ID: 965924668

View in Genome Browser
Species Human (GRCh38)
Location 3:173963101-173963123
Sequence GATGAGATAATGCATTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 1, 2: 3, 3: 48, 4: 466}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965924668_965924669 3 Left 965924668 3:173963101-173963123 CCTTTAAAATGCATTATCTCATC 0: 1
1: 1
2: 3
3: 48
4: 466
Right 965924669 3:173963127-173963149 CTTATGCTACAACTATAAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965924668 Original CRISPR GATGAGATAATGCATTTTAA AGG (reversed) Intronic
903162383 1:21498262-21498284 AATGAGATAATGCATCCAAAGGG + Intergenic
903283248 1:22262238-22262260 AAAGAGATAATGCACTTGAAGGG + Intergenic
903958704 1:27042676-27042698 GAAAACATCATGCATTTTAAAGG + Intergenic
904828872 1:33294198-33294220 CATCAGATAATGCATGTAAAGGG - Intronic
904966091 1:34374138-34374160 AATGAGATAATGCATGTGAAAGG + Intergenic
906185064 1:43856273-43856295 AATGTGATAATGCACTTTTATGG + Intronic
906708359 1:47911203-47911225 AATGAGATAATGCACATAAAGGG + Intronic
907684009 1:56592052-56592074 GATGAGATAATACATACGAAAGG - Intronic
907789143 1:57644821-57644843 GAAGGGAAAATGGATTTTAAAGG + Intronic
907916583 1:58875347-58875369 GATGAGAAAATGAATGTTCATGG + Intergenic
907922464 1:58926449-58926471 GATGAAATAATTCATGTTTAAGG - Intergenic
908037592 1:60073153-60073175 AAGGAGATAATGCATCTGAAGGG + Intronic
908066456 1:60410766-60410788 AATGAGATAATGCATGTCACGGG - Intergenic
908413407 1:63888918-63888940 TATGAGATAATGAACTTTTATGG - Intronic
908445835 1:64198836-64198858 AAAAAGATAATGCAGTTTAATGG + Intergenic
909183471 1:72453924-72453946 GAAGAGATAATGAATGATAATGG - Intergenic
909275407 1:73678829-73678851 TATGAGATAATTCACATTAAAGG + Intergenic
909681817 1:78300235-78300257 GAGGAGATCATGCTTTTTGATGG + Intergenic
910486429 1:87719920-87719942 GATAAGATAAAGCTTTTTAGAGG - Intergenic
910494325 1:87809666-87809688 AATGAGAGAATGATTTTTAAAGG - Intergenic
911521846 1:98939378-98939400 GATGAGATAAAGCCTTAAAAAGG + Intronic
912565118 1:110582065-110582087 GATGACCTAATGCATCTTAATGG + Intergenic
912767151 1:112424643-112424665 GATGAGATATAGCATATTCATGG - Intronic
913408814 1:118527458-118527480 CATGAGATAAAGCCTTTGAAAGG + Intergenic
913429383 1:118773734-118773756 AATGAGATAATACATTAAAATGG + Intergenic
913475731 1:119235573-119235595 GATGAGATAGTGAATAGTAAAGG - Intergenic
913713216 1:121508145-121508167 GATGAGATCATGCCTTTTGTGGG + Intergenic
915763992 1:158344438-158344460 AATGAGATAATGCCCTTTATAGG - Intergenic
915872512 1:159575988-159576010 GATCATATAATTGATTTTAAAGG + Intergenic
915890731 1:159771168-159771190 GGTGAGAAAATGTTTTTTAATGG - Intergenic
916575961 1:166066654-166066676 GATGAGAAAATGCATGTGGAAGG + Intronic
917315316 1:173718739-173718761 AATAAGAAAATGCATTTGAAAGG + Intronic
917493570 1:175519638-175519660 GAAGAGGTAATGAATTGTAATGG - Intronic
917799890 1:178560929-178560951 GATGAGATCAGGCATGTTCAGGG - Intergenic
918022205 1:180705574-180705596 AATGAGATAGTTAATTTTAAAGG + Intronic
918389489 1:184043514-184043536 AATGAGATAATGTCTTTTACAGG + Intergenic
919169224 1:193932632-193932654 GATTAGATAATGCAATAAAAAGG - Intergenic
920721718 1:208393664-208393686 ACTGAGATAATGCATATGAATGG - Intergenic
921184000 1:212654813-212654835 AATGAGATAATGCATGTGAAGGG - Intergenic
921932687 1:220768122-220768144 AATTAGATAATGCATGTAAAGGG - Intronic
922009471 1:221567305-221567327 TCTGAGAAAATGCATTTTATTGG + Intergenic
922031228 1:221801518-221801540 AATGAGGTAATGCATTTGAAAGG - Intergenic
922910428 1:229211132-229211154 AATGAGATAATGTATATAAAGGG - Intergenic
922984201 1:229853221-229853243 GATGAAATAATGTATGTAAAGGG + Intergenic
923928927 1:238670682-238670704 AAAGAGATATTGCATTTAAAAGG - Intergenic
923963856 1:239114365-239114387 TAAAAGATCATGCATTTTAAAGG + Intergenic
924068094 1:240246642-240246664 GATCAGAATCTGCATTTTAAAGG + Intronic
924329370 1:242926618-242926640 GCAGAGATAATTCATTTTCATGG - Intergenic
1062778099 10:172613-172635 GATGAGATATTCCATGTTCATGG + Intronic
1063336298 10:5217945-5217967 CATGAGATAATGTATTAAAAAGG + Intronic
1063972031 10:11387919-11387941 GATCAGGCAAAGCATTTTAAAGG + Intergenic
1064466823 10:15591739-15591761 GGTGAGATACTCCATTTTGAGGG - Intronic
1068851992 10:61753041-61753063 TATGAGATAATAAATTATAATGG - Intronic
1070059970 10:72972421-72972443 GACTAGATCATGCATTTTTAAGG + Intergenic
1071013815 10:80970898-80970920 GATAAGATGATTCATTTTTATGG - Intergenic
1071214814 10:83388452-83388474 GATGAGATTATGTCTTTTGAGGG - Intergenic
1071313213 10:84363630-84363652 GATGAGGTAATGGATATGAAAGG + Intronic
1071851418 10:89574315-89574337 TATGGCATAATCCATTTTAATGG - Intergenic
