ID: 965945375

View in Genome Browser
Species Human (GRCh38)
Location 3:174234025-174234047
Sequence ATTCACATGGAACTTAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965945375_965945377 -10 Left 965945375 3:174234025-174234047 CCTATTTTAAGTTCCATGTGAAT 0: 1
1: 0
2: 5
3: 46
4: 376
Right 965945377 3:174234038-174234060 CCATGTGAATAGAAGTGTTTTGG 0: 1
1: 0
2: 0
3: 20
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965945375 Original CRISPR ATTCACATGGAACTTAAAAT AGG (reversed) Intronic
903084759 1:20845787-20845809 ATTCATATGGAACCAAAAAAAGG - Intronic
903094644 1:20959052-20959074 ATTCATATGGAACCAAAAAAGGG + Intronic
904979032 1:34480854-34480876 ATTCATATGGAACCAAAAAAGGG - Intergenic
905738282 1:40346739-40346761 ATTTACTTGGAAGTTTAAATTGG - Intronic
906332621 1:44900135-44900157 ATACACATGGACATTAAGATGGG + Intronic
906466720 1:46087791-46087813 ACTCACATGGAGCTTCAAAATGG + Intronic
906904010 1:49868283-49868305 ATTCACATGGAACCAAAAAAAGG + Intronic
906954759 1:50364082-50364104 ATTCATATGGAACCAAAAAAGGG + Intergenic
907014980 1:51003924-51003946 ATACCCAGGGAACTTAAAAGAGG + Intergenic
907561319 1:55391376-55391398 ATTCATATGGAACCAAAAAAGGG - Intergenic
907563796 1:55415740-55415762 ATTCATATGGAACCAAAAAAGGG - Intergenic
907996760 1:59640784-59640806 ATTTACTTGGAAATTAATATTGG - Intronic
908283728 1:62570562-62570584 ATTCACATGGAACCAAAAAAAGG + Intronic
908329786 1:63059812-63059834 ATTAACTTGGTATTTAAAATAGG + Intergenic
908512761 1:64862389-64862411 GTTGACATGAAAATTAAAATAGG + Intronic
908801794 1:67888267-67888289 ATGCACATGGAAATTAGAGTGGG + Intergenic
908992076 1:70103369-70103391 AATCACATGGGCCTTAAAAATGG + Intronic
909049144 1:70747394-70747416 ATTCATATGGAACCAAAAAAGGG - Intergenic
909979582 1:82082711-82082733 AATCACATGGACCCTAAAAGTGG - Intergenic
910041488 1:82857213-82857235 ATTGAAATGGAACTTACAAATGG + Intergenic
910341399 1:86192386-86192408 TTTCACAATGAACTTAAAAATGG - Intergenic
911321622 1:96420232-96420254 ACTCACATGGTACTGAGAATCGG - Intergenic
911631728 1:100191284-100191306 ATTAACATTGAACTTAAACTGGG + Exonic
911651569 1:100394778-100394800 ATACACACGGAACTAAAAATTGG + Intronic
911743629 1:101415222-101415244 ATTCATATGGAACCAAAAAAGGG + Intergenic
912117986 1:106431499-106431521 ACTCTCATGGAACTTGTAATGGG + Intergenic
912191071 1:107341418-107341440 ATTCCCATGAAAATTAAAACTGG + Intronic
912256289 1:108061839-108061861 ACTCACAGGGTACTTAAAAGAGG + Intergenic
913151735 1:116051220-116051242 ATTCATATGGAACCAAAAAAGGG + Intronic
914810682 1:151025535-151025557 GTCAACATGGACCTTAAAATTGG + Exonic
915348462 1:155209969-155209991 ATTCACATATAAGTTAAAGTAGG + Intronic
916042750 1:160975298-160975320 ATTCAATTGTAACTTACAATGGG + Intergenic
916366195 1:164030534-164030556 ATGCACATGGACATAAAAATGGG - Intergenic
917015384 1:170525502-170525524 GATGACATGGAACTAAAAATAGG + Intergenic
917284786 1:173412681-173412703 ATTCATATAGAATTTAAAAATGG + Intergenic
917381243 1:174410723-174410745 ATTCATATGGAACCAAAAAATGG - Intronic
917459813 1:175220413-175220435 TGTCACATGGCACATAAAATAGG + Intergenic
917572573 1:176283715-176283737 ATTCACATGGAACCAAAAAAGGG - Intergenic
917781606 1:178403440-178403462 ATTCATAGGGAATATAAAATAGG + Intronic
918137883 1:181692309-181692331 ATTTACATGGAGCTAAAAAAGGG + Intronic
918389390 1:184042287-184042309 ATTCATATGGAACAAAAAAGAGG + Intergenic
918629588 1:186700543-186700565 ATTGACAAGAAACTTAAAAGAGG - Intergenic
919010682 1:191958187-191958209 ATACTCATAGAACTAAAAATAGG + Intergenic
919383585 1:196890505-196890527 ATTTACATTTAATTTAAAATAGG + Intronic
919394351 1:197025533-197025555 TTTCTCAAAGAACTTAAAATAGG - Intergenic
920040591 1:203092948-203092970 ATACACATGGTAGTTAAACTAGG - Intronic
920265336 1:204717295-204717317 ATACAGATGGTACTTAAAGTCGG + Intergenic
921129125 1:212204600-212204622 ATTCACCTGGAGTTTAAAATTGG + Intergenic
