ID: 965913318

View in Genome Browser
Species Human (GRCh38)
Location 3:173810006-173810028
Sequence AGCCAAAGGCTGTCCTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965913315_965913318 19 Left 965913315 3:173809964-173809986 CCTCTCCTTTATTTCTCTTAAAC 0: 1
1: 0
2: 2
3: 49
4: 482
Right 965913318 3:173810006-173810028 AGCCAAAGGCTGTCCTTGATAGG 0: 1
1: 0
2: 1
3: 13
4: 130
965913316_965913318 14 Left 965913316 3:173809969-173809991 CCTTTATTTCTCTTAAACACATT 0: 1
1: 0
2: 6
3: 53
4: 621
Right 965913318 3:173810006-173810028 AGCCAAAGGCTGTCCTTGATAGG 0: 1
1: 0
2: 1
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965913318 Original CRISPR AGCCAAAGGCTGTCCTTGAT AGG Intronic
900696648 1:4016364-4016386 AGCCAAATGTTGGCCTGGATGGG + Intergenic
901661228 1:10799139-10799161 AGACAAAGCCTGCCCTTGAGGGG + Intergenic
903009071 1:20317721-20317743 AGCCAAAGGCTGCCAGGGATGGG + Intronic
904724171 1:32534314-32534336 AAGCAAAGGGAGTCCTTGATAGG - Intronic
905366592 1:37454966-37454988 AGCCAAAGGAAGTCCTTCCTGGG - Intergenic
905772504 1:40647376-40647398 AGGCTAAGTCTGACCTTGATGGG - Intronic
906955145 1:50368158-50368180 ATCCCAAGGCTGTCTTTCATTGG + Intergenic
908265842 1:62378333-62378355 AGACAAGGGCTTTCCTTGGTGGG - Intergenic
913227168 1:116710447-116710469 ACCCAAGGGCTGCCCTTGCTGGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
915732442 1:158063590-158063612 AGCCAAACAGTGTGCTTGATGGG - Intronic
921186973 1:212678595-212678617 AGCCACAGTCTGTGCTTGGTGGG - Intergenic
922781486 1:228256469-228256491 TGCCACAGGCTGTCTTTGGTGGG - Intronic
923015063 1:230120320-230120342 ATCCAAGGGCTGTTCCTGATAGG - Intronic
924077028 1:240350344-240350366 AGGCCAAGGCTTTCCTTAATAGG - Intronic
1063222890 10:3987315-3987337 AGCCAAAGGCTGCCCTGCTTGGG + Intergenic
1065965020 10:30763844-30763866 AGGCAAAGGCTGTCCCTGGATGG - Intergenic
1069441455 10:68432646-68432668 GGCCTCATGCTGTCCTTGATTGG - Intronic
1075224253 10:120611741-120611763 AACCAAAGGCTGGGCTTGCTTGG - Intergenic
1077835760 11:5926420-5926442 ACCCAGAGTCTATCCTTGATGGG - Intronic
1078084922 11:8228230-8228252 AGCCAAGGGCTGGCCTGCATGGG - Intronic
1078173375 11:8948338-8948360 AGCGAAAGTCTGTCTTTGACCGG - Exonic
1080846260 11:36029708-36029730 AGCCAATGGCTGTTATTAATGGG - Intronic
1082096422 11:48134418-48134440 AGACAAAGGCTGCCTTTCATGGG + Intronic
1082215684 11:49565669-49565691 AATCAAAGGCTGTTTTTGATAGG - Intergenic
1083800533 11:65044070-65044092 AGCCAAAGGCTGGCCCTTAGAGG + Intronic
1084725016 11:70935916-70935938 AACCCAAGGCTGTTCATGATGGG - Intronic
1085149211 11:74234923-74234945 TGCCCAAGGTTGGCCTTGATAGG + Intronic
1086633895 11:89058808-89058830 ATTCAAAGGCTGTTCTTGATAGG + Intronic