1072051981 10:91714112-91714134 AATGAGAAAATGCATGTAAAGGG - Intergenic
1072105947 10:92274190-92274212 TCTGAGATAATGCATGTGAAGGG + Intronic
1072323807 10:94276620-94276642 GATAAGATAATTCACTTTATGGG - Intronic
1072419240 10:95275548-95275570 TTTGAAATAATTCATTTTAAAGG - Intronic
1072537907 10:96377233-96377255 AATGAGATAATGCATGGGAAAGG + Intronic
1072743576 10:97924671-97924693 AATGAGATGATGCACATTAAAGG + Intronic
1073633142 10:105169056-105169078 AATGAGATAATTCATGTAAATGG - Intronic
1073763636 10:106657890-106657912 AATGAGACAATGCATTGAAAAGG + Intronic
1074182210 10:111075633-111075655 GATGAGAGCAAGCAGTTTAATGG - Intergenic
1074365924 10:112857470-112857492 CTTGAGATAATGCATTTCACAGG + Intergenic
1077750370 11:4961228-4961250 TTTGTGATAATGCATTTTCATGG + Intronic
1077821946 11:5754599-5754621 AATTCCATAATGCATTTTAATGG - Intronic
1079967869 11:27001170-27001192 AATGTGATAATGCATGTGAAAGG - Intergenic
1080201587 11:29677756-29677778 GATAAGAAATTGCATATTAAAGG + Intergenic
1080249869 11:30220879-30220901 AATGAAAGAATGGATTTTAAAGG - Intergenic
1080421077 11:32110951-32110973 GGTGAGATAATGCATGTGCAAGG + Intergenic
1081228062 11:40549800-40549822 GATTGGATAAAGCATTTAAATGG + Intronic
1081289419 11:41306358-41306380 GAAGAAGCAATGCATTTTAATGG + Intronic
1081450408 11:43166100-43166122 GATGAGATAATGCATAAGTAGGG + Intergenic
1082849260 11:57751242-57751264 GGTGAGATAATACATTTCAGAGG + Intronic
1085715173 11:78866288-78866310 GATGAGATAATTGATTCTAATGG - Intronic
1086054373 11:82629767-82629789 AATGAGATAATGTATTTAAAGGG - Intergenic
1086120462 11:83300191-83300213 AATGAGTTAATGCACTTAAAGGG + Intergenic
1086464517 11:87039005-87039027 AATGAGACAATGCACTTCAATGG - Intronic
1087442008 11:98197314-98197336 GATGAAATGATGCATGTAAAGGG - Intergenic
1087532133 11:99396910-99396932 AATGGGATAATGCATATTAAAGG - Intronic
1088275975 11:108086004-108086026 GAAGATATAATACATATTAATGG + Intronic
1088423838 11:109678606-109678628 AATGAAATAATGCATGTGAATGG + Intergenic
1088493803 11:110412806-110412828 AAGGAGAAAATGCATTATAAAGG - Intergenic
1090407027 11:126482534-126482556 CATGAGAAAATGCTTTGTAAAGG + Intronic
1090681911 11:129068849-129068871 GATGAGATACTGCAAATTGAGGG - Intronic
1091118242 11:133035082-133035104 GAAGGGATAATGCTTATTAAAGG - Intronic
1091592169 12:1849591-1849613 GATTAGATAAAGCATTTATATGG + Intronic
1091988206 12:4931412-4931434 GATGATATAATGCTTTTTTTTGG - Intergenic
1092063709 12:5572080-5572102 GATGAGATCAAGCTTTTTATTGG - Intronic
1092632583 12:10398545-10398567 CATCAGCAAATGCATTTTAAAGG + Intronic
1092726887 12:11495773-11495795 GATAAGAAAATGCATCATAAAGG - Intronic
1093203429 12:16217751-16217773 AATGAGATAATGCATATTAAGGG - Intronic
1093500959 12:19811510-19811532 AATGAGATAAAGTATTTTAACGG + Intergenic
1093517657 12:20009282-20009304 ATTGTGATAATGCATTTTTATGG + Intergenic
1094084823 12:26577935-26577957 AATGAGATAATGCATGTAAATGG + Intronic
1094259042 12:28470751-28470773 GATGACATAATTCATTTCTATGG - Intronic
1094477843 12:30855242-30855264 AACCAGATAATACATTTTAATGG + Intergenic
1095273496 12:40250831-40250853 CATGAGATAATTCCTTTTTATGG + Intronic
1095336521 12:41034715-41034737 GAAGAGAATATGCATTTTAGAGG - Intronic
1095590036 12:43892837-43892859 TATGAAATAAAGCAGTTTAAGGG + Intronic
1097442815 12:59632396-59632418 GATGGGATAATTCCTTTTATGGG + Intronic
1097659032 12:62407380-62407402 AATGAGATCATGTATTTTATGGG + Intronic
1097991742 12:65842284-65842306 AATGAGATAATGCATGCAAAGGG + Intronic
1098430872 12:70418686-70418708 GATGAAATATGGCATTTAAAAGG - Intronic
1098461391 12:70736628-70736650 AATGAGATAATGCATGTGAAGGG + Intronic
1098763923 12:74460920-74460942 CATTACATAATGTATTTTAATGG - Intergenic
1099014864 12:77332041-77332063 GATGACATGATGGATTTCAATGG + Intergenic
1099371834 12:81842635-81842657 GATTAAATATTGCATTTTAGAGG - Intergenic
1099632282 12:85165766-85165788 GCTGATTTGATGCATTTTAATGG + Intronic
1100567256 12:95809157-95809179 TATGAGATACAGCAATTTAAAGG + Intronic
1100774164 12:97956004-97956026 GTTGTGATAATACATGTTAAAGG + Intergenic
1101101243 12:101395234-101395256 GGAAAGATAATTCATTTTAAGGG + Exonic
1101633081 12:106514510-106514532 AATGAGATAACGCATCTAAAGGG + Intronic
1101857456 12:108455848-108455870 GCTGAGCTAATGCATTTTTCTGG + Intergenic
1102435286 12:112917989-112918011 AATGAGAGAGTGCATATTAAAGG - Intronic
1103574004 12:121863563-121863585 GAAGAAATAATGCCTTTTGAGGG - Intronic
1106388446 13:29311479-29311501 TTTGAAATAATGCATTTAAATGG + Intronic
1106800400 13:33250551-33250573 TATGAAATAATGCCTTTAAAAGG - Intronic
1106972878 13:35164906-35164928 GTTAATATAATACATTTTAAAGG + Intronic
1107407494 13:40128223-40128245 GATGAGATAATGCAGGTAGAAGG - Intergenic