921919139 1:220646563-220646585 ATTCATATGGAACCAAAAAAGGG + Intronic
921971759 1:221156848-221156870 AATCATTTGTAACTTAAAATTGG + Intergenic
924080516 1:240392631-240392653 ATTAAAATTGAACTAAAAATTGG - Intronic
924307469 1:242705472-242705494 ATTCATATGGAACCAAAAAAGGG + Intergenic
1062991138 10:1820062-1820084 ATTAACAAGGAACTCAAAACAGG + Intergenic
1063073393 10:2689781-2689803 CTTCCCATGCAACTGAAAATTGG - Intergenic
1064374499 10:14783414-14783436 AATCAAAGTGAACTTAAAATGGG + Intergenic
1064608722 10:17074171-17074193 GCTCACAAGGAACTTACAATAGG + Intronic
1064747452 10:18491795-18491817 ATTCCCTTGGAACTTCAAGTTGG + Intronic
1065339659 10:24693011-24693033 ATTCACACGAAAGTTCAAATAGG + Intronic
1065826404 10:29576047-29576069 TTTCCCATGAAACTTGAAATTGG + Intronic
1065911781 10:30312988-30313010 ATTCACATATAAATTAAAGTGGG - Exonic
1066236971 10:33494604-33494626 ATTCAGAAGCAAATTAAAATTGG + Intergenic
1066997234 10:42575478-42575500 AATCACATGGACCATAAACTGGG - Intronic
1068125737 10:52840150-52840172 TTCCACATGAAATTTAAAATAGG + Intergenic
1068344209 10:55750322-55750344 ACTTACATGGAACTTAATGTAGG + Intergenic
1069240446 10:66131556-66131578 ATTCATATGGAACCAAAAAAAGG + Intronic
1071460200 10:85886457-85886479 ACTCTCATGGGACTTGAAATGGG + Intronic
1072400070 10:95088825-95088847 ATTCATATGGAACAAAAAAAGGG + Intergenic
1072753540 10:98001508-98001530 ATTGAGATGGGACTTAGAATTGG - Intronic
1073558587 10:104478066-104478088 ATTCACATGGACCCTAAACCTGG - Intergenic
1075156806 10:119984495-119984517 ATTCATATGGAACCAAAAAAGGG - Intergenic
1077937791 11:6807747-6807769 ATTCATATGGAATTAAAAAAAGG - Intergenic
1078116864 11:8462118-8462140 AATTATATGTAACTTAAAATTGG - Intronic
1078302458 11:10146228-10146250 ATTCATATGGAACCAAAAAAGGG + Intronic
1078651742 11:13201241-13201263 ATTCATATGGAACCAAAAAAGGG + Intergenic
1079008986 11:16812914-16812936 ATTCACAAGAAACTGAAAAAAGG + Intronic
1079490120 11:20979431-20979453 ATTTACATGGAAGATAACATGGG - Intronic
1079742498 11:24080377-24080399 ATTTAAATGGAAAGTAAAATAGG + Intergenic
1080170836 11:29300607-29300629 ATTCACTTCTAAGTTAAAATGGG + Intergenic
1080402676 11:31951536-31951558 ATTCATATGGAACCAAAAAAGGG + Intronic
1081052911 11:38367497-38367519 ACTCTCCTGGAACATAAAATGGG + Intergenic
1081292139 11:41339579-41339601 GTTCCCATGGAAATTAAACTGGG - Intronic
1085743198 11:79094337-79094359 AGTCACATGGAATTTAAAAATGG - Intronic
1086389304 11:86345535-86345557 ATTCACAAGAAAATTAAAATAGG - Intronic
1087865464 11:103221298-103221320 ACTGACAAGGAACTTAATATCGG - Intronic
1088173336 11:107020612-107020634 CTTCATATTGAACTTAGAATTGG + Intergenic
1088317730 11:108524515-108524537 AGTTACATGGTACATAAAATAGG + Intronic
1088480606 11:110293426-110293448 ATACACCAGGAACTTAAAGTAGG + Intronic
1089965957 11:122655430-122655452 AATCACATGAAACTTGAGATGGG + Intergenic
1090111028 11:123909607-123909629 ATTTACATGGAAATTTACATAGG + Intergenic
1090707933 11:129356556-129356578 AATCACATGAGACTTTAAATTGG - Intergenic
1091893058 12:4077333-4077355 ATTCATATGGAACCAAAAAAGGG + Intergenic
1093014451 12:14142474-14142496 ATTCACATGGACATAAAGATGGG - Intergenic
1093264343 12:16983765-16983787 CTTCACATGAAAATAAAAATGGG + Intergenic
1095303839 12:40617899-40617921 ATTCACTTGGTACTTTCAATTGG - Intergenic
1095346651 12:41158035-41158057 ATTCATATGGAACCAAAAAAGGG - Intergenic
1095575253 12:43730172-43730194 GGTCACATGGACCTTAAATTTGG + Exonic
1096355114 12:50934425-50934447 ATGCACTTGGCACTTAATATAGG + Intergenic
1096375008 12:51101720-51101742 ATTCACCTGGAAATGAAAAATGG + Intronic
1096943008 12:55369520-55369542 ATTGCCATGTAACTTAAAACTGG - Intergenic
1097764538 12:63510405-63510427 ATTCACATGCAGAATAAAATTGG + Intergenic
1098327707 12:69319521-69319543 ATTCATATGGAACCAAAAAGGGG - Intergenic
1098830415 12:75354636-75354658 ATTCATATGGAACCAAAAAAGGG + Intronic