1090825881 11:130385628-130385650 AGCCAGAGAATGTCCTTGAAGGG - Intergenic
1097536528 12:60877821-60877843 AAACAAAGGCTGCCCTTTATGGG - Intergenic
1097674361 12:62582546-62582568 AGAAAAAGGCTGTCCTTCAATGG - Intronic
1107382193 13:39868706-39868728 AGTCAAAAGCTGTCCTTGGTTGG - Intergenic
1110829793 13:80017992-80018014 ACATAAAGGCTGTCCTTGCTGGG - Intergenic
1112913204 13:104515039-104515061 ATACAAAGGCTGTAATTGATGGG + Intergenic
1116148932 14:41112876-41112898 GGCCAATGGCTGTCTTTCATAGG - Intergenic
1117580641 14:57148294-57148316 AGTCAAAGGCTGTTCTTCAAAGG + Intergenic
1121867281 14:97374305-97374327 AGGCAAAGGCTGTGTTTCATTGG + Intergenic
1122603178 14:102931103-102931125 AGCCAAAGGCCGTGCCTGGTGGG + Exonic
1125439415 15:39686097-39686119 AGCCTATTGCTGTCCTTGATAGG - Intronic
1127393776 15:58527479-58527501 AATCAAAGGCTGGCCCTGATGGG - Intronic
1127733303 15:61819586-61819608 AACCAAAGGCTTTGCTTGCTCGG - Intergenic
1127973528 15:63980527-63980549 AGCCAAAGGCTGACATTTTTGGG - Intronic
1127995498 15:64151428-64151450 AGCCACAGGCCGTCCTTGGTAGG + Intergenic
1128260602 15:66230182-66230204 AGCCAGAGGCTTTCCTTCACTGG - Intronic
1131520610 15:93111513-93111535 AGCCAAAATCTGTCCTTCACTGG + Intergenic
1132108191 15:99080600-99080622 AGACACAGGATGTCCTTGAATGG - Intergenic
1132175476 15:99710817-99710839 AGCAAAAGGCTGTCACTGATAGG - Intronic
1133476579 16:6127646-6127668 AGCCATAAACTGTCCTTGCTGGG - Intronic
1136180025 16:28545033-28545055 AGCCAGATGCTGTCTTTAATGGG + Intergenic
1137701989 16:50503907-50503929 AGGGAAAGGCTGCCCCTGATGGG - Intergenic
1140957184 16:79876513-79876535 AACCACAGACTGTCCTTGCTAGG + Intergenic
1145240748 17:21239967-21239989 AGCCACAGCTTTTCCTTGATGGG + Exonic
1145846199 17:28041519-28041541 AGCCAAACTCTGCCTTTGATTGG + Intergenic
1147110318 17:38256953-38256975 AGGCAAAGGCTGCAGTTGATGGG + Intergenic
1148419192 17:47531478-47531500 AGGCAAAGGCTGTAGTTGATGGG - Exonic
1148733483 17:49851610-49851632 AGCCAAAGTCGGTGCGTGATGGG + Intergenic
1152129527 17:78467491-78467513 AGCCAAAGGCATCCCCTGATAGG - Intronic
1152849180 17:82621820-82621842 AATCAAAGGCAGTTCTTGATTGG - Intronic
1156454685 18:37286391-37286413 AGCCACAGGCTGACCCTTATGGG + Intronic
1157741135 18:50094300-50094322 AGCAAAAGGCTGTACTAGACAGG + Intronic
1161216724 19:3098401-3098423 AGCCGAGGGCTGCCCGTGATAGG - Intronic
1163051286 19:14686027-14686049 AGCCAATGGCTATCCAAGATGGG + Intronic
1164679767 19:30126131-30126153 AGCCACGGGGTGTCCTGGATAGG + Intergenic
1166506028 19:43372372-43372394 ATCCAAAGCCTGCCCTTCATTGG - Intergenic
1167388351 19:49177982-49178004 GGGCTAAGGCTGTCCTTGAGAGG + Intronic
925520994 2:4745875-4745897 AGTCACAGGCTGTCCTTGCCAGG - Intergenic
925655957 2:6149967-6149989 AGCCACAGGCCGTCCTTAAGTGG - Intergenic
