ID: 965961885

View in Genome Browser
Species Human (GRCh38)
Location 3:174439438-174439460
Sequence GAATGGAAGGAATTTCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965961885_965961889 13 Left 965961885 3:174439438-174439460 CCTAGCTGAAATTCCTTCCATTC 0: 1
1: 0
2: 2
3: 20
4: 236
Right 965961889 3:174439474-174439496 AAAAGCACCTTTCCCGTAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 85
965961885_965961888 10 Left 965961885 3:174439438-174439460 CCTAGCTGAAATTCCTTCCATTC 0: 1
1: 0
2: 2
3: 20
4: 236
Right 965961888 3:174439471-174439493 ATTAAAAGCACCTTTCCCGTAGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965961885 Original CRISPR GAATGGAAGGAATTTCAGCT AGG (reversed) Intronic
903507491 1:23848321-23848343 GAATGGAAAGAATTTTGGATGGG + Intronic
906177005 1:43783311-43783333 GAATGGAAGGGAAGTCAGCCAGG - Intronic
906566230 1:46803142-46803164 TGATGGAAGGAATTTAAGCAAGG + Intronic
906635816 1:47409796-47409818 GAATGGAAGCAATTCCTCCTTGG - Intergenic
907381041 1:54089241-54089263 GAAGGGAAGGAATTTTAAATGGG - Intronic
907985849 1:59529549-59529571 GAATGGTAAGCATTTCAGTTTGG + Intronic
908399009 1:63752777-63752799 GGATGGATGGAATTTGAGGTGGG + Intergenic
908905653 1:69005804-69005826 GGATGGCAGAAAGTTCAGCTTGG + Intergenic
908931265 1:69318407-69318429 GAATGGAAGGTATTTCAGGCTGG + Intergenic
909408110 1:75315838-75315860 GAATGGCAGAATTTTTAGCTTGG - Intronic
910047169 1:82931908-82931930 GAAGGGAAGGGATTTCTTCTAGG - Intergenic
912919445 1:113851823-113851845 GAATGAAAGGAATTTGACCCAGG + Intronic
914503207 1:148265433-148265455 GGAAGGAAGGAATTTCACCTCGG - Intergenic
914867574 1:151444806-151444828 AAATGGAAAGAACTCCAGCTTGG + Intronic
916195254 1:162216306-162216328 GAAGGGAAGGAATCTAGGCTGGG + Intronic
918239353 1:182608299-182608321 GAATAGAAGGCAGTTGAGCTAGG - Intergenic
919396456 1:197055408-197055430 CCAGGGAGGGAATTTCAGCTAGG + Intronic
920310186 1:205044032-205044054 GAAGGAAAGGAATTTCAGCCCGG - Intronic
920790222 1:209083006-209083028 GAAGGGAAGAAATTGCAGGTAGG - Intergenic
922337021 1:224626043-224626065 GAATGGCAAGGATTTCAGCCTGG - Intronic
923683029 1:236134533-236134555 GAATGGTGAGAATTTGAGCTTGG + Intergenic
1063003829 10:1949760-1949782 TCATGGAAGGACTTTCAGCCAGG + Intergenic
1064754842 10:18564469-18564491 GAATGGAATGAAATTGAGCATGG - Intronic
1065307911 10:24385697-24385719 CACTGAAAAGAATTTCAGCTGGG - Intronic
1066222658 10:33350922-33350944 GAAGAGAAGATATTTCAGCTGGG - Intergenic
1066460109 10:35605742-35605764 GAGTGGGTGGACTTTCAGCTTGG - Intronic
1067154908 10:43772583-43772605 AAATGGAAGAAATATCAGATTGG - Intergenic
1067535030 10:47102820-47102842 GAGAGGCAGGAATTTCAGCAGGG - Intergenic