1098848658 12:75568455-75568477 ATTTACATTGACCTTTAAATTGG + Intergenic
1098943410 12:76562717-76562739 ATTCTCATTGGAGTTAAAATCGG - Intergenic
1098989503 12:77049175-77049197 ATTCACATGGCATTTCTAATGGG - Intronic
1099032412 12:77543568-77543590 ATTCATATGGAACCGAAAAAGGG + Intergenic
1099380222 12:81943983-81944005 ATTCACATGGAAATGAAAATTGG + Intergenic
1099553226 12:84074197-84074219 ATTCAAATGGAGATTAAAGTAGG + Intergenic
1099722210 12:86378337-86378359 ATTTACATGGGACTTGAATTTGG + Intronic
1099851568 12:88104266-88104288 ATTCAAAGTGAAATTAAAATGGG - Intronic
1103079401 12:118011579-118011601 AATCAAATGGAACTTTAAAATGG + Intergenic
1103179347 12:118895659-118895681 ATTCATATTGAACTAAAAAAGGG + Intergenic
1103408167 12:120690607-120690629 TTTTACATGGAATTAAAAATAGG + Intronic
1106043761 13:26118334-26118356 GTCAACATGGACCTTAAAATTGG - Intergenic
1106968425 13:35103610-35103632 ATCCAAGTGGAACTAAAAATAGG - Intronic
1107081346 13:36378125-36378147 ATACATATGGAATTTAAATTGGG + Intergenic
1107100881 13:36589926-36589948 TTTCACATGGATTTTAGAATCGG + Intergenic
1107274315 13:38660129-38660151 AGTCACATTGATCTAAAAATAGG + Intergenic
1109301947 13:60598775-60598797 ATTCATATGGAACCAAAAAAGGG + Intergenic
1110101094 13:71603823-71603845 ATTTACATGGAGCATAATATCGG - Intronic
1110635167 13:77758910-77758932 ATTCATATGGAACCAAAAAACGG - Intronic
1110926625 13:81162140-81162162 ATTGACATTGAAATTTAAATAGG - Intergenic
1111117108 13:83793574-83793596 AATGTCATGGACCTTAAAATAGG - Intergenic
1112947314 13:104945898-104945920 ATGTACATGGGACTTAAAATTGG + Intergenic
1113587875 13:111477569-111477591 ACTCCCATGGAACCAAAAATGGG - Intergenic
1114904786 14:27113739-27113761 ATTTATATGGAACTAAAAATGGG - Intergenic
1115141872 14:30181238-30181260 ATTCAAAGGGAATTTTAAATTGG - Intronic
1115413923 14:33109141-33109163 ATTCACATGGATCTTTGAAATGG - Intronic
1117430304 14:55652182-55652204 TTTCACATGGCTATTAAAATAGG - Intronic
1117948243 14:61054358-61054380 ATTCATATGGAACCAAAAAAGGG - Intronic
1120126322 14:80748255-80748277 ATTCACATGGAAGTTTCAAAGGG - Intronic
1123484559 15:20676955-20676977 ATCCAAGTGGAACTAAAAATAGG + Intergenic
1123537287 15:21246020-21246042 ATCCAAGTGGAACTAAAAATAGG + Intergenic
1124161242 15:27271854-27271876 GTTCACATCTAACTTAAACTGGG + Intronic
1125705761 15:41734267-41734289 ATTCACATTGTACTTTAAAGAGG - Intronic
1125867496 15:43066446-43066468 ATTCAAATGGAACCAAAAAAGGG - Intronic
1126896310 15:53260701-53260723 ATTCACATCAAACTCAAAATCGG + Intergenic
1126976009 15:54181530-54181552 ATTCACATGGAACCAAAAAAGGG - Intronic
1127182577 15:56438122-56438144 ATTCATATGGAACCAAAAAAGGG + Intronic
1127922863 15:63506506-63506528 AATCACATCAAACTTAAAAATGG + Intronic
1130079723 15:80722000-80722022 ATTAGCATGCAACTAAAAATAGG - Intronic
1130721556 15:86391174-86391196 ATTGACTTGTAACATAAAATTGG + Intronic
1130862961 15:87907857-87907879 ATTACCATAGAAATTAAAATGGG + Intronic
1131786659 15:95920459-95920481 ATCCAAATGGAATTTAATATTGG + Intergenic
1133497993 16:6338301-6338323 ATTAACATGGTATTAAAAATAGG - Intronic
1134627264 16:15731166-15731188 ATTTAAATGAAACTTAAAACTGG - Intronic
1137909938 16:52367321-52367343 CTTCACATGGCAGTTTAAATCGG + Intergenic
1138682831 16:58698586-58698608 ATTTACATGGCACTTAAAAATGG - Intergenic
1138827944 16:60343441-60343463 CTTCAAATGAAACTCAAAATAGG - Intergenic
1141075170 16:80999572-80999594 ATTCATATGGAACCAAAAAGGGG + Intronic
1141739406 16:85880832-85880854 ATTCACATGGCACTGAAGCTGGG + Intergenic
1143969210 17:10781366-10781388 ATTCACATGGAAATACAAAAAGG - Intergenic
1144407745 17:14968777-14968799 ATTCATATGGAACCAAAAAAGGG - Intergenic
1146071870 17:29689615-29689637 ATTCACCTGTAACTTGTAATAGG - Intronic
1148255284 17:46125655-46125677 ATTCAAAGGAAACATAAAATGGG + Intronic
1149117378 17:53113792-53113814 ATTGCCATGGAACTGAAAATGGG - Intergenic
