ID: 965920789

View in Genome Browser
Species Human (GRCh38)
Location 3:173910382-173910404
Sequence ACTGATATCCAGTCTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965920789 Original CRISPR ACTGATATCCAGTCTGTTGT AGG (reversed) Intronic
900716111 1:4145448-4145470 ACTGACATGCTGTCTGTGGTTGG + Intergenic
902751783 1:18519817-18519839 AATTATATCCAGCCTGTTGGGGG - Intergenic
906585473 1:46973106-46973128 TTTGATATCTAGTCTGTTGAGGG + Intergenic
910477877 1:87626256-87626278 ACTGATGCAAAGTCTGTTGTGGG - Intergenic
1063072857 10:2684128-2684150 AATGAGATCCTGTCTTTTGTGGG - Intergenic
1065432149 10:25670310-25670332 ACTGATATTCAGTTTGTTATTGG - Intergenic
1066548292 10:36525519-36525541 AATGATAACCAGTATGTTGGAGG - Intergenic
1072355518 10:94605942-94605964 TTTGATTTCCAGTCTGTTGAAGG + Intronic
1072883932 10:99256870-99256892 GGTGATACCCTGTCTGTTGTGGG + Intergenic
1073027633 10:100499656-100499678 ACAGATACCCAGCTTGTTGTAGG - Intronic
1073934058 10:108609446-108609468 AATGATATCATGTCTTTTGTGGG + Intergenic
1078849942 11:15154652-15154674 ACTGATATTCTGTGTGTTCTTGG + Intronic
1081010371 11:37803832-37803854 ACTGATATCCAGTTTGTTGTAGG + Intergenic
1081425529 11:42922207-42922229 AATGAGATCCTGTCTTTTGTGGG - Intergenic
1082750810 11:57014622-57014644 ACTGATATCCTGTTTGCTGATGG + Intergenic
1085493181 11:76941207-76941229 ACTGATATGCACTTAGTTGTTGG + Intronic
1088589393 11:111390280-111390302 ACTGTCATCCAGTCTGTATTTGG + Intronic
1091674295 12:2477574-2477596 CCTCATCTCCAGTCTGTAGTTGG + Intronic
1094506519 12:31066406-31066428 TCCTATATGCAGTCTGTTGTTGG + Intergenic
1095613975 12:44167014-44167036 AAGGATTTCCAGTCTCTTGTGGG + Intronic
1097242550 12:57585584-57585606 CCTGATATCCAGTCTTTTCTAGG + Exonic
1101003882 12:100382988-100383010 AAGGATATCCTGTCTTTTGTGGG + Intronic
1103833706 12:123801581-123801603 ACTGATCTCCAGGCTGTCGTTGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105704093 13:22958525-22958547 ACTTATATTTTGTCTGTTGTAGG - Intergenic
1107167027 13:37294634-37294656 AGTGATTTCCCGTCTGTTTTGGG + Intergenic
1108133536 13:47330187-47330209 GTTGATATCCACTCTGTGGTTGG + Intergenic
1108627860 13:52249191-52249213 TCTGATTTCCATTCTGTTATTGG - Intergenic
1108631971 13:52293230-52293252 AATGAGATCCTGTCTTTTGTGGG + Intergenic
1108654727 13:52519364-52519386 AATGAGATCCTGTCTTTTGTGGG - Intergenic
1108658198 13:52557262-52557284 TCTGATTTCCATTCTGTTATTGG + Intergenic
1108926402 13:55751881-55751903 TGAGAGATCCAGTCTGTTGTTGG - Intergenic
1109167586 13:59055342-59055364 AATGATATCATGTCTTTTGTGGG + Intergenic
1110069348 13:71153815-71153837 AATGAGATCCTGTCTTTTGTGGG - Intergenic
1110488937 13:76079794-76079816 TCTATTATCCAGTCTGTTATTGG - Intergenic
1113282417 13:108803602-108803624 ACACATATCCAGTGTGATGTAGG - Intronic
1116178523 14:41505847-41505869 ACTGATATCCAGTCTAATTTTGG + Intergenic
1116946488 14:50840209-50840231 AGTGATATCCTGCCTGCTGTAGG + Intergenic
1124087744 15:26567629-26567651 ACTGATAACGATTCTGTCGTGGG - Exonic
1126551669 15:49937943-49937965 AATGAAATCCAGTCTATTTTGGG + Intronic
