ID: 965910788

View in Genome Browser
Species Human (GRCh38)
Location 3:173772788-173772810
Sequence CAGTGAATACAGAAAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 475}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965910788_965910790 3 Left 965910788 3:173772788-173772810 CCATCCTTTTTCTGTATTCACTG 0: 1
1: 0
2: 5
3: 50
4: 475
Right 965910790 3:173772814-173772836 GTATTATTTTGTTCTTTCCTAGG 0: 1
1: 0
2: 2
3: 58
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965910788 Original CRISPR CAGTGAATACAGAAAAAGGA TGG (reversed) Intronic
900370911 1:2331767-2331789 CAGTGGTTACATAAGAAGGACGG - Intronic
900738650 1:4316871-4316893 TAGAGAACACAGAAAATGGAGGG + Intergenic
901525114 1:9816555-9816577 GAGTGGATGCAGAAAAAGGTGGG + Intronic
904193542 1:28766415-28766437 CAGTGAAGACAGACTTAGGAGGG - Intronic
904639390 1:31912500-31912522 AGGTGAATACAGAAAGAGAAAGG - Intronic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
907710449 1:56875933-56875955 CAGTGAGAACAGAAAGAGAATGG + Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
909144654 1:71914872-71914894 CAGTGATTACAGACAAATGATGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
912507911 1:110168950-110168972 CAGAGAAGATAGAAAAAGGAAGG - Intronic
915656690 1:157366612-157366634 CAGTGGGTCCTGAAAAAGGAAGG + Intergenic
915902931 1:159859023-159859045 CAGTGCTTTCATAAAAAGGAGGG + Intronic
917209469 1:172616675-172616697 CTGTCCATCCAGAAAAAGGAAGG - Intergenic
918809748 1:189100872-189100894 GACTAAATACAAAAAAAGGAAGG + Intergenic
919237750 1:194868216-194868238 CAGAGAAAAAAAAAAAAGGAAGG + Intergenic
919446868 1:197716941-197716963 CAGAGTATACAGAAAAAAAATGG - Intronic
919481234 1:198092273-198092295 CAATGAAGCCAGAAAAGGGAAGG + Intergenic
920405184 1:205703791-205703813 CAGTGGATTCCTAAAAAGGAGGG - Intergenic
921332366 1:214052059-214052081 CAATGAATAGAGAAAAGGAAAGG + Intergenic
923676400 1:236084257-236084279 CAATGCAAACAGATAAAGGAAGG + Intergenic
1063490806 10:6462028-6462050 CAGTGAAAATGGGAAAAGGAAGG + Intronic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065958482 10:30714116-30714138 TAGTGAATACACAGAGAGGATGG - Intergenic
1066231967 10:33443479-33443501 CAGTAAAAACAGAAAAGAGAGGG - Intergenic
1067366322 10:45632367-45632389 AAGTGAATAAATAAAAAGGATGG + Intronic
1067907065 10:50303509-50303531 AAAGGAAGACAGAAAAAGGAAGG + Intergenic
1068075744 10:52250942-52250964 CAGTGGGTACACAAAAATGAAGG + Intronic
1068397293 10:56480189-56480211 CAGTGAATACAGAAACCCCAAGG + Intergenic
1068718177 10:60211344-60211366 AGGTGATCACAGAAAAAGGAAGG + Intronic
1069457404 10:68563612-68563634 GGGGGAATCCAGAAAAAGGACGG + Intronic
1070024015 10:72614291-72614313 CAGGCACTACAGAAAAAGTATGG + Intronic
1070223510 10:74475800-74475822 AAGAGAAGAGAGAAAAAGGAGGG + Intronic
1070518083 10:77226420-77226442 CAGTGAAGACAGAAAGAGACAGG - Intronic
1071098667 10:82010075-82010097 CAGTGAATAATTAAAAATGAGGG + Intronic
1072182253 10:92997323-92997345 CTCAGAATACAGAAACAGGAAGG + Intronic
1072211041 10:93247319-93247341 AAGGGAGTACAGGAAAAGGAGGG - Intergenic
1072400876 10:95098461-95098483 CAGGGATTTCAGATAAAGGATGG - Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072850104 10:98881112-98881134 CAGAGACTATAGAGAAAGGAGGG - Intronic
1072957152 10:99897334-99897356 CAGTGAAGACAGGACAAGAAAGG + Intronic
1073119672 10:101113886-101113908 AATTGAAGAAAGAAAAAGGAAGG + Intronic
1074711342 10:116180466-116180488 CAGTTACTAAATAAAAAGGATGG + Intronic
1077612723 11:3654038-3654060 CAGTGAGTACAGACAGAGGTAGG - Intronic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1078170407 11:8925189-8925211 TAGTGAAGAAAGAAAAAGGCAGG + Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078917046 11:15788087-15788109 CAGTGAAGACAGAAAAAGTAAGG + Intergenic
1079923555 11:26462481-26462503 CAGAGAACACTGAAAAATGATGG - Intronic
1079962162 11:26937998-26938020 AAAAGAAGACAGAAAAAGGAGGG - Intergenic
1080050200 11:27851808-27851830 AAGGGAAGAAAGAAAAAGGAAGG - Intergenic
1080082082 11:28233751-28233773 CAGTGAATATAGACAACTGATGG - Intronic
1080187889 11:29512482-29512504 CAGAAAATACAGTAAAATGAAGG - Intergenic
1080301996 11:30794842-30794864 TAATGAATAGAGGAAAAGGATGG - Intergenic
1080603891 11:33847822-33847844 CAGTGATTAAAGAGAAAAGATGG - Intergenic
1081193679 11:40135449-40135471 AAGTGAATACAGAAAAATACAGG - Intronic
1082173781 11:49037951-49037973 AAGTGAATACAGCAAAAGATAGG - Exonic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1085414254 11:76309891-76309913 CATTGGCTACAGAACAAGGAAGG - Intergenic
