ID: 965954856

View in Genome Browser
Species Human (GRCh38)
Location 3:174357531-174357553
Sequence ATGTACACACACATGAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965954856_965954862 13 Left 965954856 3:174357531-174357553 CCCCTCTTCATGTGTGTGTACAT No data
Right 965954862 3:174357567-174357589 CAAGGAACCACAGGAACAAAAGG No data
965954856_965954859 -5 Left 965954856 3:174357531-174357553 CCCCTCTTCATGTGTGTGTACAT No data
Right 965954859 3:174357549-174357571 TACATGTGTGTTTATGTCCAAGG No data
965954856_965954860 4 Left 965954856 3:174357531-174357553 CCCCTCTTCATGTGTGTGTACAT No data
Right 965954860 3:174357558-174357580 GTTTATGTCCAAGGAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965954856 Original CRISPR ATGTACACACACATGAAGAG GGG (reversed) Intergenic
No off target data available for this crispr