ID: 965961662

View in Genome Browser
Species Human (GRCh38)
Location 3:174436460-174436482
Sequence CTCTATGTTAAAATAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965961661_965961662 -8 Left 965961661 3:174436445-174436467 CCTGTGGCTGAGGCACTCTATGT 0: 1
1: 0
2: 0
3: 6
4: 113
Right 965961662 3:174436460-174436482 CTCTATGTTAAAATAGAGCAAGG 0: 1
1: 0
2: 1
3: 17
4: 224
965961660_965961662 -7 Left 965961660 3:174436444-174436466 CCCTGTGGCTGAGGCACTCTATG 0: 1
1: 0
2: 1
3: 17
4: 170
Right 965961662 3:174436460-174436482 CTCTATGTTAAAATAGAGCAAGG 0: 1
1: 0
2: 1
3: 17
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965961662 Original CRISPR CTCTATGTTAAAATAGAGCA AGG Intergenic
900348409 1:2222958-2222980 CTCGATGTTAAAATACAGAAAGG - Intergenic
902353310 1:15875759-15875781 GTCTAAGTTAAAACATAGCATGG + Intronic
903298195 1:22359256-22359278 CTCATTGTTTAAAAAGAGCATGG + Intergenic
903820931 1:26101959-26101981 CTCTATGGTTATTTAGAGCAGGG - Intergenic
904550204 1:31310195-31310217 ATTTATGTTAAAATAGATTAAGG + Intronic
904763921 1:32827348-32827370 CTGTATCTTAATATATAGCATGG - Intronic
906431740 1:45760877-45760899 CCTTATGTTAAAATACTGCAAGG - Intergenic
907197826 1:52700964-52700986 CTTGATGATAGAATAGAGCAGGG + Intergenic
908697824 1:66864832-66864854 CTCTGTCTCAAAAAAGAGCAAGG + Intronic
909255229 1:73411963-73411985 TTCTATTTTAAAATAGTGCAAGG - Intergenic
911414371 1:97552737-97552759 CTCTATTCTAAAATAGAAAAAGG + Intronic
912523803 1:110265990-110266012 CTCTATGTGAAAAGGGAACAAGG - Intronic
913526764 1:119701199-119701221 CTCTTTGCTAAAACATAGCAAGG - Intronic
915781304 1:158553641-158553663 TTTTATGTTAAATAAGAGCAGGG - Intergenic
916898845 1:169198883-169198905 CTTTGTGTAAAAATTGAGCAAGG - Intronic
918607095 1:186440885-186440907 CTCTATTTTAAATTAAGGCACGG + Intergenic
918664279 1:187130331-187130353 CAATATGTTTAAATAGTGCATGG - Intergenic
918734073 1:188037053-188037075 CTCTTTGTTAAAACATAACAAGG - Intergenic
918758709 1:188373108-188373130 CTCAAAGTTAAAATAGAGTCAGG - Intergenic
918870664 1:189969631-189969653 TTATATATTAAAATACAGCATGG - Intergenic
919221741 1:194639019-194639041 CTCTTTGCTAAAACATAGCAAGG - Intergenic
920079396 1:203361385-203361407 CTCTATGTTACATTAGAAGAGGG - Intergenic
920257897 1:204668586-204668608 CTCTGTCTCAAAAAAGAGCATGG + Intronic
922858948 1:228799004-228799026 TACTATGATAAAATAGAGCAGGG - Intergenic
922964326 1:229675391-229675413 CTCTATTTTAAAAGAGAGATAGG - Intergenic
924723435 1:246644886-246644908 CCCTCTGTTAAAATGGGGCAAGG - Intronic
1063311558 10:4957249-4957271 CTCTATGAAAAAACTGAGCAAGG + Intronic
1064098058 10:12438800-12438822 CTCTGTGGTAGAATGGAGCAAGG - Intronic
1067994170 10:51251170-51251192 CTCTATATTAAAATAGGAAAAGG - Intronic
1068147348 10:53088561-53088583 CTCTTTATTAACATAGATCAAGG - Intergenic
1068160703 10:53259234-53259256 CTCGATGTTAAAAGAAACCAGGG + Intergenic
1068223428 10:54073983-54074005 TGCTTTGTTAAAATAAAGCAGGG + Intronic