1085740801 11:79076749-79076771 CACTGAAGACAGGAAAAGAAAGG + Intronic
1085965509 11:81518314-81518336 CTGGGAATACAGGAAAAGGAAGG + Intergenic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086141236 11:83502836-83502858 CAATGGAAACAGAAAAAGAATGG - Intronic
1086691986 11:89798134-89798156 AAGTGAATACAGCAAAAGATAGG + Exonic
1086713814 11:90041524-90041546 AAGTGAATACAGCAAAAGATAGG - Exonic
1086872067 11:92049667-92049689 CAGTGATTATTGAACAAGGATGG + Intergenic
1088565888 11:111172575-111172597 CAGTACATCCAGAAAAAGAAAGG - Intergenic
1089168434 11:116495672-116495694 CAGCAAATACAGAGAAAGGTAGG - Intergenic
1091322139 11:134659069-134659091 CAGTGAAGAAAAAAAAAGGCAGG + Intergenic
1091438094 12:489344-489366 CACAAAATACAGAAAAAGAAAGG + Intronic
1092650154 12:10626031-10626053 CTGTGATTACTAAAAAAGGATGG + Intronic
1093847439 12:23990087-23990109 GAGTGAAGATATAAAAAGGAAGG + Intergenic
1093896672 12:24582605-24582627 CAGTAAATGCAGGAAAAGAAGGG + Intergenic
1095257907 12:40061944-40061966 CAGTATATACAGAAAAAGAAAGG + Intronic
1095366492 12:41412565-41412587 CAGTAAACAAACAAAAAGGACGG + Intronic
1095374692 12:41512554-41512576 GGGTGAATTCAGAGAAAGGAGGG + Intronic
1095900400 12:47321860-47321882 GAGTGAATAAAGAAAATGCATGG + Intergenic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1097665682 12:62474848-62474870 CAGTGAATAAAGAGAGATGAGGG - Intronic
1098931671 12:76423881-76423903 AAGTGAATGCATAATAAGGAAGG - Intronic
1099092602 12:78332256-78332278 GAGTGAATACAAAATAAAGAAGG + Intergenic
1099292922 12:80794167-80794189 CAGTGAATAGACAAAAAACATGG - Exonic
1099746731 12:86714346-86714368 CAGTAAATACATACAAAGCAGGG + Intronic
1099830877 12:87840972-87840994 AAGAGAAAACAGAAAAAGCAAGG - Intergenic
1100640885 12:96481450-96481472 CAGTGAAGACAGAAAACCCAAGG - Intergenic
1100653174 12:96612707-96612729 CATGGAAAACATAAAAAGGAAGG + Intronic
1101304462 12:103513920-103513942 AAGGGAATAGAGAGAAAGGATGG + Intergenic
1101357889 12:103997858-103997880 TACTGAATACAGAGAAAGGCAGG - Intronic
1101543763 12:105690102-105690124 AAATGAAAAAAGAAAAAGGAAGG - Intergenic
1102318725 12:111912411-111912433 CAGAGAAGGCAGATAAAGGATGG - Intergenic
1102442001 12:112970607-112970629 CACTGGATACGGAAAAAAGAAGG + Exonic
1103929203 12:124440274-124440296 CATTGGAAACAGGAAAAGGAGGG + Intronic
1104262845 12:127200547-127200569 AAGTAAATACATAAAAAGAATGG - Intergenic
1104913106 12:132249796-132249818 CTGTGATTACAGAAAAAGGTGGG + Intronic
1105657878 13:22459906-22459928 CACTGAATACAGAAAATGTAAGG - Intergenic
1107146498 13:37066303-37066325 AAGTGAAGACAGAGAAAGGGTGG + Intergenic
1107303095 13:38986687-38986709 GTGTGCATAGAGAAAAAGGAAGG - Intronic
1108107897 13:47032926-47032948 CTGTGAGAACAGAAAAAGGTGGG - Intergenic
1108180178 13:47832888-47832910 CAGTGCATGCAGAAAAGGAAAGG - Intergenic
1108447067 13:50520176-50520198 CAGTGGAAACAGCAAAAAGAGGG + Intronic
1108603897 13:52017899-52017921 CAGTGAAAATAGAATAAAGATGG - Intronic
1109151227 13:58849784-58849806 CCATGAAAACAGAAAAAAGAAGG - Intergenic
1111145202 13:84170071-84170093 CAGGGAATTCAGAAACTGGATGG - Intergenic
1111323215 13:86657713-86657735 CAGTAAAGACAGAAAAGGGAGGG - Intergenic
1111450983 13:88415426-88415448 CAGTTAATACAAAAACAGAAGGG - Intergenic
1111904709 13:94241641-94241663 AAGCTAAAACAGAAAAAGGAGGG + Intronic
1112741219 13:102474763-102474785 CTGTGGATATTGAAAAAGGAAGG - Intergenic
1113098972 13:106696461-106696483 CAATGAATTAAGAAAAAGGAGGG - Intergenic
1113177687 13:107584429-107584451 GAATGAATACAGAAAAATAAGGG - Intronic
1114135591 14:19845349-19845371 CAGTTAATTCAGAAAAAAGGGGG + Intergenic
1114311855 14:21475026-21475048 CATTGAGTTCAGACAAAGGATGG - Intronic
1114928299 14:27433548-27433570 CAGAGAATACAGAAAAAAAAGGG + Intergenic
1115230480 14:31154962-31154984 CAATGAATACAGAAATTGGTGGG + Intronic
1116390420 14:44384384-44384406 CAGTGCAGCCCGAAAAAGGAAGG + Intergenic
1116920920 14:50573219-50573241 CCATGAATATAGAAAAAGTATGG + Intronic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1117464353 14:55977227-55977249 CAGTGGATACATAAACAGCATGG - Intergenic
1118114128 14:62755622-62755644 CATCGAAAAAAGAAAAAGGAAGG + Intronic
1118117051 14:62790576-62790598 CAGTGAAAAAAAAAAAAAGAAGG - Intronic
1118659800 14:67996018-67996040 CTGTGAAAAAAGAAAAAGTAGGG + Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119677422 14:76566306-76566328 CAGTGAAAACAGGGAAGGGAAGG + Intergenic
1120162344 14:81159525-81159547 GTGGGAATACAGAAAAAGTATGG + Intergenic
