ID: 965921756

View in Genome Browser
Species Human (GRCh38)
Location 3:173925554-173925576
Sequence GCTCCCAGGTTAGCAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965921756_965921764 24 Left 965921756 3:173925554-173925576 CCACTTTCTGCTAACCTGGGAGC 0: 1
1: 0
2: 3
3: 13
4: 150
Right 965921764 3:173925601-173925623 GGTGTGGAACCAGGACAGAAAGG 0: 1
1: 0
2: 0
3: 24
4: 254
965921756_965921760 3 Left 965921756 3:173925554-173925576 CCACTTTCTGCTAACCTGGGAGC 0: 1
1: 0
2: 3
3: 13
4: 150
Right 965921760 3:173925580-173925602 AAGAATACAATCCAATTGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 254
965921756_965921759 2 Left 965921756 3:173925554-173925576 CCACTTTCTGCTAACCTGGGAGC 0: 1
1: 0
2: 3
3: 13
4: 150
Right 965921759 3:173925579-173925601 GAAGAATACAATCCAATTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 137
965921756_965921761 8 Left 965921756 3:173925554-173925576 CCACTTTCTGCTAACCTGGGAGC 0: 1
1: 0
2: 3
3: 13
4: 150
Right 965921761 3:173925585-173925607 TACAATCCAATTGCTGGGTGTGG 0: 1
1: 0
2: 0
3: 18
4: 518
965921756_965921763 15 Left 965921756 3:173925554-173925576 CCACTTTCTGCTAACCTGGGAGC 0: 1
1: 0
2: 3
3: 13
4: 150
Right 965921763 3:173925592-173925614 CAATTGCTGGGTGTGGAACCAGG 0: 1
1: 0
2: 1
3: 8
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965921756 Original CRISPR GCTCCCAGGTTAGCAGAAAG TGG (reversed) Intronic
901617370 1:10552533-10552555 GTTCCCAGTTTAGCACATAGAGG + Intronic
902665166 1:17932508-17932530 CCTCCTAGGTCAGCAGAAATTGG - Intergenic
902715974 1:18272934-18272956 GCTCCCACCTGAGCATAAAGTGG - Intronic
902842507 1:19084217-19084239 GCTCACAGGGGAGCAGGAAGTGG - Intronic
903034836 1:20486608-20486630 GCTCCCCGGTTTGCAGATGGCGG - Intergenic
905953832 1:41975433-41975455 GCTCCTATGGTAGCAGATAGTGG + Intronic
914672739 1:149883985-149884007 GCTCCTAGGTTAGCAGTTAAGGG - Intronic
915231469 1:154448792-154448814 GCTCACAGTTTAGCAGGATGTGG - Intronic
915586927 1:156848979-156849001 GCTCCCAGCGTAGCAGGATGCGG + Exonic
916503111 1:165403909-165403931 ACCCACAGGTTAGCAGCAAGGGG + Intronic
918055738 1:181020514-181020536 GATCCCAGGACAGCTGAAAGAGG + Intronic
918126463 1:181588385-181588407 GCTCCCAGCCCAGCAGACAGGGG - Intronic
918638700 1:186811890-186811912 GGTCCCAGGGTGGAAGAAAGTGG + Intergenic
922059384 1:222073146-222073168 ACTCACAGGTTAGGAGGAAGAGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924780395 1:247141903-247141925 GCTCCCAGGTCAGCAGAGAATGG - Intronic
1062800336 10:374474-374496 CCTCCCTGTTTAGCAGACAGGGG + Intronic
1064009146 10:11721492-11721514 TCTCCCAGGTCAGAAGAAAGAGG - Intergenic