1107429064 13:40322538-40322560 GAAAAAATAATGCATTTTGAAGG + Intergenic
1108530988 13:51326778-51326800 AATGAGATAATGCTTGTAAAAGG + Intergenic
1108727442 13:53198670-53198692 GATGAGATAATTAATTTTCAGGG - Intergenic
1109342436 13:61078076-61078098 GGAGAAATAATACATTTTAACGG + Intergenic
1109909960 13:68896206-68896228 GATTATATAATACATTTAAAAGG - Intergenic
1110042259 13:70777592-70777614 GAAGAGATAATGCAAATTATAGG + Intergenic
1110390518 13:74968179-74968201 AATGGGATAATGCATTTAAAGGG + Intergenic
1111038371 13:82709110-82709132 GATAAAATAAGCCATTTTAATGG - Intergenic
1111095732 13:83512957-83512979 CTTGTGATAATGCATTTTCACGG - Intergenic
1111137801 13:84072395-84072417 GATGATATAATGCATTTTCATGG - Intergenic
1111638039 13:90930990-90931012 AATGAGATTATGCCTTTTACGGG + Intergenic
1111899055 13:94178838-94178860 GATGAGATGATGAATCTAAACGG + Intronic
1112323239 13:98426186-98426208 GCTGAGATACATCATTTTAATGG - Intronic
1112636343 13:101221975-101221997 GATGAGAAAAAGCATGATAAAGG - Intronic
1115095038 14:29624626-29624648 GATAAGATAATGTATGTTATAGG + Intronic
1115296449 14:31832892-31832914 AATAAGATAATGCATATAAATGG + Intronic
1115435781 14:33371506-33371528 CATGAGATACTGATTTTTAAAGG - Intronic
1115801698 14:37001302-37001324 CATGAAACAATGCATTTAAAGGG - Intronic
1116166743 14:41343260-41343282 AATGAGATAGTACCTTTTAAAGG - Intergenic
1117237148 14:53790184-53790206 CCTGAGAATATGCATTTTAAAGG + Intergenic
1117610507 14:57478400-57478422 AAAGAGATAATGCATATTAAAGG + Intronic
1119074961 14:71628430-71628452 AATGAGATAATGTATGTAAAGGG - Intronic
1119747266 14:77053205-77053227 AATGAGATAATGCGTGTCAAGGG + Intergenic
1119924984 14:78484999-78485021 GAAGAGTTAATGCATTATAAGGG - Intronic
1120856144 14:89214220-89214242 GATGATAGAATCCATTTTAGAGG - Intronic
1121122999 14:91387989-91388011 GTCCAGACAATGCATTTTAAGGG + Intronic
1121187222 14:91984704-91984726 AGCAAGATAATGCATTTTAATGG + Intronic
1121535508 14:94687904-94687926 GTTGAGATAATCTCTTTTAAGGG + Intergenic
1122677603 14:103429383-103429405 AATGAAATAATGCATATAAAAGG + Intronic
1124850353 15:33331091-33331113 GTTGAGAGAATATATTTTAAAGG + Intronic
1125156704 15:36595349-36595371 GATGATATAATGTATTTTTAAGG + Intronic
1125411797 15:39414260-39414282 AATGAGATAATGCATGTAACGGG - Intergenic
1127692285 15:61409140-61409162 GATGAGGGAATGTATTTTGAAGG + Intergenic
1128607772 15:69049555-69049577 GATGACATCAGGCATTTTAAAGG + Intronic
1128800563 15:70494308-70494330 AATGAGATAATGCTCATTAAGGG - Intergenic
1129619450 15:77130747-77130769 AGTGAGATAATGCATATGAAAGG - Intronic
1130356136 15:83132146-83132168 GATGAGGTAATACATGTAAAGGG + Exonic
1131708808 15:95029577-95029599 GTTGATCCAATGCATTTTAAGGG - Intergenic
1131809345 15:96156485-96156507 TATGAGATAATGCACCTTGAAGG - Intergenic
1132261496 15:100429072-100429094 GATCAGATAATGAATTTCACAGG + Intronic
1133084571 16:3351994-3352016 AATTAGAAAATACATTTTAAAGG + Intergenic
1133937269 16:10279337-10279359 AGTGAGAAAATGCATTTGAAGGG - Intergenic
1135034220 16:19063173-19063195 GACGAGATCAGGCATTTTCAGGG - Exonic
1135347838 16:21704519-21704541 AATGAGATAATGCAGGTAAACGG + Intronic
1135844835 16:25909474-25909496 GATGAGATTCTGCATTTCTAAGG + Intronic
1135938046 16:26797740-26797762 GAGGAGATAATGCCTATGAAAGG + Intergenic
1137306734 16:47207959-47207981 TATGAGATAATGCATACTAAGGG - Intronic
1137751945 16:50869536-50869558 GATGAGATAGGGCATATTCATGG + Intergenic
1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG + Intronic
1138620952 16:58210967-58210989 GAAGAGATATTGCTTTATAAAGG + Intergenic
1138935534 16:61716844-61716866 GATATCTTAATGCATTTTAATGG - Intronic
1139869362 16:70092758-70092780 GAGGAGATTTTTCATTTTAAAGG + Intergenic
1140386021 16:74539455-74539477 GAGGAGATTTTTCATTTTAAAGG - Intronic
1140779167 16:78278055-78278077 CATCAGAGGATGCATTTTAAGGG - Intronic
1141253033 16:82376065-82376087 AATGAGATAATGCATGAAAAGGG - Intergenic
1141350803 16:83293901-83293923 AATGAGATAATACATGCTAAGGG - Intronic
1141768771 16:86075933-86075955 AATGAGATAATGTATGTAAAGGG - Intergenic
1141769003 16:86077531-86077553 GATGAGATAATATATGTAAAGGG + Intergenic
1142998588 17:3776372-3776394 TTTGAGATAATGCATGTAAAGGG - Intronic
1143353258 17:6305536-6305558 GATGAGATAATGCAGGTAAAGGG + Intergenic
1144014718 17:11182999-11183021 AATGAGATAATGTTTGTTAAAGG - Intergenic
1144844158 17:18207345-18207367 GAGGAGATAATTTTTTTTAAAGG + Intronic
1145727082 17:27139740-27139762 GATGAGATAATGTCTTTTGCAGG + Intergenic
1146513592 17:33471851-33471873 AATTAGATAATGCATATAAATGG - Intronic
1148587184 17:48789403-48789425 AATGAGATAATGCATATAAAAGG - Intronic
