ID: 965908815

View in Genome Browser
Species Human (GRCh38)
Location 3:173745373-173745395
Sequence TGATGCAATTAGCATAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965908815 Original CRISPR TGATGCAATTAGCATAAACT AGG (reversed) Intronic
903120784 1:21215799-21215821 TGATGTAATTAGCTAAAACGGGG + Intergenic
903420366 1:23214654-23214676 TGCTAAAATTAGCATAAACCAGG - Intergenic
906918125 1:50033670-50033692 TGATGCCATTAAAATAGACTAGG - Intergenic
907322024 1:53609227-53609249 TAATGCAATTACCATATATTTGG + Intronic
912102798 1:106232780-106232802 TGATGCAATCATCATCCACTAGG - Intergenic
912765234 1:112402962-112402984 TGATACCATTAGCAAAAACAGGG - Intronic
916592292 1:166204291-166204313 TGATACAATCAGCAGAGACTGGG - Intergenic
917770605 1:178273258-178273280 TGAGGCAAAAACCATAAACTTGG + Intronic
919001314 1:191834648-191834670 TGATTCAATTACCTTACACTGGG - Intergenic
923743053 1:236673710-236673732 TGAAGCATTTAGCACACACTTGG + Intergenic
923810936 1:237314883-237314905 CAATGAAATTAACATAAACTGGG + Intronic
923927884 1:238656434-238656456 TAATACAATAAGCATAAAATAGG + Intergenic
924664050 1:246051692-246051714 TAATGCAATTGGCATAATCTAGG - Intronic
924701711 1:246460705-246460727 TTATGAAATCAACATAAACTAGG - Intronic
1064709089 10:18104856-18104878 TGATGCACTTACCATAAATTTGG + Intergenic
1065554218 10:26898600-26898622 TGATTCAATTAGTATAGAATTGG + Intergenic
1065654803 10:27937620-27937642 TGATACAGTTAGCAGAGACTTGG + Intronic
1068257342 10:54530226-54530248 TGATGCAAAAAACATAAATTTGG - Intronic
1069243522 10:66171729-66171751 TGATGGAATTAGCTGAAACTTGG + Intronic
1077913357 11:6593588-6593610 TGATGTGATTACCAGAAACTAGG - Intronic
1078089978 11:8259023-8259045 TGATGCAATTGGCATTAGCGAGG - Intronic
1078889115 11:15538065-15538087 TGTTGTAATTTGCATAAAGTTGG - Intergenic
1079511367 11:21215106-21215128 TGATTCAATTACCTTACACTGGG - Intronic
1079585745 11:22125353-22125375 TGATGTAAATAACATAAAATAGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1087740918 11:101885839-101885861 TGTTGAAATTAGCCTAAACCAGG - Intergenic
1087970974 11:104483407-104483429 TGATGCCAAAAGCATAGACTGGG + Intergenic
1089969819 11:122683920-122683942 GGCTGCAATCAGCATAATCTGGG - Intronic
1091569316 12:1670574-1670596 TGAAGCAATTAACTTAAAGTTGG - Intergenic
1091653434 12:2326354-2326376 TGATTCAATAAGTCTAAACTAGG + Intronic
1093807584 12:23453462-23453484 TGATGTAATTACCATAAATATGG + Intergenic
1094458637 12:30668621-30668643 TGAAGCAATTAATACAAACTGGG + Intronic
1096137539 12:49214989-49215011 AAAGGCAATTAGCATAAAGTGGG + Intronic
1099421813 12:82471185-82471207 TGATGCAACATGCATAAACCTGG + Intronic
1099729436 12:86480758-86480780 TGCTGCAATTAACACAAAATAGG + Intronic
1101462149 12:104907020-104907042 TGATGGAATTTGCATAAATTTGG - Intronic
1101928576 12:108993638-108993660 TGCTGCAAATAAAATAAACTGGG + Intronic
1102760333 12:115379686-115379708 TGAAGCAGTTAGCATGCACTTGG - Intergenic
1103051609 12:117784584-117784606 TGATGCAAATAGCAGACACTGGG - Intronic
1107038788 13:35927696-35927718 TCATCTCATTAGCATAAACTTGG - Intronic
1107066630 13:36220430-36220452 TGATGGAATTTATATAAACTAGG + Intronic
1108835327 13:54539067-54539089 TAATGCTATTACCATAAAGTAGG + Intergenic