927652999 2:24923489-24923511 AGGCACTGGCTGTCCTTGAAGGG + Intergenic
933275106 2:80275968-80275990 TCCCAAAGGATGTCATTGATGGG - Intronic
933773616 2:85758864-85758886 AGGGAAAGGCTGGCCTTGAGGGG + Intronic
934669961 2:96205476-96205498 AGCCAAAGGCTGTGATTTAGGGG + Intronic
936729959 2:115370162-115370184 ACCACAAGGCTGTCTTTGATAGG - Intronic
936856475 2:116964347-116964369 GGCCAAAGGCTGCCATTGATGGG - Intergenic
937009961 2:118553682-118553704 AGCAAAAGACTGTCCATGCTGGG + Intergenic
937840702 2:126521453-126521475 ATTCTAAGGCTTTCCTTGATTGG + Intergenic
939670353 2:145003203-145003225 AGCCAAAGGCTTTTCTTGATGGG + Intergenic
940011889 2:149063038-149063060 ATGCAAAGGCTGTGCTTAATAGG - Intronic
941528751 2:166638158-166638180 AGTCAAGGGCTGTCCTAGAGAGG - Intergenic
942336816 2:174897317-174897339 AGCAGAAGCCTGTCCTTGAACGG + Intronic
947580376 2:231312465-231312487 AGCAAAAGGATGTCCTTGCCAGG + Intronic
1168906219 20:1405907-1405929 CTCCAAAGGCTGTACTTGCTGGG + Intergenic
1174714619 20:52744493-52744515 AGCCTAAGGCTAATCTTGATAGG - Intergenic
1176373128 21:6074406-6074428 AGCCAAAAGCACTGCTTGATGGG + Intergenic
1178772394 21:35517922-35517944 AGACAAAGGCTGACCTTCAGAGG + Intronic
1179510713 21:41871435-41871457 AGCCACAGGCTGTCCCTGTCTGG + Intronic
1179750349 21:43463837-43463859 AGCCAAAAGCACTGCTTGATGGG - Intergenic
1180796294 22:18607388-18607410 AGGAAAAGGCTGCCCTTGAGAGG - Exonic
1181225428 22:21387883-21387905 AGGAAAAGGCTGCCCTTGAGAGG + Exonic
1181253205 22:21546930-21546952 AGGAAAAGGCTGCCCTTGAGAGG - Exonic
1184343974 22:43901693-43901715 AGCTGAAGGCTGTCCTTGGTGGG - Intergenic
951013783 3:17706134-17706156 AGGCAAAGGCTGCAGTTGATGGG + Intronic
951743144 3:25946126-25946148 AGAGACAGGCTGTTCTTGATGGG + Intergenic
955228837 3:57081584-57081606 ACCCAAAGACAGTCCTTTATGGG + Intergenic
955340477 3:58121495-58121517 AAGCAAAGGCTGACCTTGCTGGG - Exonic
958169634 3:89922566-89922588 TTCCAAAGGCTGTTCTTGCTAGG + Intergenic
960054574 3:113268034-113268056 AGCCAGAGGCACCCCTTGATGGG + Intronic
960428265 3:117536056-117536078 AGGCAAAGGCTGTCCCAGAAAGG - Intergenic
960790930 3:121430155-121430177 TTCCAAAGGCTGTCTGTGATTGG - Intergenic
964455966 3:156866608-156866630 AGCCAAATGCAATCCCTGATAGG + Intronic
965913318 3:173810006-173810028 AGCCAAAGGCTGTCCTTGATAGG + Intronic
967357126 3:188584057-188584079 GGCCAAACGCTGTACTTGATTGG - Intronic
971929616 4:33063388-33063410 ATCCAAAGGCTCTTCGTGATAGG + Intergenic
975278156 4:72526998-72527020 AGCAAAGGTCTGTCCTTTATAGG - Intronic
977249248 4:94671025-94671047 AGCCCCAGGCTGTCCTTTAGAGG - Intergenic
978230054 4:106386633-106386655 ATTCAAAGGCTGACCTTTATGGG - Intergenic
978516603 4:109575258-109575280 AGCCAAAGCTTTTCCTTGGTGGG - Intronic