1149154722 17:53613995-53614017 GATGACATAATTCACTTAAACGG + Intergenic
1150487765 17:65555889-65555911 GTTGAGATGAAGCATCTTAAAGG - Intronic
1150768721 17:68023545-68023567 GGTGGAATAAGGCATTTTAAAGG - Intergenic
1150851799 17:68710569-68710591 GAGAAGAGAATGCTTTTTAAAGG + Intergenic
1155534782 18:26805862-26805884 GATGAGTTAATGCATGTAATGGG + Intergenic
1155645620 18:28073899-28073921 GATGAGATAATGCATACAAAGGG + Intronic
1155895757 18:31323901-31323923 GAAAATATAATGCATTATAATGG - Intronic
1156136339 18:34043702-34043724 AATGAGATAATGTAAATTAAAGG + Intronic
1157310287 18:46547461-46547483 GTTGAACTAATGGATTTTAATGG + Intronic
1158323218 18:56286084-56286106 ATTGTGATAATGCATTTTCATGG - Intergenic
1158337038 18:56423504-56423526 TATGAAGTAATTCATTTTAATGG - Intergenic
1158338987 18:56445320-56445342 GATCAGATAATGCACTAGAAAGG + Intergenic
1159056163 18:63466463-63466485 AATGAGATAATACATGCTAAAGG - Intergenic
1159085548 18:63786258-63786280 TATAAAATAATGCATTTCAAAGG - Intronic
1159344468 18:67181951-67181973 GCAGAGATACTGCAATTTAAAGG + Intergenic
1159663922 18:71133750-71133772 GGTGACATGATGCATTTCAATGG + Intergenic
1159952372 18:74494848-74494870 GATGAGATTAGGCATGTTCAGGG - Intergenic
1161654046 19:5502603-5502625 AATGGGATACTGGATTTTAAAGG + Intergenic
1163902009 19:20110800-20110822 AATGAGAAAAAGCATTTGAAAGG - Intronic
1163944872 19:20526017-20526039 AATGAGAAAAAGCATTTGAAAGG - Intergenic
1163955952 19:20640605-20640627 AATGAGAAAAAGCATTTGAAAGG + Intronic
1164379177 19:27717751-27717773 GATGACAGAAAGCATTCTAATGG - Intergenic
1164933143 19:32190727-32190749 GATATGAAAATGCATTTTAAAGG - Intergenic
1167804423 19:51769994-51770016 GATGAGATAGCGCATAATAAGGG + Exonic
1167808022 19:51802637-51802659 GATGAGATAGTATATATTAAAGG + Intronic
925935737 2:8757688-8757710 GCTGAGAAAAGCCATTTTAATGG - Intronic
926958276 2:18326272-18326294 GATATGATAATGCAATTTCATGG + Intronic
927630618 2:24770965-24770987 AATGTGACAATGCATTTTATAGG + Intergenic
927883484 2:26704904-26704926 GATGAGGTAATGCCTGTAAAGGG - Intronic
928292930 2:30055800-30055822 AATGAGATAATACATGTGAAAGG + Intergenic
930179782 2:48342703-48342725 GATGAGATCAGGCATGTTCAGGG - Intronic
930452069 2:51554355-51554377 GATATGAATATGCATTTTAATGG + Intergenic
930502528 2:52239849-52239871 AATGAATTATTGCATTTTAATGG - Intergenic
930871937 2:56179646-56179668 GATAAGATGATGCCTTTTGAAGG + Intergenic
931049934 2:58401213-58401235 GAAGAGATAATCCATGTTCATGG + Intergenic
931419999 2:62118279-62118301 GATGAGATCATGCATGTGAAAGG + Intronic
931631298 2:64303321-64303343 GATGTGATAATGCACTTTCATGG + Intergenic
933001409 2:76928545-76928567 TATGGGTTCATGCATTTTAAAGG + Intronic
933541629 2:83650985-83651007 AATGATATTATGCTTTTTAATGG + Intergenic
933869908 2:86556144-86556166 GACTAGATAATACATTTTAATGG + Intronic
934744038 2:96746622-96746644 AATGAGATACTGCATGTGAAAGG - Intergenic
935405808 2:102707845-102707867 AATGGGCTAATGCATTTGAAAGG + Intronic
935511954 2:103986844-103986866 GATGAATTAATTTATTTTAAAGG - Intergenic
935658550 2:105445571-105445593 GTTGTGATAATGCACTTTCATGG + Intergenic
937225962 2:120368830-120368852 AATGAGATAATGCATATAAAGGG + Intergenic
937723456 2:125130678-125130700 AATGAGATCATGTATTTTTAGGG + Intergenic
938115446 2:128600143-128600165 CTTGACAGAATGCATTTTAAGGG + Intergenic
938917730 2:135959808-135959830 GAGGTTATAATGCAGTTTAATGG + Intronic
939194876 2:138959300-138959322 GAAGAGATTATGCATGTAAATGG + Intergenic
939378767 2:141406956-141406978 GACTAGATAAAGCATTTTAAGGG + Intronic
939905165 2:147904409-147904431 GATAAGAAATTGAATTTTAAGGG + Intronic
940209972 2:151246222-151246244 AATGAAATACTGCATTTTTATGG + Intergenic
940349235 2:152662802-152662824 GAGGAAATAATGGACTTTAAGGG - Intronic
940371657 2:152908538-152908560 GATAAGAAATTGCAATTTAAGGG - Intergenic
940752553 2:157643083-157643105 AATGAGATAATGCATATGAAGGG + Intergenic
940934960 2:159482402-159482424 AATGAGATAATGCATGTAAAGGG + Intronic
940977982 2:159968277-159968299 GATTATAGAATGCATTTTATTGG + Intronic
941034992 2:160558847-160558869 AATGAGATAATGCATTCAAAGGG - Intergenic
941752426 2:169147206-169147228 GCTTTCATAATGCATTTTAAAGG - Intronic
942885046 2:180912772-180912794 AATGAAATAATGTAGTTTAAAGG - Intergenic
943248063 2:185481632-185481654 GATAAATAAATGCATTTTAAAGG - Intergenic
943442640 2:187944851-187944873 AATGAAATAAAACATTTTAATGG + Intergenic
944261170 2:197678974-197678996 GCAGAGAAAATGCATTCTAATGG + Intergenic
944330744 2:198463324-198463346 AATGAGATCATGTCTTTTAAGGG - Intronic
944680854 2:202075366-202075388 AATGAGATAATGTATGTGAAAGG + Intronic
944819422 2:203414873-203414895 AATGAAATAATGCATTACAAAGG + Intronic