1068359755 10:55962031-55962053 GAGTGGACAGAATTTCAGCTGGG - Intergenic
1069282831 10:66677046-66677068 GAATGGAAGGAAACTAAGTTGGG + Intronic
1070551648 10:77495172-77495194 TAATGTTAGGAATTTCAGTTTGG - Intronic
1071719859 10:88132065-88132087 GTTTGGAAGGAATCCCAGCTGGG + Intergenic
1072072670 10:91934526-91934548 AAATGGGAGGAAACTCAGCTGGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072455723 10:95574017-95574039 GAAGGGAAGGAATGTAAGCTGGG + Intergenic
1073811285 10:107155104-107155126 GAATGACAGAAATTTCACCTGGG + Intronic
1079098986 11:17529086-17529108 GGATGCAGGGAATTGCAGCTAGG - Intronic
1081846187 11:46242058-46242080 GAATGGAAGGAAAGCCAACTAGG - Intergenic
1082816471 11:57513170-57513192 GCTTGGAAGGAAGTTTAGCTTGG - Intronic
1082874375 11:57972933-57972955 AAAGGGAAGGATTTCCAGCTTGG + Intergenic
1082897329 11:58205670-58205692 TATTGGAAATAATTTCAGCTTGG + Intergenic
1085648525 11:78245180-78245202 GAATGGTTAGAATTTCAGTTTGG + Intronic
1085725048 11:78947820-78947842 GCATGGAGGGAACTTCAGCAAGG - Intronic
1086115681 11:83247155-83247177 GAATCTAAGAACTTTCAGCTAGG - Intronic
1087134827 11:94706106-94706128 GAAGCGAAGGTATTTCAGCCAGG - Intergenic
1087342456 11:96924617-96924639 TACTGGAAGGAATTTAAGTTAGG + Intergenic
1088298954 11:108334456-108334478 TAATGGAAGTAATTTCATGTGGG + Intronic
1088827768 11:113510151-113510173 GAATAGAAGGAGTTTTAGCTGGG - Intergenic
1090484251 11:127098465-127098487 GAATGGAAGTAATTTCTACGGGG + Intergenic
1090604754 11:128409998-128410020 AAATTGAAGGAAGTTCACCTGGG - Intergenic
1090833607 11:130437956-130437978 GCATGGCAGGACTTGCAGCTGGG + Intergenic
1091546567 12:1504986-1505008 GATTGGAAGGAATTTCTCCTGGG + Intergenic
1091665189 12:2413819-2413841 GAACGGGAGGCATTTGAGCTGGG - Intronic
1092878440 12:12868640-12868662 GGATGGCAGGAATTTCAACTGGG - Intergenic
1093375772 12:18425683-18425705 AAAAGGAAGAAATGTCAGCTGGG - Intronic
1093521528 12:20056699-20056721 ATATGGAAGGAGTTCCAGCTTGG + Intergenic
1093790507 12:23244674-23244696 GATTTGAAGGATTTTCAGCCTGG + Intergenic
1096000276 12:48123640-48123662 GAAGGAAAGCGATTTCAGCTAGG + Intronic
1097576078 12:61394192-61394214 GAATGAAAGGATTTATAGCTTGG + Intergenic
1097670712 12:62534093-62534115 GAAAGGAAAGGATATCAGCTGGG + Intronic
1097738276 12:63208162-63208184 AGATGGAAGAAATTTGAGCTGGG - Intergenic
1097887001 12:64739092-64739114 GTATGGAAGGCATTTGAGATAGG - Intronic
1098218587 12:68244907-68244929 GAAAGAAAGAAATTTCATCTGGG + Intergenic
1099453597 12:82837652-82837674 GAATGGAAGAGATTTCACCATGG - Intronic
1100285651 12:93164101-93164123 TAAAGGAAGGCATCTCAGCTGGG + Intergenic
1101050336 12:100856580-100856602 GAGGGGAAGCTATTTCAGCTTGG + Intronic
1107071756 13:36277548-36277570 TCTTGGAAGGAATTTCAGGTAGG + Intronic