979278773 4:118841274-118841296 AGCCAAAGACTGCACTTGGTGGG + Intergenic
979348612 4:119619874-119619896 AGCCTAAGGCTGTCCTATCTAGG + Intronic
980951711 4:139385627-139385649 AGCCAAAATCTGACCTTTATGGG + Intronic
983263418 4:165482252-165482274 AGACCAAGGCTGTCATTCATTGG + Exonic
984754397 4:183312478-183312500 ACCCAAAAGCTGTCCTGGATGGG - Intronic
988870262 5:35381922-35381944 AACCAAAGTTTGTCTTTGATAGG - Intergenic
992721521 5:79565942-79565964 AGCCTATGCCTGTTCTTGATAGG + Intergenic
998766700 5:145496542-145496564 AGGCAAAGCTTGTCCTTGACTGG - Intronic
999372119 5:151062272-151062294 TGTCAAGGGCTGTCCTTGAGAGG - Intronic
1006799266 6:36749335-36749357 AGCCATAGGCTGTGATTGGTGGG - Intronic
1008161741 6:48085677-48085699 AGCAAAAGGATTTCCTTGCTTGG + Intergenic
1014621882 6:123677180-123677202 AGCAAATGGCTGTCTTTGGTGGG - Intergenic
1015027897 6:128559003-128559025 AGCAGAAGGCTGGTCTTGATTGG - Intergenic
1021652290 7:22844054-22844076 AGCCAAATGCAATCCTTAATTGG + Intergenic
1022447068 7:30479100-30479122 AGCCAAAGCCTGGACATGATAGG + Intergenic
1025778860 7:64581862-64581884 AGACAAAGGCTTTCTTTCATAGG + Intergenic
1026307691 7:69155986-69156008 AGCCTATGGCTGTGCTAGATGGG - Intergenic
1027452259 7:78345708-78345730 AGCCACAGGCAGTACTTTATAGG - Intronic
1027671979 7:81112080-81112102 AGCCAAAGGCTGTATTTAATAGG - Intergenic
1029147790 7:98458927-98458949 GGCGAAAGGCTGTCCCCGATGGG + Intergenic
1029973257 7:104810208-104810230 AGCCAGAGGCTAGCCGTGATGGG + Intronic
1031560836 7:123236033-123236055 CCTCAAAGGCTGTCCTTGTTTGG - Intergenic
1032067457 7:128782394-128782416 AGCCTAAGGGTGGCCTAGATTGG - Intergenic
1033272917 7:139948799-139948821 AAACAAAAGCTGTCTTTGATGGG - Intronic
1034516127 7:151581372-151581394 AGAGAAAGGCAGTCCTTGATAGG - Intronic
1035743765 8:1947111-1947133 AGGAATAGGCTGTCCTTGTTGGG + Intronic
1036568751 8:9961099-9961121 AGTCAGAGGCTGTCTTTGAGCGG - Intergenic
1038673670 8:29603472-29603494 ACCCAAAGGCTGGCATTGGTTGG + Intergenic
1038738853 8:30198818-30198840 AAGCAAAGGCTGACATTGATTGG + Intergenic
1040331010 8:46385754-46385776 CCCCAAAGGCTGTCCTGGGTGGG + Intergenic
1045987696 8:108268046-108268068 AGCTAGAGGCTGTTCTAGATGGG - Intronic
1046625563 8:116573209-116573231 AGCCATATGCTGGTCTTGATCGG + Intergenic
1047778124 8:128090443-128090465 AGTTAAAGGCTGACTTTGATGGG + Intergenic
1051212444 9:14758805-14758827 AGCCATAGGTTGTGCTTCATGGG + Intronic
1055845833 9:80562350-80562372 AATCTAAGGCTGTCCTTGACAGG + Intergenic
1062213403 9:135376632-135376654 AGCCAAAGGCAGTTCTGGAGAGG + Intergenic
1189675120 X:43453407-43453429 AGCCAAAGGCTGAGCATGGTTGG - Intergenic
1201190348 Y:11438653-11438675 AGCCAAAGGCTGGCCCTGGTTGG + Intergenic