1120526166 14:85579268-85579290 AAATAAATACATAAAAAGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121497956 14:94410158-94410180 CAGGGAAGACAATAAAAGGAGGG - Intergenic
1122168967 14:99854927-99854949 CCGTAAATACAGACAAATGATGG + Intronic
1122566232 14:102658589-102658611 CATAGCATACAGGAAAAGGATGG - Intronic
1122594586 14:102880768-102880790 CTGTGTATCCATAAAAAGGAAGG + Intronic
1202870809 14_GL000225v1_random:161689-161711 CAGTGAAGAGTGAAATAGGAAGG - Intergenic
1124444872 15:29721680-29721702 AAGAGAAGACAGAAAAATGAGGG + Intronic
1125517183 15:40328194-40328216 CAGTGAAAACTGAAAAAACAAGG - Intergenic
1126196394 15:45936601-45936623 CACTGAATACTGAAGAAAGAAGG + Intergenic
1126394654 15:48201750-48201772 CAATGAATAGAGCATAAGGATGG + Exonic
1126753265 15:51898880-51898902 AAGTGAAAAAAGAAAGAGGAGGG - Intronic
1126785056 15:52171525-52171547 CAGTGAATGCAGAGAAAGGAAGG + Intronic
1127239630 15:57098422-57098444 GAATGAATACATAAAAAAGATGG - Intronic
1127402914 15:58608932-58608954 CAGTGTATACAGAAAACGAAAGG - Intronic
1127407322 15:58664640-58664662 CTATGACTAAAGAAAAAGGAAGG + Intronic
1127803171 15:62494923-62494945 CCGGGAACAGAGAAAAAGGAGGG - Intronic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129855449 15:78821438-78821460 CAGTCCAGACAGAAACAGGAAGG + Intronic
1130348297 15:83068112-83068134 CACTGAAGGGAGAAAAAGGAAGG - Intergenic
1130503957 15:84519459-84519481 GAGGGAATAAAGAAAAAGAAAGG + Intergenic
1130824577 15:87531036-87531058 AAATGAAAACAGAAAAAGAAGGG - Intergenic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1130847701 15:87762603-87762625 CAGTGGATACAGGCACAGGAAGG - Intergenic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131971706 15:97900242-97900264 CAGGGAGTACAGGAAAAAGAGGG - Intergenic
1133839831 16:9397641-9397663 GAGGGAATAGAGAAACAGGAAGG - Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134676364 16:16093417-16093439 CAGTGTATACAGAACATGGAAGG + Intronic
1135258207 16:20958663-20958685 CATGGAATACAGAGAAGGGATGG - Intronic
1138216255 16:55207654-55207676 CAGGGAATACGAATAAAGGAAGG - Intergenic
1138870755 16:60880732-60880754 CAGTGAATACAAACATATGAGGG - Intergenic
1139958786 16:70705953-70705975 CACTGGATACAGATACAGGAAGG + Intronic
1140167428 16:72567429-72567451 AAGTAAAAACAAAAAAAGGATGG + Intergenic
1140901336 16:79370816-79370838 CAGTGAATTATGAAAAGGGAGGG - Intergenic
1140939702 16:79709892-79709914 CAGCCAATGGAGAAAAAGGAAGG - Intergenic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141418671 16:83897660-83897682 CAGAAATTACATAAAAAGGAAGG + Intergenic
1142479501 17:209981-210003 AAGAGAATTCAGAAACAGGAAGG - Intergenic
1143071940 17:4302977-4302999 CAGTGAAAACAGAAAAACACAGG + Intronic
1144621072 17:16818849-16818871 CTGTGAAGACAGAAAAGGGCAGG + Intergenic
1145289462 17:21531776-21531798 CAGTGCATCCAGAAAGAGGAAGG + Exonic
1146112174 17:30099927-30099949 GAGTGAATACAGAAAAAAGAGGG - Intronic
1146981339 17:37164549-37164571 CATTAAAGACAGAGAAAGGAAGG + Intronic
1147729550 17:42589778-42589800 CAGTGAATACAAATGATGGATGG - Intronic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1147873485 17:43604219-43604241 GAGTATATACAGAGAAAGGATGG + Intergenic
1148013220 17:44502864-44502886 CAGTGAAGAAAGAAAAGAGAAGG + Intronic
1148038678 17:44689187-44689209 CAGTGAACACTGTAAACGGATGG + Intronic
1148473781 17:47913406-47913428 CAGTAAGTACAGAAATAAGAGGG - Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149584946 17:57780193-57780215 CCGTGAAAACAGAAAAGAGAAGG + Intergenic
1150129899 17:62663307-62663329 CAGTGAAGAAAAAGAAAGGAAGG - Intronic
1150235957 17:63592902-63592924 AAGAGAAAAGAGAAAAAGGAGGG - Exonic
1150315131 17:64162874-64162896 TGGTGAATGCAGAAAAAGGGAGG - Intronic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1153073821 18:1138839-1138861 CAGACATTACAGAAATAGGAAGG - Intergenic
1153896356 18:9565566-9565588 CAGTGAACACACAAAGAAGAAGG + Intronic
1154459693 18:14568845-14568867 CAGTTAATTCAGAAAAAAGGGGG + Intergenic
1155665453 18:28302653-28302675 AAGTCAATACAGAAAAAATAAGG + Intergenic
1155893194 18:31291752-31291774 AATTGAAAACAGAAAAAGTAGGG - Intergenic
1156584707 18:38419278-38419300 CAGAGAAAATATAAAAAGGAAGG - Intergenic
1156992028 18:43420443-43420465 AGGGGAATAAAGAAAAAGGAAGG - Intergenic
1157778378 18:50416422-50416444 CAGAGAAGTCAGAAAAAGAAGGG - Intergenic
1157990625 18:52491651-52491673 CAATGAAGACAGAAAAATGGAGG + Intronic
1158153873 18:54403558-54403580 AATGGAAAACAGAAAAAGGAAGG - Intergenic
1158625288 18:59066099-59066121 TAGTGAATAAAGATAAAGCAGGG + Intergenic
