ID: 965942639

View in Genome Browser
Species Human (GRCh38)
Location 3:174203316-174203338
Sequence TTCCTCTGTGCACGGTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965942639_965942641 -4 Left 965942639 3:174203316-174203338 CCACTTCACCGTGCACAGAGGAA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 965942641 3:174203335-174203357 GGAAGTGTATTCGTGCACAGAGG 0: 1
1: 0
2: 1
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965942639 Original CRISPR TTCCTCTGTGCACGGTGAAG TGG (reversed) Intronic