1064868907 10:19915204-19915226 ACTCACAGGAAAGCAGAAAGGGG - Intronic
1065144391 10:22753734-22753756 GCTCCCAAGTTGGCACAGAGGGG + Intergenic
1070370003 10:75773270-75773292 GATCTCAGGTTAGCACAGAGAGG + Intronic
1070690671 10:78522614-78522636 GCTGCAAGGTGAGCAGAAGGGGG - Intergenic
1072786491 10:98286656-98286678 GCTCCCAGGTGGGCAGGATGAGG + Intergenic
1073355967 10:102854420-102854442 GCTCCGAGGTGAGCTGGAAGTGG + Exonic
1074866578 10:117547465-117547487 TCTCACAGGTGAGCAGGAAGGGG - Intronic
1075566763 10:123510668-123510690 GCTCCCAGCTTTGCAGCAAAAGG + Intergenic
1078869720 11:15332166-15332188 GCTCCCAGGTCATCAGACATTGG - Intergenic
1079543378 11:21603129-21603151 GCACAGAAGTTAGCAGAAAGAGG + Intergenic
1083938824 11:65884285-65884307 ACCCCCAGGGTAGCAGAATGGGG + Intronic
1084795542 11:71502295-71502317 GCTGTCGGGATAGCAGAAAGTGG + Intronic
1084795569 11:71502450-71502472 GCTCTCTGGATAGCAGAAAGTGG + Intronic
1084795584 11:71502528-71502550 GCTGTCTGGATAGCAGAAAGTGG + Intronic
1084795676 11:71502958-71502980 GCTGTCGGGATAGCAGAAAGTGG + Intronic
1095507971 12:42918356-42918378 GCTTGTACGTTAGCAGAAAGAGG + Intergenic
1096556067 12:52404688-52404710 GCTCCCAGCCTAACAGAAGGTGG + Intronic
1097011860 12:55958677-55958699 GCTCCCAGGGTATCAGAGAGGGG + Intronic
1097717638 12:62983296-62983318 GGTCCCATGCTAGTAGAAAGGGG - Intergenic
1099293198 12:80798114-80798136 GCTCCCAGCCTAGCAGAGAGAGG - Intronic
1101373049 12:104147446-104147468 GCTTCCAGGTCAGCATGAAGAGG - Intergenic
1102167024 12:110814849-110814871 ACTCCCAGGTGCCCAGAAAGTGG - Intergenic
1103206535 12:119133907-119133929 GGTGCAAGGTTAGCAGACAGGGG + Intronic
1103207368 12:119140642-119140664 GCTCCCATAGTAGCAGAGAGTGG + Intronic
1104768637 12:131346377-131346399 CCTCCCATGTGAGCAGGAAGGGG - Intergenic
1104811391 12:131622212-131622234 CCTCCCACGTGAGCAGGAAGGGG + Intergenic
1105471801 13:20701938-20701960 GCTGCCATGTTACCAGACAGTGG + Intergenic
1105928966 13:25034173-25034195 GCTTCCTGCTTAGCAGAGAGGGG + Intergenic
1106906636 13:34416228-34416250 GCTCCCAGGTAACCAGAAGCAGG + Intergenic
1107637367 13:42406217-42406239 GCTCCCAGGGTAGCCTAAAGTGG - Intergenic
1113371740 13:109731439-109731461 GTTCCCTGGATAGCAGGAAGAGG + Intergenic
1117119910 14:52555462-52555484 TCCCCCAGGTAAGCACAAAGTGG + Intronic
1119519514 14:75275831-75275853 GCTTACAGGGTAGCAGTAAGTGG - Intergenic
1120552953 14:85893547-85893569 TCCCCCAGGATAGCAGTAAGAGG - Intergenic
1121317533 14:92971094-92971116 GCTCCCAGGTGAGCAGGAAGAGG - Intronic
1121597328 14:95174435-95174457 GCTCCTAGGTGAGCAGTATGAGG - Intergenic
1124610459 15:31204488-31204510 GATCCCAGGTTAGCAGCAGTGGG - Intergenic