1158869217 18:61667998-61668020 CATAGAATAAAGAAAAAGAAGGG + Intergenic
1159097906 18:63925705-63925727 TAATGAATACAGAAGAATGATGG + Intronic
1159403990 18:67976581-67976603 CATTGAATTCAGAATCAGGATGG - Intergenic
1159419170 18:68194059-68194081 CAGTGCATACAGTATCAGGAAGG - Intergenic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1160244654 18:77147475-77147497 CCATGAAACCAGAAAAAGGAAGG - Intergenic
1160470633 18:79129508-79129530 AAATGAAGAGAGAAAAAGGAGGG - Intronic
1161603631 19:5201797-5201819 CAGTGAAGAGAGAAAAAGATGGG - Intronic
1161918769 19:7250552-7250574 GAGGAAATAAAGAAAAAGGAAGG + Intronic
1162277524 19:9668462-9668484 TAGAGAATACAGAAAAAAAATGG + Intronic
1162580984 19:11530154-11530176 CAGTAAATAAATAAATAGGAAGG + Intergenic
1165800098 19:38544015-38544037 CAGCCAATCCAGAAAGAGGATGG - Intronic
1165986015 19:39769598-39769620 CAGGAAATCCAGAAAAAGGGTGG + Intergenic
1167905608 19:52658180-52658202 CAAAGAATAAAGAAAAATGAAGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168356953 19:55706615-55706637 CAGGAAAGAGAGAAAAAGGAGGG + Intronic
925069382 2:954632-954654 CATTTAATACAGAAATAGGAAGG - Intronic
925272822 2:2626384-2626406 CAAAGAATACAAAAAAAGGGAGG - Intergenic
925354624 2:3229926-3229948 CAGTGATAAGAAAAAAAGGAAGG - Intronic
925627245 2:5853469-5853491 CAGTTAATACAGAAAAAAACTGG + Intergenic
926142698 2:10377762-10377784 CAGTGAACACAGAAACATAAAGG + Intronic
926839879 2:17068149-17068171 AAGTAAATAAAGGAAAAGGAAGG - Intergenic
926897439 2:17709711-17709733 CAGAGAATAAAGAAAAAGAAGGG + Intronic
927275346 2:21257771-21257793 AAGGGAGGACAGAAAAAGGAAGG - Intergenic
928043250 2:27899771-27899793 CAGTTAATCCAGAAAAAGCTAGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928477281 2:31641729-31641751 CAATGAACACAGAAAAAGTTTGG + Intergenic
929083341 2:38143473-38143495 CAGTGGACACTGAAAAAGAAAGG - Intergenic
929716113 2:44311596-44311618 CAGTGAAAAGAATAAAAGGATGG + Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930485061 2:52001184-52001206 TTGTGAATAGAGAGAAAGGAAGG - Intergenic
930489419 2:52049547-52049569 CAGTGAATCAATACAAAGGAAGG + Intergenic
930588053 2:53293549-53293571 TACTGAATACAGCAAAAGCAGGG + Intergenic
930945755 2:57073130-57073152 CAGGTAATACAGGAAATGGAGGG - Intergenic
931522313 2:63112274-63112296 CAGGGGTTACAGGAAAAGGAGGG - Intergenic
931613667 2:64132092-64132114 TAGTGGAAAGAGAAAAAGGAGGG - Intronic
931845696 2:66201615-66201637 AGGTGAAGGCAGAAAAAGGAAGG - Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
932591055 2:73067961-73067983 AAGTCAATACACAAAAAGGCTGG + Intronic
933229144 2:79785680-79785702 CACTGAAAATACAAAAAGGAAGG - Intronic
933903245 2:86864164-86864186 CAGTGAATACATAACCAGCATGG + Intergenic
935231179 2:101098056-101098078 CAGAGAAGGCAGAAAAAGAAAGG + Intronic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
935777271 2:106484783-106484805 CAGTGAATACATAACCAGCATGG - Intergenic
935921042 2:108015436-108015458 AAGAGAATACAGTAGAAGGATGG + Intergenic
936898075 2:117451535-117451557 CAGGGAATGGAAAAAAAGGAGGG - Intergenic
936924304 2:117721032-117721054 CAGGAAATACAGAAAACAGAGGG + Intergenic
938632749 2:133186405-133186427 CAGTGAAAACAGAAAACCGCAGG - Intronic
939790164 2:146562400-146562422 AAGTGAAAAGAGAAAAAAGAAGG + Intergenic
940728079 2:157358185-157358207 CAGAGAAGTGAGAAAAAGGATGG + Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
942377562 2:175353070-175353092 CAGTCAAAACAGAACAGGGAGGG - Intergenic
942431791 2:175919789-175919811 CAATCACTATAGAAAAAGGAGGG - Intergenic
942589610 2:177528089-177528111 GAGTGAATATAGAGAAATGAAGG - Intronic
943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG + Intronic
943115348 2:183662732-183662754 TAGTGGGTACAGAAAAAGCAAGG - Intergenic
943752715 2:191526279-191526301 CAGTCATCACAGAAAGAGGAAGG - Intergenic
943807370 2:192138688-192138710 GATTGAAGACAGAACAAGGAAGG + Intronic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944374533 2:199026576-199026598 CCCTGAACACAGAAGAAGGAGGG - Intergenic
944848509 2:203692770-203692792 CAGTGAACCCAAAAAAAGCATGG + Intergenic
945892264 2:215442615-215442637 CACTGAAGCCAGAACAAGGAGGG - Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946110964 2:217416757-217416779 CAGTCACTAAAGAAAAAGTATGG + Intronic
947159238 2:227195130-227195152 CGGTGCATAGAGAAAAATGATGG + Intronic
947510523 2:230748961-230748983 TAGTCTATACAGAAAAAGGCAGG + Intronic
948218416 2:236249761-236249783 AAGTGAATTTAGGAAAAGGAAGG + Intronic
948642002 2:239381282-239381304 TAGTGACTACATAAAAAGAAAGG - Intronic