1130193597 15:81759204-81759226 ACAGAAATGCAGTCTGATGTTGG + Intergenic
1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG + Intergenic
1132131687 15:99286780-99286802 AATGATATTTAATCTGTTGTTGG + Intronic
1134072613 16:11270018-11270040 ACTGATGTCCAGTCTTGGGTAGG + Intronic
1134457116 16:14402887-14402909 ACTGTTATCCTGTTTGTCGTAGG - Intergenic
1135198759 16:20418560-20418582 ACTGGTATTCATTCTGTCGTGGG - Intronic
1140788804 16:78369638-78369660 ACTGTTATCCATCCTATTGTGGG + Intronic
1140894178 16:79310650-79310672 ACTGAGATCCCTTCTTTTGTTGG + Intergenic
1146829001 17:36050617-36050639 AATCATATCCAGTATTTTGTTGG + Intergenic
1149168863 17:53785606-53785628 TCTGTTTTCCAGTCTGATGTGGG - Intergenic
1159801072 18:72899787-72899809 GCTGAGATCCAGTGTGATGTGGG - Intergenic
1166876173 19:45898875-45898897 CCTGGTATACAGTCTGTTTTGGG + Intronic
933437472 2:82266489-82266511 TCTGATACCCTGTGTGTTGTAGG - Intergenic
933916968 2:87005220-87005242 ACTGAAATACAATCTGTGGTGGG - Intronic
934006027 2:87764694-87764716 ACTGAAATACAATCTGTGGTGGG + Intronic
935505822 2:103901292-103901314 GCTAATATCCTTTCTGTTGTCGG + Intergenic
935768982 2:106398796-106398818 ACTGAAATACAATCTGTGGTGGG + Intronic
935911116 2:107897129-107897151 ACTGAAATACAATCTGTGGTGGG - Intergenic
935969233 2:108513963-108513985 ACTGAAATACAATCTGTGGTGGG - Intergenic
937005109 2:118504499-118504521 ACTGATGTCCAGCATGTAGTAGG + Intergenic
945003542 2:205377602-205377624 ACTGGTCTCCAGTCCCTTGTGGG - Intronic
946982794 2:225236271-225236293 ACTGATATCCCTCCTGTCGTGGG - Intergenic
947357585 2:229312949-229312971 ACTGATCTCTAGTCTCTTTTTGG - Intergenic
948996850 2:241585161-241585183 ACTGATGTCCAGTGTGTTCTTGG + Intronic
1171202459 20:23253112-23253134 ACTGATGTCCAGTCGGTATTTGG + Intergenic
951391813 3:22114326-22114348 ACTGATAAACAGTCTGTATTTGG + Intronic
952121924 3:30255551-30255573 AATGAGATCCTGTCTTTTGTGGG + Intergenic
955702472 3:61695540-61695562 TCTGATATCCAGTCCCTTGCAGG + Intronic
955867441 3:63399961-63399983 ACTGAACAACAGTCTGTTGTAGG - Intronic
957405505 3:79770633-79770655 ACTGATATCCATTATGTCCTTGG + Intergenic
957894921 3:86409936-86409958 AGTTACTTCCAGTCTGTTGTCGG + Intergenic
958733350 3:97981863-97981885 ATTGATATTTAGTTTGTTGTAGG - Intergenic
965675159 3:171186967-171186989 ACTGAAAACAAGTCAGTTGTAGG + Intronic
965920789 3:173910382-173910404 ACTGATATCCAGTCTGTTGTAGG - Intronic
966429798 3:179819467-179819489 ACTGGTATCACTTCTGTTGTTGG + Intronic
967166404 3:186783636-186783658 ACAGGTATGCAGTCTGTTGGCGG + Exonic
967497917 3:190162662-190162684 AGTGATATCCAATCTGTTTTTGG + Intergenic
967862268 3:194161010-194161032 ACTGATTTACAGTCTTTTGAGGG + Intergenic
967968106 3:194978431-194978453 TCTGATAGCCATTCTTTTGTAGG - Intergenic
968116763 3:196096372-196096394 ACTGATACCCAGGCTGCTGCTGG + Intergenic
968155008 3:196373581-196373603 AATGATGTCCAGTATGTTCTTGG - Intronic
972345519 4:38189185-38189207 ACTGATAGCCAATCAGATGTAGG - Intergenic
982735438 4:159001658-159001680 AGTGAGATCCTGTCTTTTGTGGG - Intronic
982985915 4:162205264-162205286 ACTGATATCCAGTGATTTCTAGG - Intergenic