945036622 2:205709039-205709061 GGTGAGTTAATGCATATCAATGG - Intronic
945042304 2:205752439-205752461 GATGAGATAATACTTTTTTTGGG + Intronic
945950030 2:216030459-216030481 AATGAGATAATGCATGGAAAGGG + Intronic
946041686 2:216788223-216788245 GAGGAGATAATGCCATTTGATGG - Intergenic
946807130 2:223482133-223482155 AATGAGCTAATACATTTAAAGGG + Intergenic
948312676 2:237000376-237000398 AATGAGATAATGCATGTGAGAGG + Intergenic
948348388 2:237318460-237318482 GATGAGGTACTGCATGTTTAAGG - Intergenic
1168984607 20:2037430-2037452 GATGAGATAATACAAGTAAACGG - Intergenic
1169643890 20:7787470-7787492 GAAGAGATACTACATTTTCATGG + Intergenic
1169685782 20:8269445-8269467 AATGAGATAATGCATGTCAAAGG + Intronic
1170086917 20:12544281-12544303 GAAGAGAGATTGCATCTTAAGGG - Intergenic
1170768738 20:19313904-19313926 GAGGAGATGATACATCTTAAAGG + Intronic
1172082444 20:32352772-32352794 GATGTTAAAATACATTTTAAAGG + Intergenic
1173804671 20:45916438-45916460 AATGAGTTAATGCATTGAAAGGG + Intergenic
1173813541 20:45971051-45971073 AATGAGAAAATCCATTTTAGGGG + Intronic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1177015266 21:15780054-15780076 GAGAAAATGATGCATTTTAAAGG + Intronic
1177753996 21:25322592-25322614 GATAAGCTAATGTATTTTATTGG - Intergenic
1177802819 21:25844843-25844865 GGCCAGATATTGCATTTTAATGG + Intergenic
1177967838 21:27750520-27750542 GATGAGATAATGTCGTTTACAGG - Intergenic
1179232886 21:39521000-39521022 AATGATATAATGAAATTTAAGGG - Intergenic
1179239761 21:39579786-39579808 GATTAGAAATTGCAATTTAAGGG + Intronic
1181943875 22:26499922-26499944 GATGTGAAAATTTATTTTAATGG + Intronic
1182017421 22:27052388-27052410 GATGTAATAATGCAATTAAAAGG - Intergenic
1182377939 22:29861904-29861926 AATGAAGTAATGTATTTTAAAGG - Intergenic
1184315562 22:43685472-43685494 GTTGTGATAATGCATTTTTGTGG - Intronic
949395170 3:3607126-3607148 GATCAGAGAAAGAATTTTAAGGG + Intergenic
950156634 3:10725975-10725997 AATGAGATAATGCATTTTAAGGG + Intergenic
950280796 3:11706253-11706275 GATAAGATAATGGGTATTAAAGG + Intronic
952903445 3:38124769-38124791 AATGTGATAATGCACTTTCATGG + Intronic
952924025 3:38308303-38308325 AATGAGACAATGCATATAAAGGG - Intronic
953083351 3:39642441-39642463 GATGAGAAAATGGATTTGAAAGG - Intergenic
953464029 3:43104216-43104238 GATGAAATAATGAATGTGAAAGG - Intronic
953936378 3:47047239-47047261 AATGAGATGATGTATGTTAAGGG - Intronic
953938546 3:47069091-47069113 AATAAGATAATGTATTTGAAGGG - Intronic
954499519 3:50997960-50997982 GAGAATATAATGTATTTTAATGG + Intronic
955593654 3:60564725-60564747 GATGAGAAATTGCTTTTTATGGG + Intronic
956074957 3:65495301-65495323 AATGAGATAATCCTTTTTGAGGG + Intronic
956151678 3:66250312-66250334 GATAAGATACTGCCTTTTAGAGG + Intronic
956182616 3:66531556-66531578 GATGAGAATATGCATTGGAATGG + Intergenic
956779050 3:72590048-72590070 GATAAGATAATGCCTCTCAAGGG - Intergenic
956787336 3:72653506-72653528 GTTGTGATAAGGCATTCTAAAGG - Intergenic
957027814 3:75204616-75204638 GATGAGAAAAGGAATTTTTAGGG - Intergenic
958481413 3:94649695-94649717 GATGAGATAATGCATAAGTAGGG - Intergenic
958734947 3:97997913-97997935 AATGTGATAATGCACTTTCATGG + Intronic
958796816 3:98714797-98714819 GATGAGTTAATACAGTTTGATGG - Intergenic
959326741 3:104946332-104946354 AATGAGATCATGTCTTTTAAGGG - Intergenic
959602021 3:108197925-108197947 AATGAGACAATGTATTTAAAAGG + Intronic
961123858 3:124398404-124398426 GATGAAATAATGCATGAGAAAGG - Intronic
963453190 3:145510844-145510866 CATGAAATAAGTCATTTTAAAGG + Intergenic
964255379 3:154769224-154769246 AATGAGATCATGTATTTTATAGG - Intergenic
964543432 3:157804948-157804970 ATTAAGATAATGGATTTTAAAGG + Intergenic
964657125 3:159079904-159079926 AAAGAGTAAATGCATTTTAAAGG + Intronic
964996596 3:162890080-162890102 GAAGAGATATTTAATTTTAATGG + Intergenic
965245730 3:166265158-166265180 GAAGAGATAATGAATTGGAATGG + Intergenic
965319502 3:167234214-167234236 TATAAAATAATACATTTTAAAGG - Intergenic
965411756 3:168340337-168340359 GATTTGATAATGTGTTTTAATGG + Intergenic
965924668 3:173963101-173963123 GATGAGATAATGCATTTTAAAGG - Intronic
966077010 3:175948790-175948812 CATGAAATAATTCATTTTTATGG - Intergenic
967031503 3:185611580-185611602 ACAGAGATAATGCATATTAATGG + Intronic
969978477 4:11129101-11129123 GTTGTGTTAATGCATTTTCATGG + Intergenic
970432672 4:16003120-16003142 TCTAAGATAATGCATTTGAAAGG - Intronic
970492693 4:16591078-16591100 GATGCTATAATCCTTTTTAAAGG + Intronic
970910812 4:21272947-21272969 GTTGAGATGAAGCATTTTAGTGG + Intronic
970958440 4:21843359-21843381 GATTAGATAATACAGTTTGATGG + Intronic
971846387 4:31924139-31924161 GATGAGATGATGCACTTCCACGG + Intergenic
971916809 4:32881045-32881067 GAAGAGATAATGTTATTTAAAGG + Intergenic