1107390764 13:39961204-39961226 GACTGGATGGAATTGAAGCTTGG + Intergenic
1108557861 13:51613297-51613319 GGATGGCAGTCATTTCAGCTTGG - Intronic
1109133727 13:58621946-58621968 GAATGAAAGGAATGCCACCTGGG + Intergenic
1109133900 13:58624057-58624079 GAATGAAAGGAATACCACCTGGG - Intergenic
1109237577 13:59843494-59843516 GATTGGAAGCAATTTCTCCTGGG + Intronic
1111063797 13:83063240-83063262 GTTTGGAAGGAATTTCGGCTTGG + Intergenic
1112144540 13:96683000-96683022 GAATGGAAGGTATTTCATGAAGG + Intronic
1112280187 13:98056126-98056148 GCATGGAAGGATTCTCAGCAGGG + Intergenic
1112905008 13:104406684-104406706 CAATGGAAAGAATTTCAAGTAGG + Intergenic
1113900134 13:113792198-113792220 GAATGTAGGAAATTTCAGTTAGG + Intronic
1114623501 14:24113886-24113908 GCAGGGAATGAAGTTCAGCTCGG + Intronic
1115098675 14:29671435-29671457 GAACAGAAGGCTTTTCAGCTGGG + Intronic
1116256567 14:42563968-42563990 GAATGGAAGACATATAAGCTTGG - Intergenic
1116364008 14:44038361-44038383 TAATGGAAGAAATTACAGATAGG - Intergenic
1117673343 14:58130380-58130402 GAAGGGAAGGAGGTTGAGCTAGG - Intronic
1117751054 14:58924212-58924234 GAATTTCAGGAATTCCAGCTAGG + Intergenic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1119891445 14:78185512-78185534 GAATGGTAGGAGATTCAGTTAGG + Intergenic
1120157726 14:81112534-81112556 GCAAGAAAAGAATTTCAGCTGGG - Intronic
1121837118 14:97102164-97102186 GAAGGGAGTGAATGTCAGCTGGG + Intergenic
1122249135 14:100425807-100425829 GAATTAAAGCAATTTCAGCTTGG + Intronic
1124638562 15:31380674-31380696 CAATGGCAGGAATTTTAGCATGG - Intronic
1125564116 15:40662074-40662096 GAATGGTAGCAATATCATCTTGG - Exonic
1127135175 15:55912503-55912525 GAATGGAAGACATTCAAGCTTGG + Intronic
1127214096 15:56806221-56806243 GAAGGGAGGGCATTTCAGGTTGG - Intronic
1127226021 15:56930169-56930191 GCATGGAAGGTATCTCTGCTGGG + Intronic
1127569094 15:60223483-60223505 CAATGGCTGGAATCTCAGCTCGG - Intergenic
1129933011 15:79428127-79428149 GGAAGGAAGGACTTTCATCTTGG - Intergenic
1130394573 15:83490832-83490854 GAATGGATGGAATCTTTGCTGGG + Intronic
1131201001 15:90395836-90395858 AAATGGAAGAAAATTCAGCTAGG + Intronic
1133709690 16:8389463-8389485 GATTGGAAGGATTTTCAGCTAGG - Intergenic
1135611648 16:23872838-23872860 GAAGAGCAGGAACTTCAGCTGGG + Intronic
1135856469 16:26015708-26015730 GAATGATAGGAATTTGTGCTTGG - Intronic
1137920987 16:52488231-52488253 GAAAGCATGGAATTTCAGCAGGG - Intronic
1140428647 16:74882964-74882986 AAATGGAAAGGATTTCATCTAGG - Intronic
1140733864 16:77880497-77880519 GAAGAGAAGGAATTTGGGCTGGG - Intronic
1144092498 17:11870665-11870687 GAATGGAAGGCAGGCCAGCTAGG - Intronic
1146495404 17:33317823-33317845 GAGGAGATGGAATTTCAGCTGGG + Intronic