1129424316 15:75453385-75453407 GCTCGGAGGTTAGGAGGAAGCGG + Intronic
1131366742 15:91847850-91847872 GTTCCAAGCTCAGCAGAAAGTGG - Intergenic
1131862671 15:96670721-96670743 GCTCCGGCGTTAGCAGAAACAGG - Intergenic
1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG + Intergenic
1133748231 16:8703597-8703619 GCTGACATGTTAGCAGAAAAAGG + Intronic
1136508691 16:30722730-30722752 TCACCCTGGTTAGCAGCAAGCGG - Exonic
1137819843 16:51433654-51433676 GCTCCCATTTTAACAGTAAGAGG - Intergenic
1140381829 16:74495875-74495897 GGTCCCAGTATAGCAGAAAGTGG - Intronic
1143672871 17:8408521-8408543 GACACCAGGTGAGCAGAAAGGGG + Intergenic
1144792714 17:17870183-17870205 GCTCCCTGGCTGGCCGAAAGAGG + Intronic
1147144534 17:38477497-38477519 GCTCTCAGAGTAGCAGACAGAGG - Intronic
1148230417 17:45929903-45929925 GCTCCCAGGGGAGCAGATAATGG + Intronic
1152553993 17:81044052-81044074 GATCCCAGGAAAGCAGACAGTGG - Intronic
1152717543 17:81907189-81907211 GCTCCCAGGTGACCAGACAGTGG - Exonic
1152919208 17:83057380-83057402 GCTCTCAGGTTGGCAGGAGGAGG + Intergenic
1153010463 18:534178-534200 GGTGCCAGGTGAGCAGAGAGGGG - Intergenic
1160629231 18:80233721-80233743 GCACCCAGGTCCCCAGAAAGGGG + Intronic
1162228839 19:9248117-9248139 TCACCCAGGATAGCAAAAAGTGG + Intergenic
1163399769 19:17085210-17085232 GCTCTCAGGTGATCAGAAAATGG + Intronic
1165089337 19:33374297-33374319 GTTCCCAGAATAGCAGAAGGTGG + Intronic
1165160276 19:33811935-33811957 ACTCCCAGGTCAGCAGGGAGAGG - Intronic
1167707717 19:51091504-51091526 GCCCCCAGGTTTGCACACAGAGG - Intergenic
1168713529 19:58514604-58514626 TATCCCAGGATAACAGAAAGGGG - Intronic
925663852 2:6232075-6232097 GCTTACAGGTCAGCAGAACGTGG - Intergenic
928098037 2:28417477-28417499 CCTCACAGCTTTGCAGAAAGAGG - Intergenic
930564888 2:53006314-53006336 GCTCCTAGTACAGCAGAAAGAGG + Intergenic
931016641 2:57989004-57989026 GCTCCCAGTCTAGCAAACAGAGG + Intronic
936247468 2:110840915-110840937 GCTCCTAGGGTAGGAGATAGAGG + Intronic
936973035 2:118192843-118192865 GCTTCCACGTTAGCAAAATGAGG + Intergenic
938671587 2:133591360-133591382 GCTCCCCTGGCAGCAGAAAGGGG - Intergenic
938809312 2:134837630-134837652 GCTTCCAATATAGCAGAAAGTGG - Intergenic
939105307 2:137942096-137942118 GTTCCCAGTTTGGCAGAAACAGG - Intergenic
939431394 2:142113504-142113526 GCTTCAAAGTTAGGAGAAAGTGG + Intronic
942715413 2:178886140-178886162 TCTCCCAGGTCAGCAGGAAGAGG - Intronic
944448747 2:199819392-199819414 GCTCACAGGTTAGCTTAAAAGGG + Exonic
946474973 2:219998270-219998292 GCTCCCAGATTAAAGGAAAGAGG + Intergenic
947714833 2:232334228-232334250 GCTCCCAGGGCAGCAGAAAGCGG - Intronic