988222694 5:28369392-28369414 ACTGGTATCCTGACTGTTGCGGG - Intergenic
988548713 5:32181099-32181121 ACTGAGATCCAGTCTGTACCTGG + Intergenic
989782383 5:45283970-45283992 AATGAGATCCTGTCTTTTGTGGG + Intronic
990845800 5:60137122-60137144 AATGAGATCCTGTCTTTTGTGGG - Intronic
995000724 5:107124742-107124764 AGTGATATCTAGCCTGTTTTTGG - Intergenic
995653892 5:114402786-114402808 CCTGATATCCAGGCTGCTGCAGG - Intronic
997793010 5:136779477-136779499 ATTGGTATCCAGATTGTTGTTGG - Intergenic
999060112 5:148624706-148624728 AGTGAAATTCAGTGTGTTGTGGG + Intronic
1000616262 5:163431043-163431065 ACTGGGATCCAGACTGTAGTCGG + Intergenic
1000839140 5:166194972-166194994 TCAGAGTTCCAGTCTGTTGTAGG + Intergenic
1001477531 5:172061185-172061207 ACAGATCTCCCGCCTGTTGTCGG + Exonic
1001660552 5:173389259-173389281 ACCAATATGCAGTCTGTTGGAGG + Intergenic
1001937282 5:175714473-175714495 ACTCATTTCCAGTCAGTTGGGGG - Intergenic
1002025042 5:176391090-176391112 ACTGAGATCTAGACTGTTGGGGG - Intronic
1008023628 6:46608912-46608934 ACTGTTATAAAGCCTGTTGTAGG - Intronic
1027926489 7:84471225-84471247 ACTGATATAAACTATGTTGTTGG + Intronic
1030202105 7:106916283-106916305 ACTGATGCCCACTCTGTTCTAGG + Intergenic
1031660838 7:124422190-124422212 TCTGATTTACAGTTTGTTGTTGG - Intergenic
1032983207 7:137308726-137308748 ACTGAGAGCCAGTGTGCTGTGGG - Intronic
1033613246 7:142986065-142986087 ACTGCTATCCATTCTGCTTTTGG + Intergenic
1034949610 7:155288089-155288111 CCTGATCTCCAGTCTGTGGCTGG + Intergenic
1038590242 8:28831138-28831160 AATGAGATCATGTCTGTTGTAGG + Intronic
1038949375 8:32397765-32397787 AGTGATACCCAGTCTATTGCAGG + Intronic
1042290531 8:67166400-67166422 ACTGTAATCCAGTATGTGGTAGG + Intronic
1043232915 8:77825031-77825053 AGGTATATTCAGTCTGTTGTGGG - Intergenic
1043987010 8:86705631-86705653 TCTGATATCCAGCCTGTCTTTGG - Intronic
1045127689 8:99111587-99111609 ACTGATATGCAGTCCACTGTGGG - Intronic
1045613320 8:103874435-103874457 ACTGTAATGAAGTCTGTTGTTGG - Intronic
1048570604 8:135652110-135652132 ATTGATATTCAGTGTTTTGTAGG + Intronic
1050809110 9:9720821-9720843 AATGATATCATGTCTTTTGTTGG + Intronic
1051409511 9:16774857-16774879 ACAGATATACAGTCTTTTGTGGG - Intronic
1052224667 9:26071132-26071154 ACTGATTCCCAGTGTGATGTGGG + Intergenic
1052481883 9:29039913-29039935 ACTGATATCTAGGCTGCTTTTGG + Intergenic
1052579472 9:30336322-30336344 ATTGATTTCCAGAGTGTTGTTGG - Intergenic
1055040509 9:71865895-71865917 TCTGATAGCCAGTCTGTTAGTGG + Intronic
1055160155 9:73116894-73116916 AGTAAGATCAAGTCTGTTGTTGG + Intergenic
1057852667 9:98577334-98577356 ACATATATACAGTCTATTGTAGG - Intronic
1057973520 9:99579894-99579916 AATGAGATCCAACCTGTTGTAGG + Intergenic
1189385283 X:40531886-40531908 AATTATATCCATTCTGTTGATGG - Intergenic
1191189409 X:57650699-57650721 GTGGATCTCCAGTCTGTTGTGGG - Intergenic
1193283453 X:79683727-79683749 AATGAAATCCAGGCTGATGTGGG + Intergenic
1193420502 X:81277596-81277618 GCTAATATCTAGTCTATTGTAGG + Intronic
1198076597 X:133199211-133199233 AATGATATCATGTCTATTGTGGG - Intergenic
1198853587 X:140992322-140992344 ACTAAAATTCAGACTGTTGTTGG + Intergenic