1169240979 20:3980626-3980648 CAGAGTATACAAAAAAATGATGG + Intronic
1170251886 20:14292517-14292539 CAGGGCATACATAAAAAGAAAGG - Intronic
1170404973 20:16026302-16026324 CAGTGAATACAGTAAAATGGTGG - Intronic
1170480435 20:16760127-16760149 AAGTGAATAGAGAAAAGGGAGGG - Intronic
1172144462 20:32746537-32746559 CAGAAAATACAGAAAAGGAAAGG + Intergenic
1172785981 20:37469297-37469319 CACTCAAGAAAGAAAAAGGAAGG - Intergenic
1173381547 20:42548813-42548835 CAGTCAATAAAGAAGAGGGAAGG + Intronic
1174091035 20:48047789-48047811 CAGTTAATAAGGAAGAAGGAAGG + Intergenic
1174370854 20:50086318-50086340 CACTAAACACAGAAAAAGGAGGG + Intronic
1174729367 20:52900317-52900339 TAGTGAAGACAGAAAGAGGCAGG - Intergenic
1175039198 20:56029863-56029885 CTGTGGATACAGAGAAAAGATGG + Intergenic
1176814432 21:13583987-13584009 CAGTTAATTCAGAAAAAAGGGGG - Intergenic
1177524641 21:22275764-22275786 CAATGAACACAGAAAACTGAAGG + Intergenic
1177923207 21:27180568-27180590 CACTGCAAACAGAAAAGGGAAGG - Intergenic
1178096369 21:29219911-29219933 GAGTGAATACATAAAATGGGTGG + Intronic
1178240104 21:30889480-30889502 CAATGGATACAGAAAATGGAAGG - Intergenic
1179068082 21:38045111-38045133 TAGTAGACACAGAAAAAGGAGGG - Intronic
1181975500 22:26726467-26726489 CAAAGAACACAGACAAAGGAGGG + Intergenic
1182977771 22:34639590-34639612 CAATGAGTACAGAAAAGTGAAGG + Intergenic
1183188358 22:36305519-36305541 CAGTCATTAGAGAAACAGGAAGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1185220213 22:49625687-49625709 CAGAGAAGGCAGAAAAAGAATGG + Intronic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
950869952 3:16219821-16219843 CAGAGAATACAGCAAAGGAATGG + Intronic
951448880 3:22814081-22814103 CAGTGGCAACAGAAACAGGATGG - Intergenic
951589892 3:24253053-24253075 CAGTGAATACAAATAAAGGTGGG + Intronic
952204464 3:31166427-31166449 CAGGGAATGAAGAAAAAGAACGG + Intergenic
952312624 3:32203874-32203896 CAGTGAAACCAGGGAAAGGAAGG - Intergenic
952505317 3:34001987-34002009 CAGTGAACACAGAACTAGGCTGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952836225 3:37604658-37604680 CAGTGAGTAAAGAAAAGAGAAGG - Intronic
953589381 3:44236867-44236889 CACTGAATAAGGAGAAAGGAGGG - Intergenic
954264075 3:49459830-49459852 GAGTGAATAAGGAAAGAGGAGGG - Intergenic
954417739 3:50402153-50402175 CAATCAATACAGAAAGAGGTCGG + Intronic
955010480 3:55009798-55009820 CTGTGAAAACAGAAATAGAATGG - Intronic
955550353 3:60078123-60078145 TAGTGAATGCAAAAAAAGAATGG + Intronic
955929682 3:64044212-64044234 CATAGAATAAAGAACAAGGAAGG - Intergenic
956011233 3:64833777-64833799 CAGTGAATTCAGAAAGGGGAAGG + Intergenic
956300587 3:67768421-67768443 CAGTACTTACAGAAAAAGTATGG - Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
957148526 3:76455973-76455995 CTATGAATACACAAAAAGGCTGG + Intronic
958479320 3:94626647-94626669 GAGTGCAAGCAGAAAAAGGAGGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959979588 3:112500824-112500846 CTGTGAACACAGGAAAAGGAAGG - Intergenic
960423967 3:117483480-117483502 CAGTTAAAACAAAAAAAGGCGGG - Intergenic
960440864 3:117686578-117686600 CAGTAAATACAGAAAGATAAGGG + Intergenic
960484804 3:118238923-118238945 ACGTGAATAAAGAAAAAGGATGG + Intergenic
960874735 3:122285178-122285200 TAGTGAATTCATAAAATGGAAGG + Exonic
960948424 3:122982749-122982771 CACTGAATGGAGAAAAAGCAGGG + Intronic
964136711 3:153352638-153352660 CAGTGAATTCAGAAAAACCTGGG - Intergenic
964580279 3:158226757-158226779 GGGTGGATACAGAAAAGGGAGGG - Intronic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
965550026 3:169954971-169954993 CACTGACTACAGGAACAGGAGGG - Intergenic
965806647 3:172548932-172548954 CAGTGAATACAGAAAAAGTGGGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966010212 3:175066044-175066066 CAGTGAATACAGACACTGAAGGG - Intronic
966523185 3:180894960-180894982 CGGTCAGTACTGAAAAAGGAAGG - Intronic
966827354 3:183976206-183976228 AAGAGAAGAAAGAAAAAGGAAGG - Intronic
967255799 3:187590674-187590696 AAGTGAACAGAAAAAAAGGAAGG - Intergenic
967696902 3:192543242-192543264 CTGTGCTTACAGAAAAGGGAGGG - Intronic
970206011 4:13656129-13656151 CAGTGAAGGAAGAACAAGGAAGG + Intergenic
970363901 4:15338637-15338659 CTGTGAATGCAGAGAAAAGATGG - Intergenic
970820446 4:20205631-20205653 CAGTTAAAACAGAGAAAAGAGGG + Intergenic
971498729 4:27295918-27295940 AAGTGAATAAAGAGAAAAGAGGG + Intergenic
971750442 4:30640281-30640303 CAGAGGATACGGAAAAAGCAAGG - Intergenic
972032436 4:34478180-34478202 AAGTGAAGACGGAAAAAGGCTGG + Intergenic
973884859 4:55310281-55310303 CAGTGAAAAGAGAAAAAAGCAGG + Intergenic
974903349 4:68028478-68028500 CAATGAGTAAAGAAAAAGGGTGG + Intergenic
975307518 4:72866629-72866651 CAGTGGATGCAGCACAAGGAGGG + Intergenic
976499402 4:85770137-85770159 CAAAGAATACAGACCAAGGAAGG + Intronic
976804823 4:89035169-89035191 CACTGGGTACAGAAAAAGGGAGG + Intronic
976819115 4:89184986-89185008 CATTTAAAACAGAAAAAGTAAGG + Intergenic
977796254 4:101168497-101168519 CAGTGAATGTAGATAGAGGAGGG + Intronic
977851451 4:101835095-101835117 AATAGAAGACAGAAAAAGGAAGG - Intronic
978338259 4:107693216-107693238 CTGTGAAAACAGGAACAGGAGGG + Intronic
978695486 4:111571932-111571954 CAGTGGTAACAGAAAAAGAATGG + Intergenic
978735523 4:112079978-112080000 AAGTGAATACATAAGAAAGAAGG - Intergenic
978756388 4:112307571-112307593 AATGGAATACAGAAAAAGGCAGG - Intronic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979606648 4:122645540-122645562 CAGTGATAACAGAGAAAGAAAGG + Intergenic
979815602 4:125099818-125099840 GAGAGAATAAAGAAAATGGAGGG - Intergenic
979844205 4:125488076-125488098 TAGTGAAAAAAGAGAAAGGAAGG + Intronic
980057371 4:128091320-128091342 ATGTGAATAAAGAAAAAGAAAGG - Intronic
980676173 4:136084482-136084504 CAGTTAATACAGAAAATTAAAGG + Intergenic
980719644 4:136678104-136678126 CAGTGAATACACAAATAATAAGG - Intergenic
980817877 4:137972164-137972186 CTGTGCATCCATAAAAAGGAAGG - Intergenic
981128869 4:141135566-141135588 ATGTTAATACAGAAAAATGATGG + Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981255501 4:142656499-142656521 CAGTGAGTCCCGAAAAAGGAAGG - Intronic
981265757 4:142781398-142781420 CCTTAAAGACAGAAAAAGGAGGG + Intronic
981675184 4:147334863-147334885 AAGAGAATACAGCAAAAAGAAGG + Intergenic
983352921 4:166616631-166616653 AAGTAATTACTGAAAAAGGAGGG - Intergenic
983628972 4:169829928-169829950 CAATTAAAAAAGAAAAAGGAGGG + Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984575302 4:181440964-181440986 AAATGAGTACAGAGAAAGGATGG - Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
985052100 4:186001092-186001114 CAGTGCTTACAGAAAGAGGGAGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985647561 5:1092186-1092208 CTGTGTTTACAGTAAAAGGAAGG + Intronic
986006801 5:3675010-3675032 CGGTGACTACAGCAAAAGCATGG - Intergenic
987958206 5:24767864-24767886 CAGTGAATAGCTAAAAAGTAAGG - Intergenic
988229259 5:28452744-28452766 CAGAGAATAAAGGAAAATGAAGG + Intergenic
988294048 5:29331356-29331378 AAGTGAACACAGACAAAAGATGG - Intergenic
988994470 5:36701469-36701491 CAGTGCCTTCAGAAAAGGGAAGG - Intergenic
991069652 5:62462879-62462901 CACTGAAAAAAAAAAAAGGATGG - Intronic
991228646 5:64303483-64303505 CAGTGAATACACAAATAATAAGG + Intronic
991365780 5:65866561-65866583 CAGCCAAAACAGAAACAGGAGGG + Intronic
992197719 5:74356297-74356319 CAGAGAATAAAGAAAAAAGAAGG + Intergenic
992424437 5:76641861-76641883 CAGTGACCACACAAAAAAGAAGG - Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992981597 5:82180313-82180335 TAATGCATACAGAAAAATGAGGG - Intronic
993284271 5:85970369-85970391 CAGTAAAAAAAGATAAAGGAGGG - Intergenic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993628085 5:90250196-90250218 AAGAGACGACAGAAAAAGGAAGG - Intergenic
994084362 5:95742482-95742504 AAGAGAATAGAGAAAATGGATGG - Intronic
994338602 5:98599443-98599465 CACTGAATATTGAAAAATGATGG + Intergenic
995138622 5:108707357-108707379 CAGTGAGGACAGAACAAGAAGGG - Intergenic
995353861 5:111214778-111214800 CTGGGCATACAAAAAAAGGATGG - Intergenic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996352547 5:122561551-122561573 TACTGAGTAAAGAAAAAGGAAGG + Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG + Intergenic
996738052 5:126775682-126775704 CAGTGAATCTATAAAATGGATGG + Intergenic
996778391 5:127157926-127157948 AATGGAAAACAGAAAAAGGAAGG - Intergenic
997805814 5:136916696-136916718 GAGTGAAAACAAAAAAAGGCAGG - Intergenic
998331266 5:141329564-141329586 CAGTGATTAAAAAAAAAAGAAGG + Intergenic
1000329420 5:160195375-160195397 CAGTGAATACACACTAAGAACGG - Intronic
1000437167 5:161226521-161226543 TAGTGAAAAAAGAAAAAAGATGG + Intergenic
1000972150 5:167726441-167726463 AAGTAAATAAATAAAAAGGAAGG - Intronic
1001692716 5:173644710-173644732 CAGTGGAACCAGAAAATGGAGGG - Intergenic
1002213993 5:177616260-177616282 CAGAAAAGACAGAAAAAGAAGGG - Intergenic
1003113578 6:3268409-3268431 CTCTGAATCCATAAAAAGGAAGG - Intronic
1003337354 6:5186347-5186369 CAGTCACTTCAGCAAAAGGATGG + Intronic
1004197632 6:13519300-13519322 CAGTTTATACAGAAAAAGGCAGG - Intergenic
1004241043 6:13922967-13922989 AACTGAATACAGAACAGGGAGGG - Intergenic