1149589312 17:57816892-57816914 AAATGGTAGGAAGTTCAGTTTGG - Intergenic
1151346342 17:73504687-73504709 AAAGAGAAGGAATTTGAGCTGGG + Intronic
1155888733 18:31240344-31240366 GAATGGTAGGAATGACACCTCGG + Intergenic
1156353162 18:36318694-36318716 GAAAGAAAGGAATTTCAATTAGG - Intronic
1157056064 18:44230200-44230222 AAACTGAAGGAATCTCAGCTTGG + Intergenic
1159505145 18:69326936-69326958 GAATGAAAGGATTCTCAGCAAGG + Intergenic
1160395541 18:78568540-78568562 GAATGGTTGGAACTTCAGATAGG + Intergenic
1163406039 19:17123114-17123136 AAATGAAAGGATTTTCAGCTTGG + Intronic
1164900448 19:31916859-31916881 GAATGGAAGGGATTGCATCAGGG + Intergenic
1165786935 19:38467212-38467234 GAAGGGATGGAAATTCAGGTTGG - Intronic
1165897609 19:39152599-39152621 GAAGGGAAAGAATTTGTGCTGGG + Intronic
1167393346 19:49211136-49211158 GAATGGGAGGAATGTCAGAGCGG - Intronic
925157593 2:1659293-1659315 GGCTGAAAAGAATTTCAGCTAGG + Intronic
926844755 2:17123979-17124001 GAATTGAAGGATATTAAGCTGGG + Intergenic
927430879 2:23025270-23025292 GGTTGGAGGGAATTTCAGCAGGG + Intergenic
929219958 2:39453529-39453551 GAATGGATGGAATTTCAACATGG - Intergenic
930301448 2:49620967-49620989 CTATGGGAGGAATTTCAGCAAGG + Intergenic
930401889 2:50900507-50900529 AAACGGAAGGCATTTCAGGTGGG + Intronic
930486497 2:52017736-52017758 GTAGGGAAGGACTATCAGCTGGG + Intergenic
931714226 2:65016343-65016365 GAATGCAGGGACTTTCAGCCAGG - Intronic
933002632 2:76944718-76944740 GATTGTAGGGAAATTCAGCTGGG + Intronic
935263171 2:101372057-101372079 GGATGGAAGGACTTACAGATGGG + Intronic
935383454 2:102477307-102477329 GAATGGGAGAAATTTTAGGTGGG - Intronic
935982092 2:108637603-108637625 GAATGGCAGTATTTTTAGCTAGG - Intronic
937059024 2:118967712-118967734 GGTTGGAAGGAATATCAGCAGGG + Intronic
937847237 2:126594164-126594186 GAATGTAAGAAATGTCAGGTTGG + Intergenic
942567641 2:177282369-177282391 TAATGGTGGGAAGTTCAGCTGGG + Intronic
943703949 2:191015280-191015302 CCATGGAAGGATTTTCAGGTTGG - Intronic
944122315 2:196253338-196253360 AAATGGTAGGAAATGCAGCTTGG - Intronic
944672426 2:202006253-202006275 GAAAGGAAGCAATTTTAGCAGGG - Intergenic
944830771 2:203532279-203532301 TAATGGGAAGAATTTCAGTTTGG + Intronic
945152237 2:206803438-206803460 GAAAGGAAGGAATCTTAGATTGG + Intergenic
946348855 2:219134584-219134606 GAATGGATGGATCTTTAGCTGGG - Intronic
949080764 2:242097329-242097351 GAATAGAAGGTAGATCAGCTGGG + Intergenic
1170995789 20:21356695-21356717 GACTGGAAGGAAGTTTAGTTAGG + Intronic
1171071844 20:22077249-22077271 GAAAAGAATGAATTTCAGCATGG - Intergenic
1172472379 20:35209344-35209366 GAATGGAAAGAATATGAACTTGG + Intergenic
1172504258 20:35449691-35449713 GAATGAATGGAACTTCAGCGCGG + Intronic
