ID: 965910801

View in Genome Browser
Species Human (GRCh38)
Location 3:173772896-173772918
Sequence CACCTCGCTTTTGCATCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965910799_965910801 -6 Left 965910799 3:173772879-173772901 CCAGCAGGCTATAATTCCACCTC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG 0: 1
1: 0
2: 1
3: 6
4: 65
965910794_965910801 23 Left 965910794 3:173772850-173772872 CCTCCTAATTGCAGCTTCCTCTC 0: 1
1: 0
2: 2
3: 20
4: 201
Right 965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG 0: 1
1: 0
2: 1
3: 6
4: 65
965910793_965910801 26 Left 965910793 3:173772847-173772869 CCTCCTCCTAATTGCAGCTTCCT 0: 1
1: 0
2: 1
3: 23
4: 289
Right 965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG 0: 1
1: 0
2: 1
3: 6
4: 65
965910795_965910801 20 Left 965910795 3:173772853-173772875 CCTAATTGCAGCTTCCTCTCCTT 0: 1
1: 0
2: 3
3: 35
4: 317
Right 965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG 0: 1
1: 0
2: 1
3: 6
4: 65
965910797_965910801 6 Left 965910797 3:173772867-173772889 CCTCTCCTTCAGCCAGCAGGCTA 0: 1
1: 0
2: 3
3: 28
4: 259
Right 965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG 0: 1
1: 0
2: 1
3: 6
4: 65
965910798_965910801 1 Left 965910798 3:173772872-173772894 CCTTCAGCCAGCAGGCTATAATT 0: 1
1: 1
2: 1
3: 12
4: 125
Right 965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG 0: 1
1: 0
2: 1
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965910801 Original CRISPR CACCTCGCTTTTGCATCCAA AGG Intronic
903818892 1:26085700-26085722 ATCCTCGGTATTGCATCCAAAGG + Intergenic
903845488 1:26277600-26277622 CACCTTTCTTCTCCATCCAATGG + Exonic
905868741 1:41391123-41391145 AACCACTCTTTGGCATCCAAAGG - Intergenic
906230435 1:44158025-44158047 CATCTTGCTTGGGCATCCAAAGG + Intergenic
919454682 1:197807416-197807438 CACCTCACTTTGGCTTCTAATGG + Intergenic
1062982263 10:1735723-1735745 CACCTCCCTTCTGAAACCAAAGG + Intronic
1064682085 10:17820274-17820296 CAGCTTGTTTTTGCATCCTAAGG - Intronic
1066581446 10:36886669-36886691 CAGCTGGCCTCTGCATCCAAAGG - Intergenic
1067976089 10:51026484-51026506 CACCTCACTTTAGAATGCAAGGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069493236 10:68879565-68879587 CCCTTCCTTTTTGCATCCAAAGG + Intronic
1074135358 10:110620743-110620765 CACCTCTCTTTGGTATCTAATGG + Intergenic
1078865102 11:15289837-15289859 CATCTCTCTATTGCATCCACGGG - Intergenic
1080974582 11:37322897-37322919 CACCTCTCGTTTCCATCAAATGG - Intergenic
1086018673 11:82199085-82199107 CCTCTCTCTTTGGCATCCAATGG - Intergenic
1089433169 11:118438404-118438426 CTCCCCCCTTCTGCATCCAATGG - Intronic
1090953947 11:131498160-131498182 CACCAAGCATTTGCTTCCAACGG + Intronic
1093071597 12:14711178-14711200 AACCACGCTTTGGCATCCTAGGG - Intergenic
1101021402 12:100557969-100557991 CACCACGATTCTCCATCCAATGG + Intronic
1103875080 12:124120838-124120860 CACCTCTCTTGTGGATCCGATGG - Intronic
1117355530 14:54920302-54920324 CACCTGGCTTCTGCATCAAGTGG + Intergenic
1118098396 14:62566046-62566068 CACCTCTATATTCCATCCAATGG - Intergenic
1118330557 14:64812426-64812448 CACTCCCCTTTTGCATCCAGGGG - Intronic
1120836258 14:89040794-89040816 CACCTGGGAATTGCATCCAAGGG + Intergenic
1128826454 15:70721930-70721952 CACCTTTCTTTTGCATCTAATGG - Intronic
1133609467 16:7419394-7419416 CACCTCGCTTGTGAATGCAGAGG + Intronic