1068243481 10:54336026-54336048 CTCTTTGATAAAACATAGCAAGG - Intronic
1068756067 10:60654813-60654835 CTCTTTGAGAAAATAGAGGAAGG - Intronic
1069332999 10:67315663-67315685 CTCTATTTTTAAATGGAACAAGG + Intronic
1069576260 10:69531106-69531128 ATCTAGGTAAAAATGGAGCAAGG + Intergenic
1074077422 10:110141827-110141849 CTTTAAGTTAATATTGAGCAAGG + Intergenic
1075796684 10:125125301-125125323 CTCTGTGTTTAAATATAGCATGG - Intronic
1075959513 10:126556350-126556372 CTCCACGTTTAAATAGAACACGG + Intronic
1075996495 10:126880652-126880674 CTCTGTGCTAAAAGAGAGCTCGG - Intergenic
1076174178 10:128354139-128354161 TTCTATGTTAAAATTATGCATGG - Intergenic
1077793843 11:5470031-5470053 ATCCATGTTAAAATATAGAAAGG - Intronic
1078620744 11:12905493-12905515 AACTATGTTAAAATAAAGGAGGG + Intronic
1078716382 11:13843327-13843349 CTGTAAGTTAAAGTAGAGAAAGG + Intergenic
1079016860 11:16876255-16876277 CTCTATACTACCATAGAGCAAGG - Intronic
1079147688 11:17868346-17868368 CTCTTTGTTAAAACACAACAAGG + Intronic
1079557874 11:21783310-21783332 TTTTATGTAAAAATATAGCAAGG + Intergenic
1082692853 11:56326533-56326555 CTCTTTGCTAAAACATAGCAAGG - Intergenic
1082900024 11:58238223-58238245 TTCTATGGTAAAATGGAGCTGGG - Intergenic
1083974816 11:66109384-66109406 CTTTTTGTTAAAATAGAGATGGG - Intronic
1085214668 11:74818363-74818385 CTGTATATTAAAACAGAGCACGG - Intronic
1086560163 11:88158572-88158594 CACTATGATCAAATAGTGCAAGG + Intronic
1088507989 11:110544624-110544646 TTTTATATTAAAATATAGCAGGG + Intergenic
1090562619 11:127948751-127948773 CTCTAAGTTCATATAGTGCAAGG - Intergenic
1090692501 11:129198997-129199019 CTCTTTGCTAAAACATAGCAAGG - Intronic
1090947802 11:131447426-131447448 CTCTAATTGAAATTAGAGCAGGG - Intronic
1092276291 12:7063532-7063554 CTCTAGGTTAAAATGAAGCTAGG + Intronic
1093713319 12:22352847-22352869 CTGATTGTTAAAAAAGAGCATGG + Intronic
1098297089 12:69015039-69015061 ATATAATTTAAAATAGAGCATGG + Intergenic
1099420226 12:82449175-82449197 CTCTCTGTCAGAATAAAGCATGG - Intronic
1099561259 12:84176761-84176783 ATATATGTTAAAATAGATAATGG + Intergenic
1101158044 12:101946180-101946202 CTCTGTGTTAAGACAGTGCAGGG - Intronic
1101744033 12:107524352-107524374 CTCTATGTACACAGAGAGCAAGG - Intronic
1102578148 12:113870127-113870149 CTCTCTTGTAAAACAGAGCAGGG + Intronic
1105913487 13:24892243-24892265 ATCTCTGTTAAAACAGACCAGGG - Intronic
1106807747 13:33328447-33328469 CTCTGTGCTAAAACATAGCAAGG + Intronic
1107705594 13:43100511-43100533 GTCTATGTTAAAAAAGAAGACGG - Intronic
1109818515 13:67620173-67620195 TCCTATGATAAAACAGAGCAGGG + Intergenic
1110338517 13:74361760-74361782 TTTTAAGTTAAAATAAAGCAAGG - Intergenic
1111036233 13:82677837-82677859 CTCTTTGCTAAAACATAGCAAGG + Intergenic
1113522692 13:110951861-110951883 CTGCATTTTAAAATAAAGCATGG - Intergenic
1120101471 14:80450126-80450148 CTCTTTGCTAAAACATAGCAAGG - Intergenic
1126012057 15:44312486-44312508 CTCTTTGTTAAAATAAAAGAAGG + Intronic
1128710190 15:69865978-69866000 CTCTAGGTCCAAGTAGAGCAGGG + Intergenic