1109181885 13:59223756-59223778 TGATGCTATTCCCATAAAATTGG + Intergenic
1109458338 13:62623781-62623803 TTATATTATTAGCATAAACTAGG - Intergenic
1112160738 13:96865199-96865221 TGATGAAAATAGCAAACACTTGG + Intergenic
1113617411 13:111690879-111690901 TGAAGCGTTTAGCACAAACTCGG + Intergenic
1113622940 13:111776139-111776161 TGAAGCGTTTAGCACAAACTCGG + Intergenic
1116455340 14:45114647-45114669 AGATGTTATTAGCATAAATTAGG + Intronic
1116592677 14:46799213-46799235 TGATGGATTTTGCATAAACCTGG + Intergenic
1118670279 14:68118561-68118583 TGCTGCAATCTGCATAAATTTGG - Intronic
1124684115 15:31764746-31764768 AGATTCAATTAGTATAAATTAGG + Intronic
1126793696 15:52243294-52243316 TGATGCCGTGAGCCTAAACTGGG + Intronic
1127155406 15:56119452-56119474 AGATGCCATAAGCATACACTGGG - Intronic
1128514556 15:68334198-68334220 TGATCCAATAAGCATTAATTAGG - Intronic
1128962271 15:72019498-72019520 TAATGCAAATAGTTTAAACTGGG + Intronic
1130453772 15:84083040-84083062 TGATGTACTTAGAATAAATTCGG + Intergenic
1130584292 15:85168630-85168652 TAATGCTGTTGGCATAAACTAGG - Intergenic
1138906021 16:61334693-61334715 TGCAGCAATTAGCATAAATATGG + Intergenic
1138964170 16:62064074-62064096 TAATGATATTAGCATAAACTAGG - Intergenic
1140268381 16:73440520-73440542 TGATGAAATTAACACAAAGTCGG - Intergenic
1140687240 16:77445304-77445326 TAATGCACTTAGCAAAAATTTGG + Intergenic
1143154595 17:4828164-4828186 TAAAGCACTTAGCATATACTAGG - Intergenic
1143292828 17:5844888-5844910 TGATGTAATTATTATAATCTTGG - Intronic
1148916478 17:50984332-50984354 TTATGCAATTCGGAGAAACTTGG - Intronic
1151034051 17:70777872-70777894 TGATGCATATAGAAGAAACTAGG + Intergenic
1152170171 17:78740767-78740789 TCAGGCAGTCAGCATAAACTGGG + Intronic
1152181396 17:78823920-78823942 TGAAGCACTTTGCATAGACTGGG - Intronic
1153072576 18:1122893-1122915 TAGTGCAATTAGCAGAAAATGGG - Intergenic
1153397422 18:4640486-4640508 TGGTACAATTAGCATCAGCTAGG - Intergenic
1156707579 18:39901669-39901691 TGTTGCAAATGGCATATACTTGG - Intergenic
1156940827 18:42765825-42765847 TGATTCAATTACCGAAAACTGGG - Intronic
1156992448 18:43425889-43425911 TGATCTAATTATAATAAACTGGG - Intergenic
1159606133 18:70477231-70477253 TGATGCAATTACCTCACACTGGG - Intergenic
1164006891 19:21158084-21158106 TGATACAAATAGCATTAAATTGG + Intronic
1166282570 19:41804295-41804317 TGATGCCATTATCATAAGATGGG + Intronic
926505452 2:13709242-13709264 TGATGGAATCAACATAAATTTGG + Intergenic
928905583 2:36363874-36363896 TGCTGCAGTTGGTATAAACTAGG + Intronic
929356342 2:41029227-41029249 TGATGCAATTGGCATCCAGTTGG - Intergenic
929999619 2:46852138-46852160 TGCTGTAATTATCACAAACTGGG + Intronic
931119510 2:59200156-59200178 TGATTCAATTACCTTATACTGGG - Intergenic
931716197 2:65030604-65030626 TCATGCAAATAGCACTAACTAGG - Intergenic
931784002 2:65602829-65602851 AGATGGAATTTGTATAAACTGGG + Intergenic
931925286 2:67065741-67065763 AGATGCTAATAGCATATACTTGG - Intergenic
933047720 2:77559033-77559055 TGATTCAATTAGCTTTTACTGGG - Intronic
933204511 2:79490048-79490070 TGATGAAATTGGCAAGAACTAGG - Intronic
933467214 2:82668221-82668243 TGATGGAATAAGGATCAACTTGG - Intergenic
937016477 2:118610764-118610786 TGATGCAGTTAGCCTGACCTAGG - Intergenic
937722173 2:125113481-125113503 TCAAACAATTTGCATAAACTTGG - Intergenic