1173975984 20:47187071-47187093 TAATGAAACGAAATTCAGCTGGG + Intronic
1175416344 20:58803921-58803943 AAATGGAAAGAAGTTCACCTGGG - Intergenic
1175670428 20:60898206-60898228 GAATGGCAGGGATTTCTGCCTGG - Intergenic
1177076676 21:16584038-16584060 GAAAGAAAGTAATTTCAGGTTGG + Intergenic
1177490172 21:21813683-21813705 GGATTGAAGGAAGTTCAGGTAGG + Intergenic
1181545404 22:23599498-23599520 GAATGGAAGGAATTTTTGGGTGG + Intergenic
1181624203 22:24112391-24112413 ACATGAAAGGAATTTGAGCTTGG - Intronic
1181699043 22:24609613-24609635 GAGTGGAGGGAAATCCAGCTTGG + Intronic
1181814902 22:25430401-25430423 GAATGGAAGGAATTTTTGGGTGG - Intergenic
1181937509 22:26449379-26449401 GAGTGCAATGAATCTCAGCTCGG + Intronic
1182220119 22:28752146-28752168 AAATTGAAGGAATTTGGGCTGGG + Intronic
1182619609 22:31611659-31611681 CAATGGGAGGACATTCAGCTGGG + Intronic
1185414869 22:50704450-50704472 GAAGGGAAGGAATTGCCGCCTGG - Intergenic
949500378 3:4674461-4674483 TAATGGAAAGGAATTCAGCTTGG + Intronic
950026199 3:9821486-9821508 GAGTGCTAGGAATCTCAGCTGGG + Intronic
951658195 3:25032707-25032729 GAAGGGAGGGTATTTCAGCAGGG + Intergenic
952664061 3:35883030-35883052 CAATGAAAGGAATGTCAGTTGGG + Intergenic
955432475 3:58862286-58862308 CCATGGAAGGATTATCAGCTGGG + Intronic
955789367 3:62572498-62572520 GCACTGAAGGAATTTTAGCTTGG - Intronic
956232564 3:67033413-67033435 AAATGGAAGGAAGTTCATCATGG + Intergenic
958518331 3:95150484-95150506 GAATGGCTGGAATTTCACTTTGG + Intergenic
959115502 3:102173259-102173281 GAATAGAGGACATTTCAGCTGGG + Intronic
959594191 3:108111278-108111300 GAATGGAATGAATCTCTGTTTGG + Intergenic
960769346 3:121174973-121174995 GAATGGAAGGAATATATGCCAGG + Intronic
961235698 3:125364862-125364884 GAATGGAGGGAAATAAAGCTGGG - Intronic
963536903 3:146540821-146540843 GAAAGGTAGGAATTTCAAGTAGG + Intronic
963810336 3:149770623-149770645 GGATGGAAGGAATTTCTGATGGG - Exonic
964003340 3:151803277-151803299 GAAGGAAAAGAATTTCAACTTGG - Intergenic
964222746 3:154365508-154365530 GATTTGAAAAAATTTCAGCTTGG - Intronic
965318761 3:167225364-167225386 GAATGGTAGGAATAACAACTAGG + Intergenic
965644400 3:170864883-170864905 TAATAAAAGGAATTTCATCTGGG - Exonic
965961885 3:174439438-174439460 GAATGGAAGGAATTTCAGCTAGG - Intronic
966012964 3:175104128-175104150 GAATGGAAGGAAGTTAACATGGG - Intronic
967340753 3:188394883-188394905 GATTGGAAGCATTTTCAACTGGG - Intronic
968601312 4:1511262-1511284 GAGAGGAAGGAATTGCAGTTCGG - Intergenic
973114131 4:46433835-46433857 GAAGGGAAGGAATGGCAGCAGGG + Intronic
974290526 4:59924003-59924025 GAATAAAAGGTATTTTAGCTGGG - Intergenic
974715725 4:65668344-65668366 GAGTGGAAGGAATTTCTGCAAGG + Intronic
975405180 4:73981257-73981279 GAATGGAAGGAAAATTTGCTTGG - Exonic