1149118661 17:53133127-53133149 AATCAGATGGTAATTAAAATAGG + Intergenic
1149212102 17:54315737-54315759 TTTCACATAGATTTTAAAATTGG + Intergenic
1153349728 18:4065825-4065847 ATTCACATGGAACAAAAAAAGGG + Intronic
1153351793 18:4089458-4089480 ATTCATATGGAACCAAAAAAGGG + Intronic
1153556526 18:6320749-6320771 ATTCATATGGAACCAAAAATGGG + Intronic
1153593922 18:6704449-6704471 GTTCATATGGAACCAAAAATGGG + Intergenic
1154046419 18:10909777-10909799 TTTCACATGGAACTAAAGCTGGG + Intronic
1154492290 18:14931637-14931659 CTGCGCATGGAACATAAAATAGG + Intergenic
1155503628 18:26511942-26511964 ATGCACATGGAACTAAGAGTTGG - Intronic
1155627863 18:27857153-27857175 ATTCATATGGAACCAAAAAATGG - Intergenic
1155792264 18:29988096-29988118 AATTAAATGCAACTTAAAATGGG - Intergenic
1156124777 18:33890528-33890550 ATTCATATGGAACCAAAAACAGG + Intronic
1156719427 18:40051439-40051461 AATCACATGCATGTTAAAATTGG - Intergenic
1158103699 18:53860881-53860903 ATTCTCATAAAAATTAAAATTGG - Intergenic
1159117466 18:64132072-64132094 ATTTACATTTTACTTAAAATTGG - Intergenic
1165548655 19:36563782-36563804 ATTCACATGGAACCAAAAAAGGG + Intronic
1166734843 19:45078039-45078061 GTTGCCATGGAACTTAAAATTGG - Intergenic
1168124055 19:54273361-54273383 ATTCATATGGAACCAAAAAGAGG + Intronic
1168178309 19:54642172-54642194 ATTCATATGGAACCAAAAAGAGG - Intronic
1168229788 19:55023013-55023035 ATTCATATGGAACCAAAAAAGGG + Intronic
926257794 2:11223874-11223896 ATTCAAATGCAAATTAAAAAGGG + Intronic
926358288 2:12061437-12061459 ATTCACATTGCACTTTAACTGGG - Intergenic
926930847 2:18039398-18039420 AATCACATGGAAGTTATTATGGG - Intronic
930306809 2:49685003-49685025 ATTCATATGGAACCAAAAAAGGG + Intergenic
930529873 2:52575504-52575526 ATTTACATGGAAATGAAAAAGGG - Intergenic
930628295 2:53723590-53723612 ATTCATATGGAACCAAAAAAGGG + Intronic
931025144 2:58104715-58104737 ATTCACATAGAACTGAAAAGGGG + Intronic
931554066 2:63480392-63480414 ATTCATATGGAACCAAAAAAGGG + Intronic
932672111 2:73746854-73746876 CTTGACAAGGAACTGAAAATGGG + Intergenic
932988522 2:76758042-76758064 ATTCATATGGAAACTGAAATAGG - Intronic
933081665 2:77996130-77996152 ATTCATATAGTAGTTAAAATTGG - Intergenic
933371056 2:81416094-81416116 ATTCAAATGGAATTTAAGTTTGG + Intergenic
934879633 2:97964506-97964528 AATCACATGCAACTAAGAATTGG + Intronic
934996170 2:98962851-98962873 AATTATATGGAACTTAAAAAAGG - Intergenic
935805039 2:106737328-106737350 AATGTTATGGAACTTAAAATAGG - Intergenic
935952243 2:108340769-108340791 ATTCACATGGAACCAAAAAAGGG - Intergenic
936036110 2:109113118-109113140 GTTCACATGGAACCAAAAAAGGG - Intergenic
936063035 2:109308908-109308930 GTTCACATGGAACCAAAAAAGGG - Intronic
936253771 2:110890795-110890817 ATTCACATGGGAATTAGAAGGGG - Intronic
936642227 2:114326763-114326785 ATTTACATGGAAATGCAAATGGG - Intergenic
937059971 2:118973858-118973880 ATCCTCATGGAACTTTCAATAGG - Intronic
938832617 2:135068386-135068408 TTTCACTTTGAACTTAAATTTGG + Intronic
938999904 2:136722191-136722213 ATACACATAGAAATAAAAATAGG - Intergenic
939170301 2:138688023-138688045 GTTCACATGGAACCAAAAAAGGG - Intronic
941680018 2:168387745-168387767 ATTCATATGGAACCAAAAAAGGG + Intergenic
942126029 2:172826545-172826567 AAGCACATAGAACTTAAAAATGG + Intronic
942279631 2:174347113-174347135 ATTAACATTGATATTAAAATTGG + Intergenic
942279638 2:174347172-174347194 AATCACAAGGTCCTTAAAATTGG + Intergenic
943589229 2:189777932-189777954 ATTCAAAGGAAACTTAAATTTGG + Intronic
944405405 2:199378317-199378339 ATTCACATGGAAGTCGAAATGGG - Intronic
944955986 2:204809725-204809747 ACTCAAATGGAACTAAAAAAGGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946661515 2:222005663-222005685 ATTCACCTGGCACTTAAATCTGG - Intergenic
948401029 2:237685600-237685622 ATTCCCATGGAGCTCACAATCGG + Intronic
1169969807 20:11257545-11257567 ATTTATATGGAACTAAAAAAGGG + Intergenic