1133852121 16:9515132-9515154 CTCTATGTTCAACCAGAGAATGG - Intergenic
1137065945 16:35843551-35843573 TTCTATGGAAAAATAGACCATGG + Intergenic
1138467930 16:57206865-57206887 CTCTCTTTTAAAATATTGCAAGG - Intronic
1141118818 16:81335012-81335034 TTCTATGGAAAAATAAAGCAAGG + Intronic
1141503350 16:84459733-84459755 CTCTAGGGAAAAATACAGCAGGG - Intronic
1146035715 17:29404850-29404872 ATTTATGTTAAAATACAGAATGG - Intronic
1147240139 17:39085537-39085559 CTCTATGTTCAAACAGACCTTGG - Intronic
1148715252 17:49711223-49711245 CTCTATGGTAAAGTGGGGCAGGG + Exonic
1149008319 17:51828893-51828915 AGTTATGTTAAAATAGTGCATGG + Intronic
1149713846 17:58768245-58768267 CTCTATTTTAAAAAATAGCAGGG - Intronic
1150287198 17:63961098-63961120 CTGTATGTAAATATAGGGCACGG - Intronic
1154086031 18:11306454-11306476 CTCTATGTTAACATACTGCTTGG - Intergenic
1155275157 18:24180387-24180409 CTATATGTTAAAAGACGGCAAGG - Intronic
1155902457 18:31408114-31408136 CTCTCTCCTAAAATAGACCATGG - Intronic
1156048884 18:32907919-32907941 CTCCAGGGTAAAACAGAGCATGG + Intergenic
1156283174 18:35661881-35661903 TTTTATACTAAAATAGAGCATGG + Intronic
1158236352 18:55320322-55320344 ATCTTTTTTAAAAAAGAGCACGG - Intronic
1159580177 18:70226575-70226597 CTCTATGTTCCATTAGGGCATGG - Intergenic
1164632451 19:29770378-29770400 CTCCAGGTTAAAATAAGGCAGGG - Intergenic
1164840197 19:31387466-31387488 GTCTATGTGAAAATTCAGCACGG - Intergenic
1165671140 19:37680376-37680398 CTCTTTATTAAGATAGAGCGGGG - Intronic
1165971193 19:39631718-39631740 CTCTATTTTAAAGAAGAGCAGGG - Intergenic
1166443336 19:42835667-42835689 GTCTATGTTAAATTAAAACAGGG + Intronic
1166463026 19:43006321-43006343 GTCTATGTTAAATTAAAACAGGG + Intronic
1166480309 19:43166408-43166430 GTCTATGTTAAATTAAAACAGGG + Exonic
1166490128 19:43251953-43251975 GTCTATGTTAAATTAAAACAGGG + Intronic
1166749348 19:45157380-45157402 CACTAGGTAAAAATAAAGCAGGG - Intronic
1167624187 19:50576335-50576357 CTCTAAGTTAAAATAGATTAAGG + Intergenic
925589000 2:5491676-5491698 CTCTATGTAAGAACACAGCAAGG + Intergenic
927959542 2:27232432-27232454 CTCTGTGCTAAAATAGAAAAAGG - Exonic
930230055 2:48834460-48834482 CTCTTTGCTAAAGTATAGCAAGG - Intergenic
930487815 2:52030140-52030162 CTCCATTTTGAATTAGAGCAAGG + Intergenic
933400247 2:81787221-81787243 CTCTATGTTAAGATAGAGAAAGG - Intergenic
936227031 2:110664290-110664312 CACTATGTCACAATACAGCAGGG + Intronic
937723879 2:125136069-125136091 CTCTATGTTCCATTAGAGCATGG + Intergenic
938039120 2:128061290-128061312 CTCTATGTCAAAATAGAAATTGG + Intergenic
939260084 2:139795920-139795942 TGCTATGTTAAAAGAGAGCTTGG - Intergenic
939746212 2:145971840-145971862 ATCTATTTTAAAATAAAGAAGGG + Intergenic
939768082 2:146278773-146278795 CTCAATGTTATCATAGAGCCTGG - Intergenic
939789738 2:146556924-146556946 CTCTATGTAAAAATCCAGTATGG - Intergenic
939923093 2:148141222-148141244 CTGTATAGTAAAACAGAGCAAGG + Intronic
940604254 2:155899726-155899748 CTCTGTGTTTAAAAAGTGCAGGG - Intergenic