1005043672 6:21621726-21621748 CACTGAAGACAGACAAAAGAAGG + Intergenic
1005476908 6:26216919-26216941 CACTGAATAAAGAAAAAGAATGG - Intergenic
1006080782 6:31565022-31565044 CTGTGAAGACAGGAAAAGCATGG + Intergenic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1009666434 6:66687103-66687125 TAATGAATACAGACATAGGAAGG - Intergenic
1010054385 6:71547541-71547563 AAATGAATACATAAAAAAGAAGG + Intergenic
1010451795 6:76012384-76012406 AAGTAAATACAGAAATAGGGTGG - Intronic
1011255223 6:85413919-85413941 AAGAGAATGGAGAAAAAGGAGGG + Intergenic
1011350982 6:86423577-86423599 AAGTGAATACAAAATAAGCAAGG + Intergenic
1011362325 6:86540642-86540664 GAGTGGAAACAGAAAATGGAAGG + Intergenic
1011995214 6:93578124-93578146 CTGTGAAAAGTGAAAAAGGAAGG + Intergenic
1013034372 6:106365948-106365970 CACTGAGTACAGAAAAACTAAGG - Intergenic
1013299873 6:108794963-108794985 ATGTGAAGACAGAGAAAGGAAGG - Intergenic
1013500061 6:110740168-110740190 CAGACAATATAGAAAAAGGCTGG - Intronic
1013520380 6:110927252-110927274 CTGTGATCACAGAAAAAGCAAGG - Intergenic
1013941119 6:115664116-115664138 CACTGAATATACAAAAAGCATGG - Intergenic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1016834769 6:148466163-148466185 CTGTGAATACAGAACATGTAAGG - Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017614679 6:156232284-156232306 CAGTTAAAACAGAAAGAGGCTGG - Intergenic
1018141452 6:160841526-160841548 CAGTGAACCCAGAAAAACGACGG - Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1019268825 7:134538-134560 CAGTGGATACAGAGAAATGTGGG - Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019412649 7:913138-913160 CAGTTAATACAAAAGAAGGCCGG - Intronic
1019838609 7:3416350-3416372 AAGTTAATAAAGAGAAAGGAGGG - Intronic
1020042038 7:5011599-5011621 GAGTAAAAAAAGAAAAAGGAAGG + Intronic
1020169495 7:5833969-5833991 CAGTGAAAACAGGAAGAGAATGG + Intergenic
1020676813 7:11193191-11193213 CAGTGGGTCCTGAAAAAGGAAGG - Intergenic
1021048466 7:15952961-15952983 CAGTCAATATCAAAAAAGGAAGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022658584 7:32344736-32344758 CAGACAATACATAAAAAGGGAGG - Intergenic
1022766797 7:33421929-33421951 CAGAAAATACAGAAAAGGGAAGG + Intronic
1023116061 7:36863962-36863984 GATTGAAGAAAGAAAAAGGAGGG + Intronic
1023140381 7:37096042-37096064 GAGTACATACAGAAAAAGAAAGG - Intronic
1023974148 7:45015451-45015473 CAGTGAATCCAGGAAGGGGAAGG - Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024674523 7:51626237-51626259 CTGTGAATACACCAAGAGGAAGG + Intergenic
1024682009 7:51700382-51700404 CAGAAAAGACAGAAAAAGAATGG + Intergenic
1024882852 7:54109634-54109656 GAATGAAAACAGAAAAATGAGGG - Intergenic
1024950813 7:54858489-54858511 CAGTGCATGAAGACAAAGGAAGG - Intergenic
1025782985 7:64618287-64618309 ACGTGATGACAGAAAAAGGAGGG - Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026454012 7:70555136-70555158 CAGTGGAGACAGAGAAGGGATGG + Intronic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1028967422 7:96817666-96817688 AAGGCAATACAGAAAAAGGAAGG + Intergenic
1029697631 7:102224603-102224625 CTGTGACTACAGACAAAGGCAGG - Intronic
1030061704 7:105627220-105627242 AAATAAATACAGAAAAAGAAAGG - Intronic
1031868017 7:127061207-127061229 CATTGAATTCACAGAAAGGAAGG + Intronic
1031981243 7:128126961-128126983 CAGTTTATACAGAAAAGAGATGG - Intergenic
1032918972 7:136524773-136524795 ATGTAAATACAGAAAAGGGATGG + Intergenic
1033181276 7:139181333-139181355 CAGTTAATTCATAAAAAGAATGG - Intronic
1034935282 7:155195229-155195251 AATTGAAAACAGAAAAAGCAGGG + Intergenic
1035433687 7:158841592-158841614 TAGTGAATAAATAAAAATGATGG + Intergenic
1035937724 8:3861055-3861077 CAGCTGATACTGAAAAAGGAGGG - Intronic
1036274627 8:7339643-7339665 CAGCAAATACAGAAAAGGAAGGG - Intergenic
1036346725 8:7970703-7970725 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1036672493 8:10801209-10801231 AAGTGAATAGAGGAAAGGGATGG + Intronic
1036842051 8:12131457-12131479 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1036863883 8:12377707-12377729 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1037067423 8:14599330-14599352 AAGTGAATACAAAAAAAGCAAGG - Intronic
1037215045 8:16439477-16439499 GAGTGAATACTGAAATAGAAAGG - Intronic
1037501925 8:19494866-19494888 CAGTAAAAACAGAAAATGGGCGG + Intronic
1037597981 8:20370400-20370422 CAGTGAATAGAGATACAGAAAGG - Intergenic
1037705964 8:21315399-21315421 CTTTGAATTCAGAAAAAGGAGGG - Intergenic
1037819652 8:22129536-22129558 CACTGAATGAAGAAAAAGGCTGG + Intronic
1039008531 8:33068187-33068209 AAGTGAAGACAGGCAAAGGAAGG - Intergenic