1170163335 20:13337874-13337896 GTACACATGGAACTTACAAAAGG + Intergenic
1170411522 20:16097206-16097228 AGTCACATGTCACTTAATATTGG + Intergenic
1170441188 20:16380481-16380503 ATTCACATTTAATTTAAATTGGG - Intronic
1170669113 20:18414214-18414236 TTTCACATGGAATTTCAACTAGG - Intronic
1172922231 20:38494321-38494343 TTTCACATGGAATTAAAAACAGG + Intronic
1174032355 20:47640030-47640052 TTTCTCATGGCACTCAAAATAGG + Exonic
1174722878 20:52832410-52832432 TTTCAAATGGAGATTAAAATGGG - Intergenic
1174741231 20:53016066-53016088 AGTAACATGGAATTTAAAAATGG + Intronic
1175713823 20:61242268-61242290 ATTTGCATGTAACTTAAAAGCGG - Intergenic
1176881544 21:14200772-14200794 ATTCACATGGAACCAAAAAAGGG + Intronic
1177476937 21:21635554-21635576 AGTCACATAGAACTAAAAAGAGG + Intergenic
1177612897 21:23475885-23475907 ATTCAGATAGAATGTAAAATAGG - Intergenic
1178203587 21:30437050-30437072 ATCCACATGGCACATAAAATAGG + Intergenic
1178573964 21:33768249-33768271 GTTCACATTAAATTTAAAATAGG - Intronic
1179313492 21:40218477-40218499 ATTCATATGGAACCAAAAAAAGG - Intronic
1179933422 21:44587536-44587558 ATTCATATGGAACCAAAAAAGGG + Intronic
1183376257 22:37467272-37467294 ATCCACATGCACCCTAAAATGGG + Intergenic
949481153 3:4494558-4494580 GTTTAGATAGAACTTAAAATAGG - Intronic
950313598 3:11980328-11980350 ATTCATATGCACCTTAAAATTGG - Intergenic
951161693 3:19430467-19430489 ATTCATATGGAACCAAAAAAGGG - Intronic
951287170 3:20827158-20827180 AGTTACATGGAAATTAAACTAGG + Intergenic
951518027 3:23583413-23583435 ATTCATATGGAACCAAAAAAGGG - Intronic
953045704 3:39292342-39292364 AGTCACAAGGAACTTAGAAATGG - Intergenic
954483287 3:50821991-50822013 ATTCATATGGAATTAAAAAAAGG - Intronic
955595056 3:60580486-60580508 ATTAAAATGGAAGTTGAAATAGG - Intronic
955636732 3:61038124-61038146 ATTAATATGGAACTTTAAAATGG + Intronic
956654376 3:71534960-71534982 CTTCACACTGAACTTGAAATTGG + Intronic
956995279 3:74820111-74820133 ATTCATATGGAACCTAAAAACGG - Intergenic
957260327 3:77893694-77893716 ATTGACATGAAAATGAAAATAGG + Intergenic
957463152 3:80549042-80549064 ATTGACATGAAAGTTAAAGTTGG - Intergenic
957733507 3:84176120-84176142 ATTCACATGGCACCAAAAAAGGG + Intergenic
958463029 3:94422940-94422962 ATTCATATGGAACCAAAAAAAGG + Intergenic
959367225 3:105476778-105476800 TTAGACATGGTACTTAAAATGGG - Intronic
959541789 3:107548584-107548606 TTTCTCAAAGAACTTAAAATAGG + Intronic
962645001 3:137429508-137429530 ATTTATATGGAGTTTAAAATAGG + Intergenic
964042766 3:152283064-152283086 ATTCACATGGAAGGTCAAACTGG + Intronic
964081715 3:152766918-152766940 ATTCATATGGAACCAAAAAAGGG + Intergenic
964138028 3:153367439-153367461 ATTCATATGGAACCAAAAAAGGG - Intergenic
964325346 3:155539895-155539917 ATTCATATGGAACTAAAAGAGGG + Intronic
964863642 3:161229975-161229997 ATTTAAATAGAAATTAAAATGGG + Intronic
965087772 3:164121487-164121509 ATTCATATGGAACCAAAAAAGGG + Intergenic
965945375 3:174234025-174234047 ATTCACATGGAACTTAAAATAGG - Intronic
966369096 3:179227843-179227865 ATTCACATAGAAAATTAAATAGG - Intronic
967357080 3:188583602-188583624 GTCCTCATGGAACTTAAAATGGG - Intronic
969959743 4:10932620-10932642 ATTCACATGGTACTTAGGAATGG - Intergenic
970086896 4:12358979-12359001 ATACCAATGGAACTTAAATTAGG + Intergenic
971838540 4:31801690-31801712 ATTCACATGGAACCAAAAAAAGG - Intergenic
972188698 4:36564425-36564447 ATTCACTTGGAACCAAAAAAGGG - Intergenic
972219163 4:36934472-36934494 ATTCACATGGAAGAAAAAAAGGG + Intergenic
973001464 4:44956749-44956771 ATTCATATGGAACCAAAAAAAGG - Intergenic
974951290 4:68585798-68585820 ATTCATATGGAACCAAAAAAGGG + Intronic
975538263 4:75475006-75475028 ATTCACATGAAAATTACCATAGG + Intergenic
977058768 4:92229263-92229285 ATACACATGGACATAAAAATGGG + Intergenic
978208608 4:106109281-106109303 ATTCATATGGAACCAAAAAAGGG + Intronic