939892495 2:147754087-147754109 TGATGCAATTAGCTAAAAAATGG + Intergenic
940657128 2:156501373-156501395 TTATGGAATTAGAATGAACTTGG + Intronic
944438618 2:199718496-199718518 TGATGCAATTAACATAGAAGTGG + Intergenic
1171351435 20:24506092-24506114 TAAGGCACTTAGGATAAACTGGG - Intronic
1175068118 20:56307743-56307765 TGAATCAATTTCCATAAACTTGG - Intergenic
1179276499 21:39896642-39896664 TAATGCAATAAGCATACACGAGG + Intronic
1179986378 21:44923181-44923203 GGATGCAATTAGCAAAATCCAGG + Intronic
949584498 3:5424622-5424644 TAAAGCATTTAGCATATACTAGG + Intergenic
949735949 3:7171807-7171829 TGATGCACTTGGCATTTACTTGG - Intronic
950286870 3:11751926-11751948 TGATGCAAGTAGCTCCAACTAGG + Intergenic
951823236 3:26837625-26837647 TGATTCTGTTAACATAAACTAGG - Intergenic
955118178 3:56026692-56026714 TGTTACCATTAGCAGAAACTAGG - Intronic
956701582 3:71963890-71963912 TTATGCAATTAGCAAGAAATAGG - Intergenic
958774450 3:98464853-98464875 TGATGCCATTATCATAAAAGTGG + Intergenic
959268869 3:104178752-104178774 TGATTCAATTATCATTCACTGGG + Intergenic
961934322 3:130567114-130567136 TGATCCCGATAGCATAAACTCGG - Exonic
962420260 3:135222039-135222061 TGATGCAAAGAGCACAAGCTTGG + Intronic
963141713 3:141951112-141951134 TGGTGCATCTAGCATAATCTTGG + Intergenic
963734443 3:149003965-149003987 GGATGCATTTATCAGAAACTGGG - Intronic
964437054 3:156664520-156664542 TGATGGAGTAAGCATGAACTAGG - Intergenic
964586161 3:158305116-158305138 TCATTCAAATAGCATGAACTTGG + Intronic
964995486 3:162873468-162873490 TCAAGCAATAAGCATAAAATTGG + Intergenic
965908815 3:173745373-173745395 TGATGCAATTAGCATAAACTAGG - Intronic
967829606 3:193907860-193907882 TGATCAAATTAGCATAAGCCTGG + Intergenic
970617180 4:17779353-17779375 TTAAGCAATTAGCATAAAAATGG + Intronic
974225703 4:59040083-59040105 TGATGCAATTACAATTAGCTTGG - Intergenic
974755144 4:66195758-66195780 TGATGCCTTTATTATAAACTGGG - Intergenic
975080841 4:70278629-70278651 TTAAGCAATTAGAATAATCTTGG + Intergenic
976313149 4:83632788-83632810 TTATGAAATGAGCATAAACATGG + Intergenic
978358537 4:107903859-107903881 TGATGAAATTAGAATAAAGTGGG - Intronic
978851690 4:113345139-113345161 TGATGCAATATGAATGAACTTGG + Intronic
982193854 4:152888728-152888750 GGCTGCAGTTAGCATAACCTAGG + Intronic
982653260 4:158114242-158114264 TGCTGCATTTAGCATAAAACTGG + Intergenic
983002308 4:162431844-162431866 TAATGCATTTAGTATAAATTTGG + Intergenic
983417450 4:167476764-167476786 TGATGCAATGGTAATAAACTTGG + Intergenic
983465032 4:168076247-168076269 TAAAGCAATTAGAATAGACTAGG + Intergenic
983979199 4:173973435-173973457 TGCTGCACTGAGCATTAACTCGG - Intergenic
984335089 4:178379694-178379716 TGATCCAACTGGCATAAAGTTGG + Intergenic
984341788 4:178466531-178466553 TGATGGAGATAACATAAACTTGG - Intergenic
988268705 5:28986180-28986202 TGATGCAAGAAACATAAAATTGG - Intergenic
989210370 5:38853278-38853300 TGATAAAATTAACATTAACTGGG + Intronic
991928233 5:71726323-71726345 AGATGCAATTCACATAAACATGG - Intergenic
993591168 5:89796822-89796844 TAATACAATTATCATAAACAGGG + Intergenic
997274771 5:132575370-132575392 TGATTCAATTACCTTCAACTGGG + Intronic
998532546 5:142899327-142899349 TGATGCAGCCAGCATTAACTTGG + Intronic
999389316 5:151178808-151178830 TGATACAATGAGCATAAAACAGG + Intergenic