971957050 4:33434304-33434326 GGAGAGAGAATTCATTTTAATGG - Intergenic
971993254 4:33929297-33929319 GATCAGAAAAGGCATTTTTATGG + Intergenic
972225539 4:37007034-37007056 AATAAGATAATGTATATTAAGGG - Intergenic
972943809 4:44228943-44228965 AATGAAATATTTCATTTTAAAGG - Intronic
974216581 4:58855087-58855109 TATCAGATAATGTATCTTAAAGG - Intergenic
974936500 4:68414700-68414722 GACGACATACTGCATTTAAAGGG + Intergenic
975591683 4:76006830-76006852 ATTAAGATAATGTATTTTAAGGG - Intronic
975881456 4:78912632-78912654 CATTAGATATTCCATTTTAATGG - Exonic
976434257 4:84998880-84998902 GAGGAAATAAGGCATTTTCATGG + Intergenic
976467955 4:85392730-85392752 GATTAAATAATGTAGTTTAATGG + Intergenic
976654133 4:87469634-87469656 GATGAGAAATTTCATTCTAAAGG + Intergenic
977051915 4:92138827-92138849 GATGAGAAAATGTATTAAAAAGG - Intergenic
978124652 4:105121480-105121502 GTTGAGAAAATTTATTTTAAAGG - Intergenic
978126261 4:105139189-105139211 AATGACATAATGCATTTTAAAGG + Intergenic
978649769 4:110986556-110986578 GATGAGAAAATGCAGATTCAAGG + Intergenic
979285054 4:118913822-118913844 AATAAGATGATGCATTTGAAAGG - Intronic
979692682 4:123576577-123576599 GATGAGAAAATGCACTCTATTGG + Intergenic
979715612 4:123833640-123833662 AAAGAGTTAATGCATGTTAAAGG - Intergenic
979924321 4:126541435-126541457 GATAAGAAAGTGAATTTTAAGGG - Intergenic
980279028 4:130693914-130693936 GAGGAGATAATACCCTTTAAGGG + Intergenic
980598889 4:134993145-134993167 GATTAGAGAATGGATTCTAATGG - Intergenic
981195422 4:141914505-141914527 TATGAGATAATACATGTAAAAGG + Intergenic
981979396 4:150772939-150772961 GATGAGATTGGGCATTTTCAGGG - Intronic
982589337 4:157285209-157285231 CATGAGACATTGCATTTAAAAGG - Intronic
982635379 4:157889108-157889130 GATGAGACAATGCATGTAGAAGG - Intergenic
983464021 4:168063979-168064001 TATGAGTTAATGTATTTTAGGGG - Intergenic
983499358 4:168481539-168481561 AATGTGATAATACATGTTAAGGG - Intronic
983754564 4:171319152-171319174 AATGAGAGAATGCACTATAAAGG - Intergenic
983884477 4:172965006-172965028 GATGAGATATAGCACTTAAAGGG - Intronic
984141613 4:176011181-176011203 AATAAGATAATGCATTAGAAAGG + Intergenic
984932025 4:184856553-184856575 AGAGTGATAATGCATTTTAAAGG + Intergenic
985199390 4:187469030-187469052 AATGAGATAATATATTTAAAGGG + Intergenic
985421223 4:189786951-189786973 TATGAAATACTGCATTTTAAGGG - Intergenic
987223979 5:15820598-15820620 GAGGAGATAATTCACTTGAAAGG - Intronic
987505617 5:18767123-18767145 GATAAAATAATTCATTTTTAAGG + Intergenic
987945053 5:24595986-24596008 TATTAAATAATGCATTTTACTGG - Intronic
988263088 5:28914548-28914570 CATGAGATGATGCAATTTAGAGG - Intergenic
988774545 5:34465999-34466021 GATGAGATAATGCATAAGTAGGG + Intergenic
989781996 5:45278066-45278088 GATGATAGAGTGCATTGTAAGGG - Intronic
990410628 5:55537555-55537577 GAAATGACAATGCATTTTAATGG - Intergenic
991603715 5:68379392-68379414 CATGAGATAATGAATATAAAGGG - Intergenic
992121012 5:73592240-73592262 GATGAGTTCATTCTTTTTAATGG + Intergenic
992853409 5:80834964-80834986 GATGAGATAAGACATTTCAGAGG - Intronic
992961879 5:81964015-81964037 AATGAGATAATGCAGATGAAGGG + Intergenic
993193540 5:84709278-84709300 AATGAAATAATGTATTTTACAGG - Intergenic
993783676 5:92101530-92101552 TCTGAGATAATGCATGTTAAAGG + Intergenic
994321088 5:98395598-98395620 GTTGTGATAATGCACTTTCATGG + Intergenic
994404284 5:99324538-99324560 AATGAGATAATGCCTTTTGCAGG + Intergenic
994587807 5:101733118-101733140 TATGAGAAAATACATTTTATAGG + Intergenic
994633468 5:102314818-102314840 GATGAAATATAGCAGTTTAAAGG + Intergenic
994657379 5:102610246-102610268 CATGAGAAAATGCAGATTAATGG + Intergenic
994790033 5:104212883-104212905 AATAACATCATGCATTTTAATGG + Intergenic
994942334 5:106340763-106340785 GCTGACATAAGACATTTTAATGG - Intergenic
995632313 5:114147692-114147714 GATGAGATAATGCATAAGTAGGG + Intergenic
996621880 5:125515125-125515147 AATGAGATAATGTATTTTGAGGG + Intergenic
997045060 5:130306076-130306098 AATGAGATAATGTATTTTGCAGG + Intergenic
997707023 5:135965327-135965349 CATTAGATAATGCATGTTCAGGG - Intergenic
997988428 5:138523757-138523779 AGTGAAATAATGCACTTTAAAGG + Intronic
998656537 5:144187234-144187256 AATGACATAATGCATTGTACTGG + Intronic
998939472 5:147265477-147265499 GATGAGAGAATGGATTCCAAAGG + Intronic
999388385 5:151172071-151172093 AATAAGAAAATGTATTTTAAGGG + Intergenic
999572383 5:152934558-152934580 ACTGGGATAGTGCATTTTAATGG + Intergenic
999760490 5:154696532-154696554 CATGAGACAATGCATATGAAGGG - Intergenic
1000011782 5:157240073-157240095 GATGTGATAATGCTTTATACAGG - Exonic
1000240441 5:159403832-159403854 GATGAGAAAATGTATGTCAAGGG + Intergenic
1000372332 5:160548925-160548947 GATTAGATAACTCATTTGAAAGG + Intergenic