979577765 4:122315521-122315543 GTTCACATGGATCCTAACATTGG + Exonic
979651830 4:123142787-123142809 GTATACATGGATCTTAAAATAGG + Intronic
979855661 4:125630588-125630610 ATAAACATGGAAAATAAAATTGG - Intergenic
980199331 4:129635120-129635142 ATTCACTTGAACTTTAAAATTGG - Intergenic
980276429 4:130657025-130657047 ATTCATATGGAACCAAAAAGAGG + Intergenic
981728362 4:147871709-147871731 ATGTACTTGGAACTTATAATTGG + Intronic
982999462 4:162395493-162395515 ATTCATATGGAACCAAAAAGGGG + Intergenic
983647849 4:170010001-170010023 ATTCCCACGCAAATTAAAATAGG - Intronic
983767550 4:171504240-171504262 ATTCACGTGGAACCAAAAAGGGG + Intergenic
983825928 4:172260079-172260101 ATTCATATGGAACCAAAAAACGG - Intronic
984095852 4:175433206-175433228 AATCACATGGAACATGAAAGGGG + Intergenic
984438777 4:179738955-179738977 AGTCACATGTAACTTTAAAGTGG - Intergenic
987796192 5:22630269-22630291 ATTCATATGGAACCAAAAAAGGG + Intronic
987831513 5:23101807-23101829 GTACACATGGAAATAAAAATGGG + Intergenic
988272512 5:29034675-29034697 ATTCTCAGAGTACTTAAAATGGG + Intergenic
989016123 5:36936657-36936679 ATCCACAAGGAAGGTAAAATGGG - Intronic
989484507 5:41973684-41973706 TTTCTCAAGGAACTTAAAACAGG + Intergenic
989663650 5:43825418-43825440 ATTCATATGGAACCAAAAAAGGG - Intergenic
991605837 5:68400061-68400083 ATTCACACCAAACTTAATATTGG + Intergenic
992294410 5:75313352-75313374 ATTAAAAAGGAACATAAAATGGG - Intergenic
992298046 5:75346356-75346378 ATTAAGATGAAACTTAAAATAGG - Intronic
992757144 5:79918344-79918366 ATTCACATGGAAACAAAAAAAGG + Intergenic
992879503 5:81092223-81092245 ATTTAAATGTAACTTGAAATAGG + Intronic
993985068 5:94587702-94587724 TTTCATATGGAACCAAAAATGGG + Intronic
994480514 5:100328410-100328432 ATTCATATGGAACCAAAAAAGGG - Intergenic
994698709 5:103105332-103105354 ATTCACATGGAACATAAATCTGG + Intronic
994712027 5:103277350-103277372 ATTCACCTGGAACTTTAAATGGG + Exonic
994764807 5:103902627-103902649 ATTCATATGGAACAAAAAAAGGG + Intergenic
995273560 5:110251278-110251300 ATTCACACTGAACTTCTAATAGG - Intergenic
997115931 5:131125798-131125820 ATTCATATGGAACTAAAAAAGGG + Intergenic
998688915 5:144564871-144564893 ATTCAAATGGAAACCAAAATTGG - Intergenic
999402532 5:151277330-151277352 ATCCACATGGAAGTCAAACTGGG + Exonic
1000523844 5:162330991-162331013 ATTCATATGGAACTAAAAAAGGG + Intergenic
1000612796 5:163393266-163393288 ATTCATATGGAACCAAAAATGGG + Intergenic
1003021460 6:2513504-2513526 AGTCACATAAAACTTAAATTTGG + Intergenic
1004081556 6:12399423-12399445 ATTCACATGGAACCAAAAAAAGG + Intergenic
1005459197 6:26052212-26052234 ATTCATTTGGAAATTAAAATTGG - Intergenic
1007190673 6:40014997-40015019 TTTCATATGGAACCAAAAATGGG - Intergenic
1007790057 6:44303682-44303704 ATCCACATGGAGCTTACAAGGGG + Intronic
1008362560 6:50638589-50638611 GTTCACATGGAGCTTAAAAAGGG + Intergenic
1008660603 6:53663823-53663845 ATTATCATAGAACTGAAAATTGG + Intronic
1008836956 6:55845361-55845383 ATTCACCTGGAACCTACAATGGG + Intronic
1009488078 6:64250785-64250807 ACTCACATGGAAATTAATAGAGG - Intronic
1010979068 6:82349428-82349450 ATTCAAATAGTACTTAACATTGG - Intergenic
1011257138 6:85434310-85434332 ATTCATATGGAACCAAAAAAAGG - Intergenic
1011368939 6:86611657-86611679 AATAACATGGATCTAAAAATTGG + Intergenic
1011731643 6:90270734-90270756 ATTCACAAGGAACCAAAAAAAGG + Intronic
1012238693 6:96848047-96848069 ATTCATATGGAACCAAAAAAGGG + Intergenic
1012490262 6:99775395-99775417 ATTCTTATGGAACCAAAAATAGG - Intergenic
1012568111 6:100685536-100685558 ATTCTGATGCAAGTTAAAATAGG + Intronic
1012729257 6:102860005-102860027 ATTAAGATGGAATTTAAAAAAGG + Intergenic
1013438200 6:110134854-110134876 ATTCATATGGAACCAAAAAAGGG - Intronic
1013675264 6:112453034-112453056 ATTCACATTGAAGTTAACAGGGG - Intergenic
1014769979 6:125449638-125449660 ATTCTCCTGAAACTTAAAAAAGG + Intergenic
1015994603 6:138985228-138985250 ATTCAGATGGACTTTAAATTAGG - Intronic
