ID: 965944914

View in Genome Browser
Species Human (GRCh38)
Location 3:174228939-174228961
Sequence GAATCCATACTGTCTTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965944914_965944918 27 Left 965944914 3:174228939-174228961 CCCACTGAAGACAGTATGGATTC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 965944918 3:174228989-174229011 TGCCACAGTGTTGTATTTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965944914 Original CRISPR GAATCCATACTGTCTTCAGT GGG (reversed) Intronic
900960634 1:5917101-5917123 GAATCCGTACTCTCTTCTGGTGG + Intronic
907732217 1:57077728-57077750 TAATCCATACTGTATTTAATTGG - Intronic
909619962 1:77656652-77656674 GAATTTGTACTGTCTTCAGAGGG + Intronic
911185503 1:94900118-94900140 GAAGCCATACTGTTCTCAGTGGG - Intronic
915037055 1:152936539-152936561 GAATCCAGACTTTATTCTGTAGG + Intergenic
919275677 1:195413050-195413072 AAATCCAACTTGTCTTCAGTAGG - Intergenic
921132056 1:212228248-212228270 GAATATATACTGTGTTCAGAGGG + Intergenic
923272809 1:232372868-232372890 GAGTCAATGCTGTCGTCAGTGGG - Intergenic
923404667 1:233648038-233648060 GATTCCATAATATCTTCAGATGG - Intronic
924011806 1:239673094-239673116 GAAGCCATTCTGTCTTCTGCTGG - Intronic
924385982 1:243498269-243498291 GACTCCCTTCTGTCCTCAGTGGG - Intronic
1070682052 10:78455620-78455642 GAATCCAGGCTGTCTCCAGCTGG + Intergenic
1075253512 10:120905188-120905210 AAATCAAGAATGTCTTCAGTAGG + Intronic
1078344411 11:10532652-10532674 GAAGACATACTGTCTTTATTGGG - Intronic
1078678649 11:13452869-13452891 CAATGCTTACTGTCTTTAGTAGG + Intronic
1086781742 11:90915445-90915467 TGCTCCATACTGTCTTCACTCGG - Intergenic
1087232178 11:95678709-95678731 GAATTAACAATGTCTTCAGTTGG - Intergenic
1087385532 11:97464149-97464171 GCCTCCACACAGTCTTCAGTGGG + Intergenic
1093939295 12:25035292-25035314 GAAGCCAACCTGTTTTCAGTGGG + Intronic
1096789997 12:54038645-54038667 GAAACCACACTGGCTTCAGACGG - Intronic
1097600635 12:61688284-61688306 GAATTGATACAGTCTTCATTTGG + Intergenic
1101482948 12:105119909-105119931 GAATCAGTCCTCTCTTCAGTTGG - Intronic
1102609110 12:114095711-114095733 GAATACTTCCTGTCTTCAGGAGG - Intergenic
1105929985 13:25043241-25043263 GAATCAATACTGTTTCAAGTCGG - Intergenic
1106245404 13:27945267-27945289 GAGTCCAGCCTGTCTCCAGTAGG - Exonic
1108242250 13:48477481-48477503 GAATGTATAATTTCTTCAGTTGG + Intronic
1109091668 13:58053587-58053609 CCATGTATACTGTCTTCAGTAGG - Intergenic
1109720153 13:66265597-66265619 GAATCCATCCTGTCCTCAAAGGG + Intergenic
1110647813 13:77908597-77908619 GAATCCATTTCCTCTTCAGTGGG - Intronic
1111616122 13:90663896-90663918 TAATCCATGGTGTCTTCTGTTGG - Intergenic
1114063795 14:19043060-19043082 GAATACATCCTCCCTTCAGTCGG + Intergenic
1114098463 14:19356936-19356958 GAATACATCCTCCCTTCAGTCGG - Intergenic