948158574 2:235804955-235804977 TCTCCCAAGTTAGCAGAGAAAGG + Intronic
1170696141 20:18660878-18660900 GCTTCCATGTTAGGAGAAACCGG - Intronic
1172229186 20:33325623-33325645 GCTCCCAGCTTGGAAGAACGGGG - Intergenic
1173689368 20:44948184-44948206 GCTCCCAGGTTCTCAGTCAGTGG + Intronic
1175592282 20:60202589-60202611 GCTCCCAGGTCACTAAAAAGTGG + Intergenic
1178389579 21:32187373-32187395 GCACCAAGGTCTGCAGAAAGTGG + Intergenic
1180088902 21:45523958-45523980 GGTCTCAGGTCTGCAGAAAGGGG - Intronic
1182336219 22:29585313-29585335 CCTCCCAGGTGAGGAGAATGAGG + Intergenic
949869008 3:8571055-8571077 TCTCCCATGTCAGCAGGAAGAGG + Intergenic
951922652 3:27873185-27873207 TCTCTCAGGTCAGCAGAAATTGG + Intergenic
952943313 3:38459489-38459511 GCCCCCAGGTGAGCAGAGAGGGG - Intronic
956351483 3:68341700-68341722 GCTCCAAGGTTAGCAGAAAATGG + Intronic
957246232 3:77720119-77720141 GCACCCAGGTTATCATAATGGGG + Intergenic
957397441 3:79660474-79660496 GGGCACAGGTTTGCAGAAAGAGG - Intronic
960217138 3:115054746-115054768 GCTCCCAGGTTGGCCCATAGAGG + Intronic
961440000 3:126947093-126947115 GCTCCCAGGTGGGCAAGAAGAGG - Intronic
961441177 3:126954230-126954252 GCTCCCAGTTTAGGAGAAACTGG - Intronic
962005211 3:131342636-131342658 GCTTCCAGTTTAACAGAAATAGG + Intronic
964945883 3:162222962-162222984 GCTCCCAGGCTAGTAGGATGAGG + Intergenic
965921756 3:173925554-173925576 GCTCCCAGGTTAGCAGAAAGTGG - Intronic
969327467 4:6452205-6452227 GCCCCCAGGCTAGCAGGAGGTGG - Intronic
969721059 4:8893299-8893321 GCTCCGAGGCGAGAAGAAAGCGG - Intergenic
971387231 4:26151985-26152007 GCTCCCAGTTTGCCATAAAGAGG - Intergenic
973601350 4:52545687-52545709 GCTTCCAGCTCAGCAGGAAGAGG + Intergenic
977338000 4:95721992-95722014 CCACCCTGGTTAGCTGAAAGGGG + Intergenic
977728630 4:100325760-100325782 GCTCCTAGTTTAGTAGGAAGTGG + Intergenic
982518127 4:156378257-156378279 GTTGCCAGGTTAGCAGCCAGTGG - Intergenic
984188530 4:176576524-176576546 GCTACCAGGAGATCAGAAAGTGG - Intergenic
985063050 4:186097057-186097079 GATCCCAGCTTAGAAGAGAGGGG + Intergenic
985660019 5:1152357-1152379 GCTCCCTGCTGAGCAGGAAGTGG + Intergenic
992397891 5:76384394-76384416 GCTTCCAGCATAGCAGAAGGTGG + Intergenic
993994750 5:94709456-94709478 TCTCCCAGGTTTACAGAAACTGG - Intronic
994169954 5:96648204-96648226 GCACACAGTTTAGCAAAAAGAGG - Intronic
998384392 5:141748072-141748094 GCTCCGAGGTTGGCAGAGGGAGG - Intergenic
999126542 5:149250336-149250358 GCTCCCAACCTAGCAGGAAGGGG - Intronic
1002522624 5:179800068-179800090 GCTGCGAGGTGAGCAGAGAGGGG + Exonic
1005448721 6:25952652-25952674 TCTCCCAGGTTCTCAGAGAGAGG + Intergenic
1005811265 6:29518235-29518257 GCCCCCATGTCAGCAGGAAGGGG - Intergenic