1016519571 6:144931437-144931459 ATTCACATGTAACTGAAAGTGGG - Intergenic
1017069668 6:150564054-150564076 AAACACATGGAACTGAAAATGGG + Intergenic
1017100590 6:150846598-150846620 ATTCACATGCATCGTACAATAGG + Intergenic
1017352146 6:153454891-153454913 ATTCATATGGAACCAAAAAAGGG - Intergenic
1017394504 6:153981141-153981163 ATTCATATGGAACCAAAAAAGGG - Intergenic
1017703811 6:157101395-157101417 ATTCACACGGACCTAAGAATAGG + Intronic
1018574867 6:165249557-165249579 AATGACAAGGACCTTAAAATAGG - Intergenic
1018850331 6:167583951-167583973 ATGCAAATGGAAATCAAAATAGG + Intergenic
1019283177 7:210753-210775 ATTCACACGGACCATGAAATAGG - Intronic
1020813995 7:12881839-12881861 ATTCCCATGGATCTTTAACTTGG - Intergenic
1020918824 7:14234726-14234748 AATCTCATGGAACTTAGAAAAGG + Intronic
1021020948 7:15598421-15598443 AGTACCATTGAACTTAAAATGGG + Intergenic
1021833707 7:24645601-24645623 ATTCATATGGAACCAAAAAAGGG - Intronic
1022878153 7:34557175-34557197 TTTCATATGAATCTTAAAATAGG - Intergenic
1023656119 7:42422594-42422616 ATTCACATGGAATTTCCAAGTGG - Intergenic
1024168996 7:46764912-46764934 GTCAACATAGAACTTAAAATTGG + Intergenic
1024236003 7:47399334-47399356 ATTCATATGGAACCAAAAAGGGG + Intronic
1027558992 7:79703600-79703622 ATTAACATGGAACCAAAAAAGGG + Intergenic
1027881839 7:83849372-83849394 ATTCACATGGCTCTTTATATTGG + Intergenic
1028118840 7:87034225-87034247 ATTCACAAGTAACTTAAACATGG + Intronic
1028146013 7:87320710-87320732 TTTCATATGGAACTGAAAAAGGG + Intergenic
1028506450 7:91576142-91576164 ATTTATATGGAACTAAAAAAGGG - Intergenic
1028626691 7:92885807-92885829 ATTCATATGGAACCAAAAAAGGG - Intergenic
1028867237 7:95727562-95727584 AATCACATGGAATGTAAAATTGG + Intergenic
1028968655 7:96831431-96831453 ATTCACATGGAACTGAAATTGGG - Intergenic
1030068010 7:105675270-105675292 ATTCACAAGGAAATTCAAAATGG + Intronic
1030404004 7:109087805-109087827 CTTCACATGAATTTTAAAATAGG - Intergenic
1030944493 7:115699704-115699726 ATTCAAAAGGAATTCAAAATTGG + Intergenic
1031039380 7:116822876-116822898 ATTCATATGGAACCAAAAAAAGG - Intronic
1031282904 7:119827308-119827330 TTTCTCAAAGAACTTAAAATAGG - Intergenic
1032911905 7:136442240-136442262 ATTCATATGGAACCAAAAAAGGG - Intergenic
1033515373 7:142099986-142100008 ATTGAAATGGAAGTCAAAATAGG + Intronic
1033918906 7:146363113-146363135 ATTTACATAGCACTTATAATAGG + Intronic
1035660266 8:1342387-1342409 TATTACATGTAACTTAAAATCGG - Intergenic
1036498590 8:9293444-9293466 ATCCACATGGGACTGAAAACTGG - Intergenic
1037533618 8:19804356-19804378 AATCACGTGGAAATAAAAATTGG - Intergenic
1040026773 8:42788645-42788667 TTTCTCAAGGAACTAAAAATAGG + Intronic
1040668561 8:49659049-49659071 ACTGCCATGGAACTTAAACTAGG + Intergenic
1041165369 8:55086998-55087020 ATTCAAATGCAACACAAAATGGG + Intergenic
1041947806 8:63466185-63466207 ATTCAAATGGAGCTTAATTTGGG - Intergenic
1042214385 8:66415310-66415332 TTTCAGAAGGAACTTAAAAGAGG - Intergenic
1043768800 8:84170700-84170722 ATTCATATGGAACTAAGAAAGGG - Intergenic
1044038191 8:87332857-87332879 ATTCATATGGAACCAAAAAACGG - Intronic
1044876917 8:96678155-96678177 ATTCACATGGAACCAAAAAAGGG - Intronic
1045059115 8:98396917-98396939 ATTCACAAAGAACTTAGAATAGG - Intergenic
1045095743 8:98796150-98796172 ATTCATATGGAACCAAAAAAGGG + Intronic
1045916239 8:107475091-107475113 GTTCATATGGAACTAAAAAAGGG + Intronic
1046285180 8:112084443-112084465 ATTTCCATGGGACATAAAATAGG + Intergenic
1046407757 8:113796845-113796867 GTTCATATGGAACTTAAAGTTGG - Intergenic
1046515721 8:115257261-115257283 AATCACAAGATACTTAAAATAGG - Intergenic
1047347877 8:124046118-124046140 ATTTAAATGGCAATTAAAATTGG + Intronic
1047820223 8:128511166-128511188 ATTCACATGGTGCTGAAAATGGG - Intergenic
1048732333 8:137456955-137456977 ATTGACATGGAAGTTAGAAAGGG + Intergenic
1050179808 9:2909178-2909200 ATTAACATAGAACTCCAAATAGG + Intergenic