941160060 2:162025789-162025811 CTCTCTGACAAAAAAGAGCAAGG - Intronic
941480030 2:165996171-165996193 TTCAATGTTAAAATAGAAAATGG + Intronic
946086274 2:217176366-217176388 CTCCATGATATAAAAGAGCAAGG - Intergenic
947074758 2:226330435-226330457 TTCTTTCTTAAAATAGAGAAGGG + Intergenic
1169502352 20:6173048-6173070 TTCTAAGAAAAAATAGAGCAAGG + Intergenic
1170648086 20:18214321-18214343 ATTTATGTTAAAAGAGGGCAGGG + Intergenic
1173215062 20:41073480-41073502 CTCGATGGTAAAATAAAGCTAGG + Intronic
1173394195 20:42662729-42662751 CTCAGTGTTCAAATAGAGTAAGG - Intronic
1174741177 20:53015642-53015664 TTCTATGTTAAAATATAGGAGGG + Intronic
1177715435 21:24834456-24834478 TGCTATGGAAAAATAGAGCAGGG - Intergenic
1179964108 21:44791048-44791070 CTCTTTGTTGAAACATAGCAAGG - Intronic
1184632815 22:45798126-45798148 CTCTTTCATAAAATAGAGGAGGG + Intronic
951327464 3:21320958-21320980 CTATATGTTGAAATAGATGAAGG - Intergenic
952107166 3:30084045-30084067 CTTTATGTTAATATAGATCTAGG + Intergenic
952581027 3:34833651-34833673 CTACATGTTAAAAGAGAGCAGGG + Intergenic
953441947 3:42925806-42925828 TTAAATGTTAAAATAGAGCCTGG + Intronic
953715382 3:45312961-45312983 CTCTATTTTAACATACAGCCTGG - Intergenic
954988649 3:54818800-54818822 TTTTCTGTTAAAATAGAGAAAGG + Intronic
955166966 3:56524569-56524591 CTTGAGGTTAAGATAGAGCATGG + Intergenic
956263092 3:67366572-67366594 CACCATTTTAAAATAGAGCTTGG - Intronic
956378956 3:68645580-68645602 ATCTATCTTAAAATAGTGCCTGG - Intergenic
957154434 3:76529807-76529829 CCCTATGTTAAAATGCTGCAAGG - Intronic
958989449 3:100825481-100825503 CTCAATGTTAATATAGAACTCGG + Intronic
960257215 3:115523542-115523564 AGCTATGTTAAAAAAGAGGATGG + Intergenic
960422973 3:117471138-117471160 CTTTATGTAGAACTAGAGCAAGG - Intergenic
962577193 3:136765390-136765412 CTCTAGGTTAAAATATATTATGG + Intergenic
963639932 3:147847208-147847230 CTTTTTGTTAACATAGAGAATGG + Intergenic
964458094 3:156891173-156891195 CTCTTTGTTAAAAAGAAGCATGG - Intronic
965387246 3:168059759-168059781 CTCTATTTTAAAATGCAGCCTGG - Intronic
965764246 3:172113398-172113420 CTGTATGATAGATTAGAGCAGGG - Intronic
965961662 3:174436460-174436482 CTCTATGTTAAAATAGAGCAAGG + Intergenic
966049017 3:175590542-175590564 ATCTATGTTCAAATTTAGCAAGG + Intronic
966899806 3:184472979-184473001 TTCTAGGTTAAAAAAGAGTAAGG - Intronic
967651876 3:191995614-191995636 ATCTAAGTGAAAATAAAGCAGGG - Intergenic
968251627 3:197221782-197221804 CTCTATATTAAACAAAAGCAGGG - Intronic
970292120 4:14584432-14584454 CTCTCTGTACAAATATAGCATGG + Intergenic
970443659 4:16106684-16106706 CTCTTTGGTAAAATTGTGCAGGG + Intergenic
970766866 4:19560056-19560078 CTCTATGTAATAATAAATCAAGG - Intergenic
971150094 4:24022361-24022383 CGCTATGGGAAAAGAGAGCAGGG - Intergenic
972280279 4:37595687-37595709 CTCATTATTCAAATAGAGCAGGG - Intronic
972394317 4:38645621-38645643 CTGGATGTTAAAATAGAGCTGGG - Intergenic
974187283 4:58460341-58460363 CTCTGATTTAAAACAGAGCAAGG + Intergenic