976336796 4:83897408-83897430 GAATGAAAGGAATTTAAGACTGG + Intergenic
976961557 4:90982283-90982305 GAATGGCAGTAATTTCATCACGG + Intronic
978846637 4:113281027-113281049 CAACTGAAGGAAATTCAGCTTGG - Intronic
979121283 4:116905188-116905210 TAATGGAAGGAAGCTCAGTTAGG - Intergenic
980999082 4:139810790-139810812 GAAGAGAAGGAATATTAGCTAGG - Intronic
981056561 4:140368142-140368164 GAATGGAATGAATTCAATCTAGG + Intronic
982162437 4:152583723-152583745 AAATGGAAGGAATTCAAGCCAGG - Intergenic
982536207 4:156609299-156609321 AAATGGAAGGAATTATAGGTGGG - Intergenic
984183797 4:176517363-176517385 GACTGGAAGGAGGGTCAGCTAGG - Intergenic
984420594 4:179515937-179515959 AATTGGAAGGAACTTGAGCTGGG - Intergenic
985395199 4:189536642-189536664 GAATTGAAGGACATCCAGCTAGG - Intergenic
988643293 5:33065704-33065726 GCATGGAGGGAATCTCATCTTGG + Intergenic
989592328 5:43122671-43122693 TAATGGAAGGAAATCCAGCGTGG + Intronic
989750811 5:44890929-44890951 GAATGAAAGCCATTTTAGCTGGG + Intergenic
990149291 5:52799016-52799038 GAAAGGAAGGAATCTGAGTTTGG - Intronic
990205860 5:53428838-53428860 GAAAGAAAGGAATTTTAGCATGG + Intergenic
990378518 5:55197630-55197652 GAAGGGGAGAAATTACAGCTAGG - Intergenic
991348571 5:65696151-65696173 GAGGGGAAGGCATTTCAGATTGG - Intronic
991602434 5:68366999-68367021 GAAAGGAAGGAATCTGAGCCAGG + Intergenic
993397016 5:87402779-87402801 AAATGGGAGGAATTTTAGGTAGG - Intronic
995519833 5:112992180-112992202 GAATGGAAGGAATATAAAATGGG + Exonic
996904747 5:128585571-128585593 GAAAGGAAGGAATTACATATAGG - Intronic
996914698 5:128698409-128698431 GAATTGAATAAAGTTCAGCTGGG + Intronic
997867806 5:137480195-137480217 GTATTGAAGGAATTTCAGTTCGG - Intronic
1001179480 5:169505788-169505810 GAATGGAGGTAATTTCATATTGG - Intergenic
1002616041 5:180456883-180456905 GAAGGGAAGGACTTTCTGGTAGG + Intergenic
1002932567 6:1644521-1644543 AAGTGGAGAGAATTTCAGCTGGG - Intronic
1003890338 6:10558455-10558477 GAAAGCAAGGAGTTTCTGCTAGG - Intronic
1005116994 6:22350045-22350067 GAATTGAAGGAAATTCACCAAGG - Intergenic
1007309801 6:40936347-40936369 GAATGGAAGGCAATTAGGCTAGG - Intergenic
1008495634 6:52130880-52130902 GAATGGAAGGAATTTTATTATGG - Intergenic
1008841050 6:55904749-55904771 GAATGGAAGGAAATACACATGGG + Intergenic
1010383439 6:75250092-75250114 GAATGTAAGAAATCTCAGGTTGG + Exonic
1010821974 6:80425092-80425114 GAATTTAATGAATTACAGCTTGG + Intergenic
1012263736 6:97116467-97116489 CAATGGAAGGAATGTCAATTGGG - Intronic
1014066985 6:117138566-117138588 GGATGGAAAGAATATCAGCTAGG + Intergenic
1014720084 6:124906040-124906062 GAATGGGAGGATTTTAAGCAAGG - Intergenic
1016527969 6:145024056-145024078 GAATGGAAATTATTTCAGCAGGG + Intergenic
1016864538 6:148752028-148752050 GAAAGGAAAGCATATCAGCTGGG - Intronic
