ID: 965950070

View in Genome Browser
Species Human (GRCh38)
Location 3:174298229-174298251
Sequence ATATAATACTATGTGTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965950070_965950071 7 Left 965950070 3:174298229-174298251 CCTGCATACACATAGTATTATAT No data
Right 965950071 3:174298259-174298281 TCTATGACAGTCAACTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965950070 Original CRISPR ATATAATACTATGTGTATGC AGG (reversed) Intergenic
No off target data available for this crispr