974358119 4:60838556-60838578 CTGCAGGGTAAAATAGAGCAGGG - Intergenic
974646121 4:64695021-64695043 CTCTATGTGAGAGAAGAGCATGG - Intergenic
975795489 4:78002561-78002583 CTCTATTTTAAAGAAGAGCAGGG + Intergenic
976635901 4:87286235-87286257 CTCTTTGCTAAAACATAGCAAGG - Intergenic
977328201 4:95603750-95603772 GTCTATGATAAAATTCAGCACGG - Intergenic
977618486 4:99110187-99110209 CTCTTTATTAAAAAAAAGCAGGG - Intergenic
979070383 4:116196508-116196530 CACAATGTTAAAATAAATCATGG - Intergenic
979784162 4:124694318-124694340 CCCTTTGTTAAAACATAGCAGGG + Intronic
979990024 4:127364481-127364503 CTCTTTGTTAAAAAAGAAAATGG - Intergenic
980039342 4:127921434-127921456 GTCTGTGTAAAAATAGAGAATGG + Intronic
980615567 4:135219007-135219029 CTGTATATTAAAATGGAGCATGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982569155 4:157026640-157026662 ATGTATGTTAGAATATAGCATGG - Intergenic
983086650 4:163453431-163453453 CTCTATGATATAAAAGTGCAAGG - Intergenic
983276615 4:165625325-165625347 TTCAATGTCAACATAGAGCAAGG - Intergenic
984401849 4:179275907-179275929 ATCTATCTTAAAATAATGCAGGG - Intergenic
985811647 5:2094559-2094581 ATCTGAGTTAAAATAAAGCAGGG - Intergenic
986872510 5:12066575-12066597 CTCTATTTTAAAATAAAATAGGG - Intergenic
987510242 5:18828219-18828241 CTCTTTGCTAAAATATAACAAGG - Intergenic
987572503 5:19682718-19682740 CTCTCTGTTAAAATAAATGATGG + Intronic
990078255 5:51878676-51878698 ATTTATATTAAAATAGAACAGGG - Intergenic
990868060 5:60401487-60401509 CCTTATGTTAAAAAAGAGGATGG + Intronic
992571551 5:78064680-78064702 CTCTCTCTAAAAATACAGCATGG - Intronic
992753668 5:79884567-79884589 CTCTATGCTGAGAAAGAGCAAGG + Intergenic
993890053 5:93462746-93462768 CTCTTTGCTAAAATATAGCAAGG - Intergenic
994446727 5:99884347-99884369 CTATTTGTTAAAATAGTGAAAGG - Intergenic
994548394 5:101200650-101200672 CTTTATGTTAACAAAGCGCAAGG - Intergenic
995517216 5:112966254-112966276 CTATATGTTACAAAAAAGCAGGG - Intergenic
995794912 5:115930910-115930932 GGATATGTTAAAATAGAACAGGG - Intergenic
996696588 5:126403582-126403604 CTCTAGGGGAAAAAAGAGCAGGG + Intronic
998133599 5:139663284-139663306 CTATATGTTAGACTTGAGCAGGG + Intronic
1000961369 5:167605238-167605260 CATTTTGATAAAATAGAGCATGG + Intronic
1002550251 5:179983664-179983686 CTCTATGATAAAAGACATCAGGG + Intronic
1003105957 6:3216131-3216153 CTGTATGTGAAAATAAAGTATGG + Intergenic
1005317619 6:24619361-24619383 CTCTACCTTAAAATAAATCAAGG - Intronic
1010913362 6:81586335-81586357 CTCTTTGCTAAAACATAGCAAGG + Intronic
1012668043 6:102002892-102002914 ATCTATGTTTAAATATTGCATGG + Intronic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1013688008 6:112608721-112608743 CTCTTTGCTAAAATACAACAAGG - Intergenic
1013928526 6:115502264-115502286 CTCTTTGCTAAAACATAGCAAGG - Intergenic
1016724035 6:147339627-147339649 CTTTACTTTAAAATAAAGCAGGG + Intronic
1017405023 6:154110155-154110177 CTATCTCTGAAAATAGAGCAGGG + Intronic
1021682740 7:23151047-23151069 GTTTAAGTTAAAATAGTGCATGG - Intronic