1020194184 7:6024522-6024544 GAAGGGAAGGAACGGCAGCTTGG + Exonic
1022184187 7:27951086-27951108 GAATAGAAGTAATTAAAGCTGGG - Intronic
1023309056 7:38864301-38864323 GAAGGGAAGGAATTAAAACTTGG - Intronic
1023500606 7:40845346-40845368 AAATGGAATGCATCTCAGCTTGG - Intronic
1024014735 7:45302817-45302839 GAATGGAAGAAATTTTTGCAAGG + Intergenic
1024759083 7:52572619-52572641 GACTGGAAGGGATTGCAGTTTGG - Intergenic
1026508325 7:71005905-71005927 GAAAGGAAGGAATGCCAGCAAGG - Intergenic
1028574572 7:92332859-92332881 GACTGGAAGGATTTTCACATAGG - Intronic
1028753385 7:94408230-94408252 AAATGGAAGCACTTACAGCTGGG - Exonic
1031383182 7:121113442-121113464 GAATGGATGGTATTTTAGCTGGG + Intronic
1034163160 7:149007060-149007082 GGATGGAAGGAAGTGAAGCTGGG + Intronic
1034458325 7:151184116-151184138 GAAAGGAAGGAAATTCGGCCGGG + Intronic
1035232145 7:157471626-157471648 GAGTGGGAGGAGCTTCAGCTGGG + Intergenic
1040072153 8:43197042-43197064 GAAGGAAAGGAATTTTAGCGAGG - Intronic
1041447226 8:57965575-57965597 GAATGGAGGGAATTTCAAAGAGG + Intergenic
1045961046 8:107968781-107968803 GAATGGAAGGAAGCTCAAATAGG + Intronic
1045993997 8:108341871-108341893 GAAAGGGTGGAATTTGAGCTGGG + Intronic
1046361893 8:113170535-113170557 GAGTGCAAGGAATTTCAGCTAGG - Intronic
1048004336 8:130406922-130406944 GAAGAGGTGGAATTTCAGCTCGG - Intronic
1048418524 8:134253248-134253270 GAATGTAAGCAATTCCAACTAGG - Intergenic
1049608806 8:143542621-143542643 AAATGGAAGGAAATTCGGCCGGG + Intergenic
1050009843 9:1173986-1174008 AAAGGAAAGGAATTTCAGCTGGG + Intergenic
1051381416 9:16462878-16462900 GAAGGGAAGAAACTTCAGCTGGG - Intronic
1053199186 9:36141328-36141350 AAAAAGAATGAATTTCAGCTGGG - Intronic
1060070508 9:120542930-120542952 CAATGGAAGGCATTTGGGCTGGG + Intronic
1061066068 9:128278249-128278271 AAATGGAAGGAATGGAAGCTGGG - Intronic
1187126375 X:16457787-16457809 GAAGGGAAGGAATAACAGGTGGG + Intergenic
1189913281 X:45832583-45832605 GAAGAGAAGGGATTTCTGCTGGG + Intergenic
1190867516 X:54397215-54397237 GAAGGGGGGAAATTTCAGCTGGG + Intergenic
1194301149 X:92187526-92187548 AAATGGAATGAATTTAAGGTAGG + Intronic
1194586176 X:95736789-95736811 GAATGGAAGGGCTTTCAACAAGG + Intergenic
1195964879 X:110420825-110420847 GAATGGCAGGAGTTTTGGCTCGG + Intronic
1196745663 X:119069884-119069906 TAATGGATGGAATTTAAACTGGG + Intergenic
1197034296 X:121855044-121855066 AAATTGAAGGAATATCAGCCTGG + Intergenic
1199439207 X:147849125-147849147 GAATGTAAGGGAATTCAGCCTGG - Intergenic
1199542822 X:148976467-148976489 TAATGAGAGGAATTTCAGTTGGG + Intronic
1199913735 X:152315888-152315910 GAAGGGAAGGACCATCAGCTGGG - Intronic
1201317110 Y:12658355-12658377 GAAAGGAAGGACTTTCAGAATGG - Intergenic