1137662207 16:50218059-50218081 CACCTTACTTTTGTATGCAACGG + Intronic
1140725870 16:77811606-77811628 CACCTCCCTTTTGCACAAAATGG + Intronic
1141463189 16:84190617-84190639 CACCTACATTTTGCATCAAATGG + Intergenic
1141620195 16:85233190-85233212 CACCTCGCCTTTGCAGGCACAGG - Intergenic
1144424610 17:15130164-15130186 CACCAGGCTTTGGCATCCAATGG + Intergenic
1148911175 17:50944047-50944069 CACCTCCCTTTTCTATCCAAGGG + Intergenic
1151517219 17:74604380-74604402 CACCTCGCTTTTGCCTCCTGGGG - Intergenic
1152737966 17:82006760-82006782 AACCTCTGTTTTCCATCCAAAGG + Intronic
1160447525 18:78939210-78939232 GACCTAGCATTTGCCTCCAATGG - Intergenic
1162700176 19:12509103-12509125 CACCTCCCTTCTGCACCCAGAGG - Intronic
930302285 2:49631712-49631734 CTCCTGACTTTTGAATCCAAAGG - Intergenic
938949503 2:136243932-136243954 TACCTCGGCTTTGCATCCAGCGG + Intergenic
946385926 2:219384492-219384514 CACCTTTCTTTTGCTCCCAAGGG + Intronic
1174221441 20:48958857-48958879 CACCTCGCATTTGGCCCCAAGGG + Intronic
1181235735 22:21446790-21446812 CACCTCGCTTCTCCTTCCATGGG - Exonic
951024419 3:17814745-17814767 CACCTTGCTGCTGCATCCACTGG + Intronic
953083460 3:39643500-39643522 CATCTGCCTTTTGAATCCAATGG - Intergenic
953251172 3:41246866-41246888 GACCTTGCTTATGCATCCGAGGG + Exonic
955401901 3:58598187-58598209 CACCTCTCTTTTCCATCCCCAGG + Intronic
955983834 3:64552914-64552936 CACCTCTCTTTTTCATCTAATGG + Intronic
960846922 3:122012610-122012632 CATCTCAGTTTTGCATACAAAGG - Intronic
965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG + Intronic
967205355 3:187114572-187114594 CACCTCGCTATAGCACCCAAAGG + Intergenic
979728260 4:123991099-123991121 CACTTAACTTTTGTATCCAAGGG + Intergenic
986022514 5:3818118-3818140 CAGTTTGCTTTTGCATACAATGG + Intergenic
986480705 5:8184181-8184203 CACCTAGCTTTTGCCTCCTTAGG + Intergenic
998398382 5:141834542-141834564 CACCTGGCTTTTGCATCCTAGGG - Intergenic
1003058614 6:2844397-2844419 CACCTTGTTGCTGCATCCAAGGG + Intergenic
1004602664 6:17165449-17165471 CAGCTCGCTGTAGAATCCAAAGG + Intergenic
1011187606 6:84696321-84696343 CAACACGATTTTGCCTCCAATGG - Intronic
1016124306 6:140381152-140381174 CACATCGCTTTTGCAATCATAGG + Intergenic
1021364054 7:19753971-19753993 CACCTTCCTTGTGCATCCACAGG + Intronic
1029382199 7:100221543-100221565 CACCTGGCTTCTGCCTCCCAGGG - Intronic
1029402356 7:100353993-100354015 CACCTGGCTTCTGCCTCCCAGGG - Intronic
1031351062 7:120731536-120731558 CTCCTCAGTTTTGCCTCCAAGGG - Intronic
1034820926 7:154215623-154215645 CACCACACTTTTGCATAGAAAGG - Intronic
1050293509 9:4180996-4181018 CACCTTGCTTCAACATCCAAGGG - Intronic
1050811690 9:9756349-9756371 TAGCTCTCTTTTGAATCCAAAGG - Intronic
1052079653 9:24188385-24188407 TACCCCACTTTTGCATCAAAGGG - Intergenic
1055676563 9:78668461-78668483 CACTCCGTTTTTGCTTCCAAGGG - Intergenic
1056290844 9:85142442-85142464 CACCTTGCTTCTGCAACCAGAGG + Intergenic
1062117216 9:134815913-134815935 GAGCTCGCTTTTGCCTCCATAGG + Exonic
1185712466 X:2314912-2314934 TCCCTCGCTTTGGCATCCCAAGG - Intronic
1190435968 X:50425724-50425746 CACCATTCTTTTGCATCCCAAGG - Intronic
1195943054 X:110180849-110180871 CACTTCCCTTCTCCATCCAAGGG + Intronic
1197938948 X:131768514-131768536 CACCTCGGTTTAATATCCAATGG - Intergenic
1200859768 Y:7978157-7978179 CACCTAGGTTTTGCATTCAGTGG + Intergenic