1008586281 6:52953160-52953182 TTAAGCAATTAGCATATAATGGG - Intergenic
1010189811 6:73183529-73183551 TGATGCAATGAACTTAACCTGGG - Intronic
1011095556 6:83658175-83658197 TGTTACCATTAGGATAAACTGGG - Intronic
1013567826 6:111386054-111386076 TAATGCAATTAGCTTATACATGG - Intronic
1014492173 6:122075962-122075984 TGATGCAATTAGCCCAACCTTGG - Intergenic
1014840414 6:126213036-126213058 AGATGCCAATAGCATACACTGGG - Intergenic
1015183693 6:130388794-130388816 TGATGCAATTCCCACAAACTGGG - Intronic
1016094534 6:140019842-140019864 TGATGAAATGAGCTAAAACTTGG - Intergenic
1016486857 6:144550072-144550094 TGTTGCAATTAGCAGAAATAAGG + Intronic
1020956583 7:14746387-14746409 TAAAGCACTTAGCATACACTTGG + Intronic
1021816372 7:24451251-24451273 TGATGTAAGTATCACAAACTGGG - Intergenic
1022706685 7:32808388-32808410 GGATGCAATCAGCAAAATCTAGG + Intergenic
1023720248 7:43085565-43085587 TGATGGGATTAACAGAAACTTGG + Intergenic
1028710268 7:93899397-93899419 TTATGTAATTACCATAAGCTAGG - Intronic
1029057072 7:97758029-97758051 TGATGCAATGATAATAAACTGGG + Intergenic
1030450957 7:109710464-109710486 CGATGAAAATAGCATAAACCAGG - Intergenic
1032503842 7:132420734-132420756 TGATGCAATTACCTCACACTGGG - Intronic
1033477704 7:141706704-141706726 TAATGCAATTATTATCAACTGGG - Intergenic
1034836515 7:154357423-154357445 TGATGCAATTAACAGCAATTTGG - Intronic
1037017625 8:13928256-13928278 TGATCTAATTGGAATAAACTAGG + Intergenic
1038027184 8:23602234-23602256 TAATGCAGTTAGCAAAAACTGGG - Intergenic
1041761524 8:61372280-61372302 TTCTGCAATTTGCATAAAGTAGG + Intronic
1043265324 8:78259825-78259847 TAATACAATTAACATGAACTGGG - Intergenic
1043273919 8:78369570-78369592 TTATGCAATAAGCCTAAAATTGG + Intergenic
1044256299 8:90066845-90066867 TAATGCAATTAGGAAAAACTAGG + Intronic
1045347216 8:101304176-101304198 TGATGGAAATAGCATGTACTTGG - Intergenic
1052173960 9:25434116-25434138 TGAGGTAATTAGCTTAGACTAGG - Intergenic
1055400262 9:75916290-75916312 TCTTGCTATTAGTATAAACTTGG + Intronic
1058091455 9:100810468-100810490 TGATTCAATTGGGAAAAACTTGG + Intergenic
1058552694 9:106132374-106132396 AACTGCAATTAGCATGAACTAGG - Intergenic
1058591103 9:106565867-106565889 TGATCCTACTAGCATAAAGTTGG + Intergenic
1062088361 9:134660522-134660544 TGATGTCATGAGCATGAACTAGG - Intronic
1185885717 X:3780763-3780785 TTATGCAGTTAGCAGAAACTGGG - Intergenic
1188236454 X:27737643-27737665 TAATTCAATTAGCATACATTTGG + Intronic
1189736117 X:44071660-44071682 TGGTGCATTTACCATAAACTTGG - Intergenic
1190237435 X:48627549-48627571 TAATGCAATAAACATAAACATGG + Intergenic
1191804956 X:65125879-65125901 TCCTGAAAGTAGCATAAACTTGG + Intergenic
1193056487 X:77157588-77157610 TGCTGCAATTAACATACACATGG - Intergenic
1194935590 X:99943682-99943704 TGAAGCAACTTGCATAAACTGGG - Intergenic
1196969763 X:121096072-121096094 TGAGGCAACAGGCATAAACTGGG - Intergenic
1197129006 X:122982051-122982073 TAATACAATTACCATAAACTGGG - Intergenic
1197877064 X:131120797-131120819 TGAAGTAATTTGAATAAACTTGG + Intergenic
1199945539 X:152663265-152663287 TGATGCAATTTGCAGCAACCTGG - Intergenic
1201866953 Y:18666433-18666455 GGATACAACTAACATAAACTTGG - Intergenic
1201985870 Y:19964448-19964470 AGTTCCAAGTAGCATAAACTTGG + Intergenic