGCTGTACTGGG + Intergenic
943420968 2:187668601-187668623 AGCGCTGATGGCGATGTACAAGG + Intergenic
947374994 2:229486807-229486829 AGGGCTGATGCTGCTGATCTGGG - Intronic
1170062723 20:12276328-12276350 AGTCCTGATGTCCCTGTTCTAGG + Intergenic
1176811358 21:13541265-13541287 CAGGCTGATGTTGGTGTACTGGG + Intergenic
1178297194 21:31420283-31420305 GAGGCTGATGTGGCTGTCCTGGG - Intronic
1183518071 22:38279234-38279256 AGAGCTGATGGCTCTGTCCTAGG - Intergenic
1183723203 22:39573987-39574009 AGGGCTGCTGAGGCTGGACTGGG + Intronic
1184064218 22:42107123-42107145 CAGGCTGATGTTGATGTACTGGG + Intergenic
1184245720 22:43234920-43234942 AGGGGGGCTGTGGCTGTACTGGG - Intronic
954375234 3:50191090-50191112 AGGGCTGGTGACTCTGGACTGGG - Intergenic
955716796 3:61837940-61837962 AAGGCTGATGTCCCTGTAAGAGG - Intronic
960549258 3:118955546-118955568 AGTGCTGATGGAGCTGTACAAGG - Intronic
962158501 3:132974595-132974617 AGGGCTGATTTATCTGTCCTGGG + Intergenic
965908613 3:173742305-173742327 AGGGCTGATGTCGCTGTACTAGG + Intronic
980791730 4:137629690-137629712 AGTGCTGATGTTGCTGCCCTGGG + Intergenic
985591725 5:768985-769007 AGGGCTCATGGCACTGCACTGGG - Intergenic
985609641 5:879944-879966 AGGGCTCATGGCACTGCACTGGG - Intronic
990984043 5:61625913-61625935 AGGCCTGAGGTCGCTGTATCCGG - Intergenic
997626052 5:135331189-135331211 AGGGCTGAAGTGGCTGTCCTAGG + Intronic
1000794561 5:165648807-165648829 AGGGCTGAAGTCTCTGTGATGGG + Intergenic
1001139443 5:169132021-169132043 AGAGCTGATGTGGCTCTTCTAGG - Intronic
1003587230 6:7402933-7402955 AGGGCTGATGTTCATGTACAGGG - Intronic
1007481318 6:42152079-42152101 AGGGCTCATATGGCTGTAGTGGG - Intergenic
1007570240 6:42884827-42884849 AGGGCTCATGTTGCTGTAGAAGG + Intronic
1019990410 7:4686462-4686484 AGAGCTGATCTTGCTCTACTGGG + Intronic
1043248180 8:78033121-78033143 AAGGCTGATGTGGATGTACTGGG - Intergenic
1044277310 8:90316856-90316878 AAGGCTGTTGTCGCTGTGCCTGG - Intergenic
1045377792 8:101592527-101592549 AGAGCTGATGTGGCTGGTCTGGG - Intronic
1045834403 8:106503472-106503494 AGGGCTGTTGTTGATGTTCTGGG + Intronic
1054858701 9:69927978-69928000 CAGGCTGATGTTGATGTACTGGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056600086 9:88040058-88040080 CAGGCTGATGTTGATGTACTGGG + Intergenic
1058372536 9:104286337-104286359 AGGGTTGATGTCACTGTTCCTGG - Intergenic
1186311512 X:8324333-8324355 AGGGCTGCTGTGCCTGTACTAGG - Intergenic
1193067409 X:77274829-77274851 AGGGCTGAGGTGGCCGTGCTAGG - Intergenic
1197812116 X:130454198-130454220 AGGGCTGATTTCCCTGATCTGGG + Intergenic