1115277567 14:31624863-31624885 CAATCAATAATGTCTTCAGTTGG - Intronic
1118209945 14:63756213-63756235 GAATGAATACTGTTTTTAGTTGG + Intergenic
1118393778 14:65318328-65318350 GAATTCATCATGTCTTCAGAGGG - Intergenic
1125109091 15:36009917-36009939 GAATTCATACCATCTTCACTAGG + Intergenic
1125185070 15:36920679-36920701 GTATTCCTACTGTCTTCATTTGG - Intronic
1127256545 15:57298264-57298286 GAATCCCTGCTGTCTGCAGTAGG + Intronic
1132180967 15:99752642-99752664 GAATCCAGGCTGTCCTCAGGCGG - Intergenic
1138305304 16:55969126-55969148 GAAACCAGACTGGGTTCAGTAGG + Intergenic
1139024734 16:62801753-62801775 GAAGTCATACTGTCCCCAGTGGG + Intergenic
1139319224 16:66099924-66099946 GTCTCCATACTGTTTTCATTTGG + Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1142921438 17:3190590-3190612 GAATTTGTACTGTCTTCATTAGG - Intergenic
1147301788 17:39535116-39535138 GAAGCAATTCTGTCTTCAGGTGG - Exonic
1147922517 17:43926819-43926841 GAATCCTTACTGTCTAGAGGTGG + Intergenic
1150174419 17:63035603-63035625 TAATCCAAATGGTCTTCAGTGGG - Intronic
1156003014 18:32406754-32406776 GAAACCAAAATTTCTTCAGTGGG + Intronic
1159216088 18:65392564-65392586 GTATCCATACTGTATCCTGTGGG - Intergenic
1159292204 18:66437860-66437882 CAATCCCAACAGTCTTCAGTGGG - Intergenic
1164948344 19:32315106-32315128 GAATCCCTACTGACTCCAGGAGG - Intergenic
925520813 2:4743017-4743039 TAATCCATACTGATATCAGTGGG + Intergenic
926783225 2:16494869-16494891 GAAGCCATATTGTCTTTAGTGGG - Intergenic
927051193 2:19330992-19331014 GAATCAAGGCTGTCTTCTGTAGG - Intergenic
934148085 2:89115967-89115989 GGATACATTCTGTTTTCAGTGGG + Intergenic
934161722 2:89255983-89256005 GGATCCATATTTTCTTCAATGGG - Intergenic
934205562 2:89926432-89926454 GGATCCATATTTTCTTCAATGGG + Intergenic
934221201 2:90084642-90084664 GGATACATTCTGTTTTCAGTGGG - Intergenic
937702270 2:124877371-124877393 AAATGCAGACTGTCTTCAGCTGG + Intronic
938971184 2:136434387-136434409 GAATCCAAACTGTAGCCAGTAGG - Intergenic
942284448 2:174400823-174400845 GATTCCAAACTGACTTCAGAAGG + Intronic
942483269 2:176412583-176412605 GACCCCTTACTGTCATCAGTTGG + Intergenic
944556900 2:200896277-200896299 GTAGCCATACTGTCTTCTTTTGG + Intronic
1172355343 20:34276076-34276098 GAAAAGGTACTGTCTTCAGTGGG - Intergenic
1175447322 20:59032222-59032244 GAGTCCAGCCTGTCTCCAGTAGG + Exonic
1175543267 20:59761487-59761509 AACTCCAGAATGTCTTCAGTGGG + Intronic
1175569363 20:60007308-60007330 GTGTCAATTCTGTCTTCAGTTGG - Intronic
1178798532 21:35768523-35768545 GAAACAATCCTGTCTTCAGCGGG + Intronic
1180482286 22:15765693-15765715 GAATACATCCTCCCTTCAGTTGG + Intergenic
1181986636 22:26804486-26804508 GACTCCATCCTGTATACAGTTGG + Intergenic
951023258 3:17803640-17803662 GAATCCATTCTGTCTTATGTTGG + Intronic
951240392 3:20279854-20279876 GAAGCGTTACTGTATTCAGTTGG - Intergenic
