ID: 965958977

View in Genome Browser
Species Human (GRCh38)
Location 3:174406234-174406256
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965958974_965958977 19 Left 965958974 3:174406192-174406214 CCAGTTTGATGAGATAGCTTATG No data
Right 965958977 3:174406234-174406256 TAAATGCCCCTTTTTGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr