ID: 965948701 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:174276909-174276931 |
Sequence | CCACCTCTATAGGTTTCTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 127 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 118} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
965948697_965948701 | 4 | Left | 965948697 | 3:174276882-174276904 | CCACTATGTAGCTAAAGCAACAC | 0: 1 1: 0 2: 1 3: 6 4: 85 |
||
Right | 965948701 | 3:174276909-174276931 | CCACCTCTATAGGTTTCTCAGGG | 0: 1 1: 0 2: 0 3: 8 4: 118 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
965948701 | Original CRISPR | CCACCTCTATAGGTTTCTCA GGG | Intronic | ||