1000484819 5:161828566-161828588 CATGAAATGATGCATTTTATGGG + Intergenic
1001486721 5:172125039-172125061 GCTGAGATAATACACTTTCAGGG - Intronic
1004991060 6:21139322-21139344 GATGACATTGTGCATTTTACTGG - Intronic
1005233889 6:23737217-23737239 GATGGAATAATTCATTTTACTGG + Intergenic
1005486858 6:26308825-26308847 CATGAGATAATTCATTTTCCTGG - Intergenic
1005872665 6:29986669-29986691 AATCAGAAACTGCATTTTAACGG - Intergenic
1008272435 6:49506027-49506049 GATGAGATAATGCATAAGCAGGG + Intronic
1008618674 6:53250417-53250439 AATGAGATAATGCTTGTAAAAGG - Intergenic
1008863612 6:56182180-56182202 AATGAGATAATGCATGTCAAAGG - Intronic
1009310014 6:62138290-62138312 AAAGAGAAAATGCATTTCAAGGG - Intronic
1009788066 6:68363707-68363729 AATGTGATAAAGCATTTTTAAGG + Intergenic
1009827234 6:68882535-68882557 AATCAGATAATGCAATGTAAAGG - Intronic
1009934313 6:70216179-70216201 GATGAGATTATTTATTTTAAAGG - Exonic
1010156021 6:72793823-72793845 AATGAGATCATGCATTTGAAAGG - Intronic
1010440014 6:75883114-75883136 GTTGTGGTAATGCATTTTCATGG + Intronic
1010870691 6:81034528-81034550 GTGTAGATTATGCATTTTAAAGG - Intergenic
1011272827 6:85596785-85596807 AATTTGATAATGCATTTAAAGGG + Intronic
1011514621 6:88139633-88139655 AATGAAATAATGCTTTTTAAAGG + Intergenic
1012262649 6:97105852-97105874 GATGAGAGCCTGCTTTTTAAGGG + Intronic
1012670557 6:102040900-102040922 GAAAATAGAATGCATTTTAATGG - Intronic
1012702039 6:102470914-102470936 GAAGAGATATTCCATTTTCATGG - Intergenic
1012957067 6:105582546-105582568 CATTGGAAAATGCATTTTAAAGG + Intergenic
1013581663 6:111541045-111541067 CATGAGATTTTGCATTTTATAGG + Intergenic
1013595339 6:111655578-111655600 GATGAGAGAATCCACATTAATGG + Intergenic
1014000600 6:116361835-116361857 GATGACATAATGCATTAAACAGG - Intronic
1014340479 6:120199857-120199879 AATGAGATGATCAATTTTAATGG + Intergenic
1014368905 6:120580473-120580495 AATGAGATCATGTATTTTGAGGG - Intergenic
1014495712 6:122119284-122119306 GATTAAATAGTTCATTTTAAGGG - Intergenic
1014944813 6:127484798-127484820 GCTGAGATAATGTATGTGAAGGG - Intronic
1015265085 6:131283483-131283505 AATGAGTTTATGCATTTTCATGG + Exonic
1015341636 6:132107663-132107685 TAGGAGATAATGCTGTTTAAAGG - Intergenic
1015461540 6:133497087-133497109 AATGAGAGAATGCATTTCACAGG - Intronic
1015866023 6:137727622-137727644 GATGAGAAAGAGCATTTCAAAGG + Intergenic
1017529421 6:155274027-155274049 AATAAGTTAATACATTTTAAGGG - Intronic
1017540524 6:155397670-155397692 GATGAGATAATACATTCAAAAGG + Intronic
1018125173 6:160675816-160675838 AATGAGATAATGCCTTTTACAGG + Intergenic
1018160190 6:161033475-161033497 AATGAGAAATTGCATTTTGAAGG + Intronic
1018276203 6:162134126-162134148 GATGAGAAAATGGATTTGCAAGG + Intronic
1018366469 6:163124909-163124931 CATGAGATTATACATTTTGAAGG - Intronic
1019665390 7:2249698-2249720 GACCAGATAATGCATTCTAGGGG + Intronic
1021169356 7:17379628-17379650 GTTGAGAAAATGCAATTTATTGG - Intergenic
1022054857 7:26719820-26719842 TATGAGTTAATTCATTTTTATGG - Intronic
1022856707 7:34321995-34322017 TATCAAATAATACATTTTAAGGG - Intergenic
1023081370 7:36529656-36529678 GATGAGATAATGCTAATGAAGGG - Intronic
1023234402 7:38068605-38068627 GATGAGGTAATGCATTTAGTGGG + Intergenic
1024465777 7:49710277-49710299 GATGAGATAATGTATGTAAAGGG - Intergenic
1024612857 7:51081984-51082006 GATGATCAAATGTATTTTAAGGG + Intronic
1025964493 7:66255370-66255392 GTTGAGAAACTGTATTTTAAAGG + Intronic
1026251118 7:68671653-68671675 GAAGAGAAAATGCATATCAAAGG + Intergenic
1027711214 7:81603864-81603886 GATGATAAAATGCATAGTAAGGG + Intergenic
1027874638 7:83753052-83753074 GAAGAGATAAGCCATTTGAAAGG + Intergenic
1028067096 7:86400165-86400187 GTTGTGATAATGCATTTTTATGG + Intergenic
1028229355 7:88287798-88287820 GATTAGATATTACATTTTAGGGG - Intronic
1028478149 7:91274135-91274157 GATAAGATAATTCATTGTCATGG - Intergenic
1028506741 7:91579555-91579577 GAGGAGAAAATGATTTTTAAAGG + Intergenic
1028770763 7:94618149-94618171 AGTGAGATAATGCATTTGAAAGG - Intronic
1029023185 7:97386558-97386580 GCTGTGATAATTCCTTTTAATGG + Intergenic
1030016837 7:105231246-105231268 GAAGAGATAATGTATTTTGTGGG - Intronic
1030028905 7:105351116-105351138 AATGAGTTAACGAATTTTAACGG + Intronic
1030552270 7:110977439-110977461 AATGAGATAATAAATTATAATGG + Intronic
1031944236 7:127822041-127822063 GAGTAGATAATGCATTTAATTGG + Intronic
1032428327 7:131839934-131839956 AATGAGATAATGCCTTAAAACGG - Intergenic
1032582941 7:133120078-133120100 GAAAATATAATGCATTTTTATGG - Intergenic
1032649373 7:133860836-133860858 GTTGAGATCATACATATTAATGG - Intronic
1034840304 7:154389283-154389305 GATAAGATAAGGAAGTTTAATGG + Intronic
