ID: 965948701

View in Genome Browser
Species Human (GRCh38)
Location 3:174276909-174276931
Sequence CCACCTCTATAGGTTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965948697_965948701 4 Left 965948697 3:174276882-174276904 CCACTATGTAGCTAAAGCAACAC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 965948701 3:174276909-174276931 CCACCTCTATAGGTTTCTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965948701 Original CRISPR CCACCTCTATAGGTTTCTCA GGG Intronic