1050499869 9:6285745-6285767 ATTGAAAAGGACCTTAAAATTGG - Intergenic
1051044961 9:12861915-12861937 ATTCTCATGCAAATTAAAGTGGG - Intergenic
1051670954 9:19510093-19510115 ACTCACAAAGAACTCAAAATTGG - Exonic
1051929825 9:22371709-22371731 ATTCATATGGAACCCAAAAAGGG + Intergenic
1052342138 9:27374477-27374499 TTTCATAAGGACCTTAAAATTGG - Intronic
1053490170 9:38493711-38493733 ATTCATATGGAACCAAAAAAGGG + Intergenic
1054970925 9:71085791-71085813 TTTCTCAAAGAACTTAAAATAGG + Intronic
1057166659 9:92932813-92932835 ATTCACATGGAATTTACTTTGGG + Intergenic
1057365512 9:94417026-94417048 AATCTCATGAAACTCAAAATGGG - Intronic
1057657808 9:96971047-96971069 AATCTCATGAAACTCAAAATGGG + Intronic
1057670497 9:97083002-97083024 ATTCATATGGAACCAAAAAAGGG + Intergenic
1057811954 9:98264805-98264827 TTTCAGATGGAATATAAAATAGG - Intergenic
1058102722 9:100935047-100935069 ATTCACATGGAAACAAAAAAAGG - Intergenic
1058362113 9:104160284-104160306 ATTACCATGGATTTTAAAATTGG - Intergenic
1058386152 9:104438325-104438347 ATTCATATGGAACACAAAAAGGG - Intergenic
1058395983 9:104555006-104555028 ATTCATATGGAACCAAAAAAGGG + Intergenic
1058583342 9:106482087-106482109 ACTCACCTGCAACTGAAAATGGG - Intergenic
1058901615 9:109447142-109447164 ATTCACATGGAAATAACAAGGGG + Intronic
1186100931 X:6155990-6156012 TTTCTCAAGGAACTTAAAAGAGG + Intronic
1187054428 X:15728847-15728869 ATTCACATGGAACCAAAAAACGG - Intronic
1187584534 X:20645529-20645551 ATTCATATGGAACTAATAAAGGG + Intergenic
1187694102 X:21900861-21900883 ATTCACATGGCATTTCAAATAGG - Intergenic
1188855354 X:35187700-35187722 ATTCATATGGAACCAAAAAAAGG - Intergenic
1188899589 X:35713372-35713394 ATTCACTTGGTAATTAAAAGGGG + Intergenic
1188952104 X:36389077-36389099 ACTTACATGGAACTTAGAACAGG + Intergenic
1189208323 X:39261185-39261207 ATTCATCTTGAACTCAAAATGGG + Intergenic
1189527097 X:41834492-41834514 ATTAACAGGCAACTTCAAATTGG - Intronic
1190682067 X:52834971-52834993 ATTTACATGGAACTGAAAGTGGG - Intergenic
1190972218 X:55361226-55361248 ATTCATATGGAACCAAAAAAGGG + Intergenic
1191091238 X:56624577-56624599 TTTCATATGAAATTTAAAATAGG - Intergenic
1192669354 X:73123237-73123259 AGGCAAATGCAACTTAAAATGGG + Intergenic
1193162955 X:78248662-78248684 ATTCTCAAAGAACTAAAAATAGG - Intergenic
1193209744 X:78792532-78792554 ATTCATATGGAACCCAAAAAGGG + Intergenic
1194133381 X:90109397-90109419 TTTCACATGGAACCAAAAAGGGG - Intergenic
1195234470 X:102883094-102883116 ATTCACATGGAATAAAATATTGG + Intergenic
1195575569 X:106446263-106446285 TTTCACAAAGAACTTAAAACAGG + Intergenic
1196260246 X:113570699-113570721 ATTTGCATGGAACCAAAAATGGG - Intergenic
1196282267 X:113835597-113835619 ATTCAAAAGAAACTTAAAAGGGG - Intergenic
1196488298 X:116239818-116239840 ATTAACATGGAACTGGAAGTGGG - Intergenic
1196708579 X:118739086-118739108 TTTCTCAAAGAACTTAAAATAGG - Intronic
1197588625 X:128381726-128381748 ATTCACATGCAGAATAAAATTGG + Intergenic
1197596856 X:128474541-128474563 ATTCACAGAGAAAATAAAATAGG + Intergenic
1197625462 X:128797227-128797249 ATTAATATGGAACCAAAAATGGG + Intergenic
1197680875 X:129383055-129383077 ATGCACATGGACATAAAAATGGG + Intergenic
1197931813 X:131704205-131704227 ATTCACATGGAAAACAAAAGCGG + Intergenic
1197948227 X:131863513-131863535 ATTCAAATGTAACTCAAAAGGGG - Intergenic
1198766482 X:140084986-140085008 ATTTACATGGAATTTACTATTGG - Intergenic
1199192404 X:144985970-144985992 ATACACATGGAAATACAAATTGG + Intergenic
1199791497 X:151159772-151159794 ATTCATATGGAACCAAAAAAGGG - Intergenic
1200098882 X:153678652-153678674 AGACAGAGGGAACTTAAAATAGG - Intronic
1200479162 Y:3679496-3679518 TTTCACATGGAACCAAAAAGGGG - Intergenic
1201856042 Y:18544148-18544170 ATTCACAGGGAACTTATAATTGG + Intergenic
1201877279 Y:18776237-18776259 ATTCACAGGGAACTTATAATTGG - Intronic
1202019536 Y:20450284-20450306 ATTCAAAAGTAACTTAACATCGG - Intergenic