958103977 3:89049373-89049395 GAATCCAGGCAGTCTTCTGTAGG - Intergenic
959391959 3:105786369-105786391 AAATCTATTCTGTCTCCAGTAGG - Intronic
959432044 3:106266228-106266250 TAATCCTCACTGTCTTAAGTTGG + Intergenic
962806821 3:138933394-138933416 GATTCCAAACAGTCTTCCGTTGG - Intergenic
965944914 3:174228939-174228961 GAATCCATACTGTCTTCAGTGGG - Intronic
968830753 4:2932035-2932057 GAGTCCTTACTGTCTCCAGAGGG + Exonic
974204164 4:58677984-58678006 TGTTCCATGCTGTCTTCAGTAGG + Intergenic
974800744 4:66814544-66814566 GTTTCTATGCTGTCTTCAGTGGG + Intergenic
976766262 4:88601591-88601613 GAATCCATCCTCTTTTCATTAGG + Intronic
976999937 4:91484620-91484642 GAATTCATACTATCTTCTATTGG + Intronic
978410429 4:108418956-108418978 GAATGAATACTGTTTTCAGAAGG + Intergenic
979117503 4:116845260-116845282 GAATCACAACTGTCTACAGTAGG - Intergenic
985177980 4:187223374-187223396 GACTCTATACTGTCTTAACTGGG + Intergenic
986070020 5:4272965-4272987 GACTCTTAACTGTCTTCAGTTGG + Intergenic
990594996 5:57303622-57303644 ACATCCCAACTGTCTTCAGTAGG - Intergenic
997245713 5:132347227-132347249 GAATGTATACTCTCTTCATTTGG + Intergenic
999529999 5:152452468-152452490 GAATCCATTGTTTCTTCTGTGGG + Intergenic
1000909503 5:167005140-167005162 GAATCCATACTATATTCCCTTGG - Intergenic
1011737069 6:90321526-90321548 CAATCCATACTGTCTCAAGTTGG - Intergenic
1022208307 7:28183727-28183749 GGATCCTCAGTGTCTTCAGTTGG - Intergenic
1024030830 7:45458230-45458252 GAATCAGCACTGCCTTCAGTGGG + Intergenic
1031022169 7:116640024-116640046 GAATTCACACTGACTTCATTAGG - Intergenic
1031946210 7:127843636-127843658 GAATCCATATATCCTTCAGTAGG - Intronic
1032362979 7:131273250-131273272 GAATCCCCAGTGTCTTCATTAGG - Intronic
1033207374 7:139434502-139434524 GAATCCATACTGCTTACAGAGGG - Intergenic
1038988444 8:32839026-32839048 AAATACATACTATCTTCAATGGG + Intergenic
1041480542 8:58315311-58315333 GAGTCCATCCTGTCTTGAGTCGG - Intergenic
1042516110 8:69661338-69661360 GAACCGACACTGCCTTCAGTGGG - Intergenic
1045252163 8:100491360-100491382 GCTTCCATGCTGTCTGCAGTGGG + Intergenic
1050378119 9:4994288-4994310 TAATCCTCACTGTCTTCAATAGG - Intronic
1050391375 9:5147292-5147314 GAGTCCAGACTGTCTCCTGTGGG - Intronic
1051608756 9:18941756-18941778 AAATCCATATTCTCTTCACTCGG + Exonic
1057955169 9:99401533-99401555 GAATCCCTATTGACTTCAGTAGG + Intergenic
1060357092 9:122919411-122919433 ATATCCATACTGTCTTCAGATGG + Exonic
1188253712 X:27932505-27932527 GAAACCATACTGTATCCATTGGG + Intergenic
1188793446 X:34434095-34434117 AAAAGAATACTGTCTTCAGTGGG - Intergenic
1189356282 X:40312293-40312315 GTGTCCATACTGTCTTCATTTGG + Intergenic
1194301186 X:92188066-92188088 GAATTCCTACTCTCTTCAATGGG - Intronic
1199471713 X:148202906-148202928 GGATCCAGATTGTCTGCAGTGGG - Intergenic