1035878195 8:3214435-3214457 AATGAGATGCTGCATTTTAAAGG + Intronic
1036758630 8:11491113-11491135 GATGAGAATCTGCATTTTATGGG - Intergenic
1036964922 8:13286410-13286432 AATGATAAAATGTATTTTAATGG + Intronic
1037736847 8:21574105-21574127 GTTGAATGAATGCATTTTAAAGG - Intergenic
1037779431 8:21857626-21857648 TATGAGATAATGGATGTGAAAGG + Intergenic
1038527286 8:28286972-28286994 AATGAGAAATTGGATTTTAATGG - Intergenic
1039175616 8:34801004-34801026 ATTGAGATAATGCAATTTCAAGG + Intergenic
1041166726 8:55099557-55099579 GATGAGATCATGTATATTACAGG - Intergenic
1041171734 8:55149407-55149429 CAGGAGATGATGCATTTGAAAGG + Intronic
1041410787 8:57552267-57552289 CATGAAATAATGCATTCTCAGGG - Intergenic
1043198700 8:77334692-77334714 GAGGATACATTGCATTTTAATGG + Intergenic
1043364078 8:79511103-79511125 GATAAAATAAAGAATTTTAAAGG + Intergenic
1044203840 8:89468129-89468151 AATGATATAATGGATTTTGAGGG - Intergenic
1044719276 8:95130137-95130159 GATGAGATAAAGTGTTTTGAAGG + Intergenic
1045829204 8:106437881-106437903 TATTAGACAATGCATTTTAGGGG - Intronic
1046298115 8:112248507-112248529 GATGAGATAAGGGATATTTAGGG + Intronic
1047505510 8:125476551-125476573 GATGAGATAATGCTTACTAAAGG + Intergenic
1047527071 8:125642643-125642665 AATGAGTTAATGCATATCAAGGG - Intergenic
1048079820 8:131113762-131113784 GGAAAGATAATCCATTTTAATGG - Intergenic
1048099748 8:131337705-131337727 TATGTGATACAGCATTTTAATGG + Intergenic
1048429747 8:134359109-134359131 GCTGAGATAGGGCATTTGAATGG - Intergenic
1049650329 8:143763948-143763970 GATATGATAATTCATTTCAACGG + Intergenic
1050168251 9:2788973-2788995 CATTAGATAATGAATTTAAACGG - Intronic
1051065882 9:13102495-13102517 CTTGACATAATGCCTTTTAAGGG + Intergenic
1051335066 9:16058526-16058548 GAGGAGATAATGAATTTCAGTGG + Intronic
1052703476 9:31965975-31965997 AATGAGATAATGTATTTTGCAGG + Intergenic
1053189900 9:36055485-36055507 AATGAAATAATGCATGTAAAGGG - Intronic
1054814485 9:69461869-69461891 ATTGAGATAATGCATGTGAAGGG + Intronic
1055098003 9:72434308-72434330 GATCAGAATCTGCATTTTAATGG - Intergenic
1055600865 9:77917057-77917079 GAGGAGATAAAGAATTATAAAGG + Intronic
1057690602 9:97280695-97280717 GAAGGGAGAATGGATTTTAAGGG + Intergenic
1059075683 9:111191599-111191621 GATTAGATTATGCATATCAAAGG + Intergenic
1059465788 9:114467999-114468021 AATGAGATAACACATTTAAAGGG - Intronic
1059466367 9:114471279-114471301 AATGAGGTAATGCATATAAAGGG - Intronic
1059737359 9:117115576-117115598 AGTGAGATAATACATTTAAAAGG + Intronic
1186069801 X:5806755-5806777 AAAGAGAAAATGCATTATAAAGG - Intergenic
1186091914 X:6058397-6058419 GATGAGATAATTAATTTTCATGG - Intronic
1186900738 X:14052726-14052748 AATGAGATAATGCTTGTGAAGGG + Intergenic
1187478366 X:19631983-19632005 CATTAGATAAAGCATTTTAAAGG - Intronic
1188292934 X:28410948-28410970 GAAAAGGAAATGCATTTTAATGG + Intergenic
1188579818 X:31697878-31697900 GATGAAATAGTGGATTTAAATGG + Intronic
1188657856 X:32720251-32720273 TAGAAGACAATGCATTTTAACGG + Intronic
1189700155 X:43710165-43710187 CACGAGATAATGCATATGAAGGG + Intronic
1191011086 X:55760238-55760260 AATGAAATAATGCTTTTTATAGG + Intergenic
1191246711 X:58233873-58233895 AATGACATAAGGCATTCTAAGGG + Intergenic
1191669707 X:63737780-63737802 GATGAGTTGTTCCATTTTAAAGG + Intronic
1191910994 X:66149583-66149605 TATGAGATAATGTATTTGAGGGG - Intergenic
1192139610 X:68636388-68636410 GAGGAAATAATGCATTTCCATGG + Intergenic
1192165595 X:68825907-68825929 AATGAGACAATGCATGTGAAGGG - Intergenic
1192922959 X:75726836-75726858 AATGAGATTATGTATTTTATAGG - Intergenic
1193263957 X:79445606-79445628 AATGAGATAATGTATTTTGTGGG + Intergenic
1193809900 X:86039092-86039114 AATGAGACAATGCATTGTAGGGG + Intronic
1194376875 X:93147141-93147163 AGTGAGAAAATGCATTTCAAAGG + Intergenic
1195504746 X:105644250-105644272 GATGAGAAAATCAATATTAAGGG + Intronic
1196409153 X:115397566-115397588 TAAGAAATAATGCATTTTAAAGG + Intergenic
1196646759 X:118126400-118126422 AATGAGATAATGTTTTTAAAGGG - Intergenic
1196735903 X:118980950-118980972 GATGAGATAATTTATTTTCTTGG + Intronic
1198328113 X:135594843-135594865 GCTCAAATAATGCATTTTATTGG - Intergenic
1198339041 X:135696069-135696091 GCTCAAATAATGCATTTTATTGG + Intergenic
1198713592 X:139532359-139532381 GCTGAGATGTTGCATTTTCATGG + Intronic
1199070999 X:143475628-143475650 GTTTAAATGATGCATTTTAAGGG - Intergenic
1199326614 X:146505579-146505601 GATCAGATGATGAATTTCAATGG + Intergenic
1200857685 Y:7957222-7957244 GATGAGATAATGCATAAGTAGGG + Intergenic
1201226733 Y:11825737-11825759 GCAGAGATAATTCATTTTCATGG - Intergenic
1201622665 Y:15977932-15977954 GATGAGATAATGCATAAGTAGGG + Intergenic
1201629109 Y:16049626-16049648 GATGAGATCATGTATTTGGAAGG + Intergenic