1007238489 6:40408276-40408298 TCTACCAGGTGAGCAGGAAGAGG + Intronic
1010825673 6:80470484-80470506 GCTCTCTGGTTAGCACAAACAGG + Intergenic
1012260704 6:97084093-97084115 ACTCTCAGGTAACCAGAAAGGGG + Intronic
1013116338 6:107106432-107106454 GCTCACAGCTTAGCAGGAAGAGG - Intronic
1029375923 7:100177019-100177041 GATCTCAGGTGAGGAGAAAGAGG - Exonic
1031835630 7:126678583-126678605 GCTCTTAGTTTATCAGAAAGAGG - Intronic
1032267165 7:130377712-130377734 GCTACAAGTTCAGCAGAAAGTGG - Intergenic
1032456382 7:132076214-132076236 GCCCCCAGGTCAGCACAGAGGGG - Intergenic
1032849875 7:135784898-135784920 GCTTACAGTTTAGGAGAAAGTGG + Intergenic
1032895833 7:136249886-136249908 GCAGCCATGTTAGCAGAGAGAGG + Intergenic
1032967709 7:137120115-137120137 CCTCTCAGGTTTGCAGAAGGGGG + Intergenic
1033549038 7:142428804-142428826 GATTAGAGGTTAGCAGAAAGAGG - Intergenic
1038420985 8:27433956-27433978 GCTCCCAGGCTAGGAGAGAATGG + Intronic
1039857168 8:41425392-41425414 TCTCCCACGGTAGCAGAAGGGGG - Intergenic
1040017131 8:42708772-42708794 GTTCCAAGGTTATCAGAAATGGG + Exonic
1044523167 8:93223130-93223152 GCCCTCATGTTACCAGAAAGGGG - Intergenic
1045034557 8:98167222-98167244 ACTTCCAGGTGAGCAGAGAGAGG + Intergenic
1047466132 8:125116089-125116111 CATCCATGGTTAGCAGAAAGAGG - Intronic
1049874442 8:145007264-145007286 GCTCCCTGGTTTGCAGACTGTGG + Intergenic
1051044731 9:12858994-12859016 GCTACCCGGGTAGCTGAAAGGGG - Intergenic
1053003809 9:34591580-34591602 GCTCCCAACCTGGCAGAAAGAGG - Intergenic
1053851129 9:42289354-42289376 TCTGCCAGGCTAGGAGAAAGTGG - Intergenic
1058474489 9:105318020-105318042 ACTCCCACTTTAGCATAAAGTGG + Intronic
1059194522 9:112358268-112358290 TCTCCCAGGTTAGAGGACAGTGG - Intergenic
1060775193 9:126367866-126367888 GCTCCCAGGTGAGCTGAATCAGG - Intronic
1061813422 9:133177519-133177541 GGTAACAGGATAGCAGAAAGGGG + Intergenic
1062425883 9:136505971-136505993 CCTCCCAGGTTAGAGGAGAGCGG - Intronic
1186181567 X:6978016-6978038 AGTCCCAGGTTATCATAAAGTGG + Intergenic
1186792713 X:13014562-13014584 TCTTTCAGGTTAGCAGACAGAGG + Intergenic
1187071011 X:15888355-15888377 GCTCCCACGGTAGCTGCAAGTGG + Intergenic
1188733398 X:33681083-33681105 GCTCCCCTCTTAGCAGAATGAGG - Intergenic
1191736706 X:64395277-64395299 GCTCCCAGGTGAGCACCAAGAGG + Intronic
1194785017 X:98072623-98072645 AGTCCCAGGATATCAGAAAGAGG + Intergenic
1195624912 X:106997876-106997898 GCTTCCAGTTTATCAGGAAGAGG - Intronic
1197832068 X:130653655-130653677 CCTTCCATGTTAGCAGCAAGTGG + Intronic
1198686194 X:139230411-139230433 TCTCTGAGGTTATCAGAAAGGGG - Intergenic
1200370738 X:155721621-155721643 GCTTACAGGTTAGGAGAGAGTGG + Intergenic