1023527248 7:41117517-41117539 CCCAAAGTTAAAATAGAGGAAGG + Intergenic
1023809827 7:43903288-43903310 ATTTATGTAAAAACAGAGCAAGG + Intronic
1026437590 7:70413311-70413333 CTCTATCCTAAAACAGAGGAGGG + Intronic
1027261430 7:76467603-76467625 CGCTATGTTAAAATGAAGAATGG - Intronic
1027312813 7:76965712-76965734 CGCTATGTTAAAATGAAGAATGG - Intergenic
1027565227 7:79783483-79783505 CTCTATTTAAAAATAGATAAAGG - Intergenic
1027908422 7:84215567-84215589 CTGTGGGTTAAAATAGAGCTAGG - Intronic
1029870165 7:103682262-103682284 CTGTAGGTGAAAAGAGAGCACGG + Intronic
1031164426 7:118212149-118212171 ACCTATGTTAAAATAGACAATGG - Intergenic
1035843792 8:2841636-2841658 CTCTAAGGTAAAATTGACCAGGG - Intergenic
1036953171 8:13160667-13160689 CTCTCTTTTAACATAGAGCTAGG - Intronic
1037081031 8:14786908-14786930 CTGTATGATAAATTAGAGGAGGG + Intronic
1039124627 8:34187563-34187585 ATATATGGTAAAATTGAGCAGGG - Intergenic
1040356895 8:46627291-46627313 CTCTAGGTCAAGGTAGAGCATGG + Intergenic
1040512427 8:48106769-48106791 CCCTATGTCAAAAAAAAGCAGGG - Intergenic
1043202938 8:77394534-77394556 CTCAATGTTAAATTTGAGTAAGG - Intergenic
1044407027 8:91839419-91839441 CTCTATGATGAGGTAGAGCACGG - Intergenic
1045100058 8:98835276-98835298 TGCTCTGTTAAAATAGAGCTAGG + Intronic
1045371718 8:101530880-101530902 CTAATTGTGAAAATAGAGCATGG + Intronic
1045416776 8:101975505-101975527 CTCCATTTTCCAATAGAGCAAGG - Intronic
1045436656 8:102171152-102171174 ATCTTAGTAAAAATAGAGCATGG + Intergenic
1046472770 8:114700145-114700167 CTATTTGTTAAAATAAAACATGG + Intergenic
1046474019 8:114716698-114716720 CTCTATGTTGTAATAAGGCAAGG - Intergenic
1049027645 8:140006445-140006467 CTCTATGTTTAAATAGTTTAAGG - Intronic
1051375452 9:16397894-16397916 CTGAATGTTAAAATTGATCAGGG - Intergenic
1052246066 9:26336751-26336773 CTGTATATTGAAATAGTGCAAGG - Intergenic
1055202067 9:73676598-73676620 ATCCATGTAAAAATAGAGAATGG + Intergenic
1058208347 9:102135839-102135861 CTCTTTGCTAAAGTATAGCAAGG - Intergenic
1062496666 9:136835095-136835117 CTCTATTTAAAAAAAGAGAAGGG + Intronic
1187584257 X:20642561-20642583 TTTGATGATAAAATAGAGCATGG - Intergenic
1191875723 X:65794108-65794130 CTCTATGTTGAAGTAGCACAAGG + Intergenic
1192269811 X:69568241-69568263 GTCCATGTTGAAATAAAGCATGG + Intergenic
1193606776 X:83578932-83578954 TTCTTTGTTGAAATACAGCAGGG - Intergenic
1193782579 X:85721817-85721839 CTATATGTGATAATAGAGCATGG + Intergenic
1194321051 X:92446958-92446980 CTCTTTGTTAAAACATAACAAGG - Intronic
1195066832 X:101244928-101244950 CTCTTTGGGAGAATAGAGCAAGG + Intronic
1196177343 X:112653710-112653732 CTCCAAGTTAAAATAGACCAAGG + Intronic
1196201064 X:112886475-112886497 CTAGATGTTAAAACAGAGAAAGG - Intergenic
1196712063 X:118773095-118773117 CTCTTTTTCAAAATAGAGGAGGG - Intronic
1197092481 X:122555674-122555696 CTCTTTGCTAAAATACAACAAGG - Intergenic
1197442930 X:126512523-126512545 CTCTTTGCTAAAACATAGCAAGG + Intergenic
1197566604 X:128095609-128095631 CTCTTTGCTAAAACATAGCAAGG + Intergenic