1039320155 8:36420744-36420766 CAGATAACACAAAAAAAGGAAGG - Intergenic
1039351196 8:36765736-36765758 CAGTTAATACAGCAAATGAAAGG + Intergenic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039978406 8:42386348-42386370 CATTGAAAAAAGATAAAGGAGGG - Intergenic
1039995073 8:42525170-42525192 AAGGAAATACAGAAAAAGGAAGG + Intronic
1040658816 8:49544796-49544818 CAGAGGATACAGATAAAGTAGGG - Intronic
1041054816 8:53973872-53973894 CAGGCAATAAAGAAAAAAGAGGG + Intronic
1041240323 8:55843645-55843667 CTGTGAAGACAGAGAAAAGATGG + Intergenic
1042432969 8:68729246-68729268 CAGTGAATAGAAATACAGGAGGG - Intronic
1043015630 8:74937152-74937174 CAGTGAAAACAGTAATAAGAGGG - Intergenic
1043486229 8:80701663-80701685 CAGTGATTACAGATACAAGAGGG + Intronic
1043745023 8:83864025-83864047 CAATGCATACAGAAAAAGTGTGG + Intergenic
1044522108 8:93210660-93210682 AGGTGAAGACAGAAAAGGGAGGG + Intergenic
1044962936 8:97548662-97548684 AAGTATATACAGAAAAAAGAGGG + Intergenic
1045889843 8:107142734-107142756 AAGTGAATTTAGAAAATGGAAGG - Intergenic
1046233104 8:111383698-111383720 CAGTAGATCCAGAAAAAGCATGG - Intergenic
1046342796 8:112880581-112880603 CATTGAATACAGAAAAACTCTGG + Intronic
1046444048 8:114291937-114291959 CAGTGAATACTGCAAAAAAATGG - Intergenic
1046497343 8:115032593-115032615 AAGTGAAAACAGAAAAACAAAGG - Intergenic
1046785535 8:118262057-118262079 AAGTGAATACAGACAGAGGCAGG + Intronic
1046919627 8:119714548-119714570 CAATGATTACAAAAAAAGGCTGG + Intergenic
1047310462 8:123687578-123687600 CATTGAATGCAAAATAAGGATGG + Intronic
1048388673 8:133938808-133938830 CAGAGAATGCAGAAAAAAAAAGG + Intergenic
1050348185 9:4714489-4714511 CAGTGAATTTAGAAGCAGGAGGG - Intronic
1050510011 9:6384520-6384542 CAGTCAGTCCCGAAAAAGGAGGG + Intergenic
1051543322 9:18245696-18245718 CATTGAAAAAAAAAAAAGGAGGG - Intergenic
1051736173 9:20201272-20201294 CACTGAATACAGAGAAAGGGAGG + Intergenic
1052035801 9:23679441-23679463 CAGTGACTCCAGGAAAAGTAGGG - Intergenic
1052444553 9:28543628-28543650 CACTAAATATAGAAAAAGTAAGG - Intronic
1052467174 9:28843599-28843621 CAGTGAACAGAGAAAGGGGAGGG + Intergenic
1053146212 9:35713844-35713866 AAGAGAAAAAAGAAAAAGGAAGG + Intronic
1054839264 9:69718359-69718381 CAGTGCATACAGGAAATGGCTGG - Exonic
1055168473 9:73225425-73225447 AATTGAAAACAGAAAAAAGAGGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055444036 9:76365186-76365208 CAGAGATTACAGACAAAGGCTGG - Intergenic
1055723311 9:79199771-79199793 CAGAGAAGACAGAGAATGGATGG + Intergenic
1056485910 9:87058081-87058103 GAGTGAATGCAGAAAAAACAGGG + Intergenic
1056628437 9:88273295-88273317 CAGTGAACCAGGAAAAAGGAGGG - Intergenic
1057133527 9:92670694-92670716 CAGTGAATTTAGGAGAAGGAAGG - Intergenic
1057980154 9:99652440-99652462 AATGGAAAACAGAAAAAGGAGGG + Intergenic
1059011231 9:110463567-110463589 GAGAAAATAAAGAAAAAGGAAGG + Intronic
1059311427 9:113391198-113391220 CAATACAAACAGAAAAAGGAAGG - Intronic
1059355317 9:113694726-113694748 CAGGAAAGACAGACAAAGGAAGG + Intergenic
1061191513 9:129085285-129085307 CCTTAAATACAGGAAAAGGAAGG - Exonic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1203733646 Un_GL000216v2:114896-114918 CAGTGAAGAGTGAAATAGGAAGG + Intergenic
1188582650 X:31733999-31734021 CAGTGAATAAAGAACAAAAAAGG - Intronic
1189189043 X:39080908-39080930 CATTGAAAACAGAAAAAGCAGGG - Intergenic
1189732886 X:44040085-44040107 CAGTGCATGCAGTAAAAGGTAGG + Intergenic
1190101606 X:47526422-47526444 AAATGAAGACAGAAGAAGGAAGG - Intergenic
1192062926 X:67848845-67848867 AATGGAATACAGTAAAAGGAGGG + Intergenic
1192329230 X:70161053-70161075 CAGTGAATAGAGCAAAAGCAGGG - Intronic
1192709734 X:73567360-73567382 TTGCGAATACAGAAATAGGAAGG - Intronic
1193202467 X:78708254-78708276 CAGAGAATACAGAAGACGTAAGG - Intergenic
1195119011 X:101730797-101730819 CACTGAAAAAAAAAAAAGGAAGG - Intergenic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195512394 X:105732187-105732209 CAGAGAAGGCAGAAAAAGCATGG - Intronic
1195684186 X:107570746-107570768 CCCTGAAAACAGGAAAAGGATGG - Intronic
1196000248 X:110775800-110775822 CAGAGAAGACAGAAAAAGAAAGG - Intronic
1196634402 X:117985209-117985231 CAGTAAATAAAGGAAAAGAAAGG + Intronic
1197649997 X:129053957-129053979 CAGTGATCACACAGAAAGGATGG + Intergenic
1197984818 X:132256197-132256219 CAGGGACATCAGAAAAAGGAAGG + Intergenic
1198241830 X:134795557-134795579 CAGTGAATAAAAAAGAAGGGTGG - Intronic
1198596875 X:138245794-138245816 AAGAGAATAGAGAAAATGGAAGG - Intergenic
1200895659 Y:8373578-8373600 AAGTGAATACAGAAGAAAGTTGG - Intergenic