ID: 965971503

View in Genome Browser
Species Human (GRCh38)
Location 3:174561630-174561652
Sequence GCAAAGTTGTTTGCTGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965971503 Original CRISPR GCAAAGTTGTTTGCTGCAAC TGG Intronic
904074671 1:27831014-27831036 GAAAAACTGTTTGCTGCACCGGG + Intronic
904413529 1:30340591-30340613 GAAGAGTTCTTTGCTGAAACTGG + Intergenic
908110348 1:60890815-60890837 GCAAACTTTTGTGCTGCAGCTGG - Intronic
908588123 1:65596979-65597001 GCAGAGTTCTTTGCTAAAACTGG - Intronic
908932535 1:69334344-69334366 GCAAAGTTGCCTGTTGCAGCAGG + Intergenic
909611031 1:77552033-77552055 GCAGAGTTCTTTGCTAAAACTGG - Intronic
912093630 1:106113644-106113666 GCAAAGATGTAGGCTGCAGCAGG + Intergenic
913494239 1:119413226-119413248 GCAAAGGTGTGTGATGCACCTGG + Intergenic
913510936 1:119561460-119561482 GCAAAGGTGTGTGATGCACCTGG + Intergenic
913515158 1:119598866-119598888 GCAAAGGTGTGTGATGCACCTGG + Intergenic
918170271 1:181989669-181989691 GCAAGGTTGTCTGCTGCGAGTGG - Intergenic
918536567 1:185581582-185581604 GTACAGTTGTGTGCAGCAACAGG + Intergenic
920578639 1:207083619-207083641 GTAAACATGTTTTCTGCAACTGG - Intronic
1064247067 10:13677041-13677063 GCAGAGCTGTTTGATGCCACGGG - Intronic
1066604114 10:37142530-37142552 CCAAAGTTGTTTGGTGGTACAGG + Intronic
1068580238 10:58731034-58731056 GCAAAGATGTTATCTGAAACTGG - Intronic
1069025540 10:63536864-63536886 GCAAAGATGTGTACAGCAACAGG + Intronic
1069180304 10:65350818-65350840 GCAAAGTTTATTGCTGCTGCAGG - Intergenic
1071421637 10:85505933-85505955 GCAATGTTGATTGCTGCGCCAGG + Intergenic
1072392230 10:94998664-94998686 AGAAAGTTGTTTACTGAAACTGG + Intergenic
1073917000 10:108417227-108417249 GGAAAGTTGTGTGCAACAACTGG - Intergenic
1074839888 10:117340309-117340331 GCAGAGTTCTTTGCTGAAACTGG - Intronic
1077968977 11:7167533-7167555 GCAGAATTGTTTGCTCAAACTGG + Intergenic
1080801892 11:35617886-35617908 TCAAAGTTGTTGGCTACAGCGGG + Intergenic
1082939561 11:58689738-58689760 GCAAGGTTGTTTGATAAAACTGG + Intronic
1085496726 11:76977665-76977687 GCAAAGATGCTGGCTGCAGCAGG + Intronic
1086969360 11:93064546-93064568 ACAAAGTTGTATGCTTCATCAGG - Intergenic
1089426989 11:118385934-118385956 AACAAGTTGTTTGCTACAACAGG + Intronic
1089614485 11:119687510-119687532 ACAGTGTTGTTTGCTGCAGCTGG - Intronic
1091661552 12:2387703-2387725 GGAAAGCTGTTCCCTGCAACTGG + Intronic
1095193691 12:39287770-39287792 GCAAAGTTTTTTTCTGTAAAGGG - Intergenic
1101016372 12:100505025-100505047 GCAAAGTTGTTTGCTGTTCCTGG - Intronic
1105370305 13:19796243-19796265 GCAAGGTTCTTTGCTAAAACTGG + Intergenic
1109089039 13:58015820-58015842 GCAGGGTTCTTTGCTACAACTGG - Intergenic
1110467228 13:75815660-75815682 GGAAAGATGTTTGTTGAAACTGG + Intronic
1115893137 14:38055069-38055091 GCAAAGACGTTAGCTGCACCAGG - Intergenic
1116126614 14:40796633-40796655 GGAAAATTGTTTGCTGGACCAGG - Intergenic
1116396081 14:44449933-44449955 GGAAAGTTGTTTACTGAAACTGG + Intergenic
1116452715 14:45083253-45083275 GCAAAGTTCTTTGCTTAAACTGG - Intergenic
1119769518 14:77211711-77211733 GCAAAGTTGTCTTTGGCAACTGG - Intronic
1126336597 15:47591836-47591858 GCAAAGTTATGTGCTGACACTGG + Intronic
1128480327 15:68032037-68032059 GCAGGGTTCTTTGCTGAAACTGG - Intergenic
1132137118 15:99352089-99352111 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134134444 16:11669675-11669697 GCAAAGTTGTTTGGCCAAACAGG + Intronic
1135071744 16:19358214-19358236 ACACAGTTGTTTGCTCCATCTGG + Intergenic
1137858811 16:51825256-51825278 ATAAAGGTGTTTGCTGTAACTGG - Intergenic
1140254279 16:73321498-73321520 ACAATGCTGTATGCTGCAACTGG - Intergenic
1145969547 17:28949177-28949199 GCAAAATTCTTTGCTGCCAGAGG - Intronic
1147534196 17:41308093-41308115 GCAAGGCCGTTTGCTGGAACTGG + Exonic
1148783310 17:50133580-50133602 GAAAAGCAGTTTGCTGGAACCGG + Intergenic
1152022924 17:77790504-77790526 GCCATGGTGCTTGCTGCAACTGG + Intergenic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1155288353 18:24315015-24315037 TTATAGTTGTTTTCTGCAACAGG - Intronic
1155750768 18:29420387-29420409 GCACAGATGTGTGCAGCAACAGG + Intergenic
1157902060 18:51527683-51527705 TCTAAAATGTTTGCTGCAACTGG - Intergenic
1158401391 18:57124395-57124417 GCAAAGATGTTTGCTACAGAAGG + Intergenic
1158787906 18:60739287-60739309 GCAAAGATGCTGGCTGCAGCGGG + Intergenic
1161259635 19:3330350-3330372 GCCCGGTTGTTTGCTCCAACAGG - Intergenic
1162348131 19:10133002-10133024 GCAGAGCTCTGTGCTGCAACTGG - Intergenic
1162432536 19:10637640-10637662 GCAAACTTGTTCTCTGCAGCTGG - Exonic
1167043303 19:47035623-47035645 GCACAGTTGTTTGCTGTATGGGG + Intronic
928305351 2:30165706-30165728 GGAAAATTCTTTGCAGCAACTGG - Intergenic
931916756 2:66964412-66964434 GCAAAGTTGCTTTCTGTGACTGG - Intergenic
932699460 2:73983703-73983725 GCTAAGCTGTTAGCTGCAGCCGG + Intergenic
937627859 2:124063995-124064017 ACATAGTTGTCTGCAGCAACGGG - Intronic
941429210 2:165391869-165391891 ACAAAGTATTTTGCTGTAACTGG - Exonic
942210324 2:173663466-173663488 GCAAAGTTGTATGGTTCAATAGG - Intergenic
942212990 2:173690099-173690121 GCAAAGTTGCTTTCTGGAATTGG + Intergenic
942868188 2:180700227-180700249 GCAAAGATGCTGGCTGCAGCAGG - Intergenic
944322364 2:198362454-198362476 GAAAACTTTTTTGCTGCATCTGG - Intronic
947315036 2:228847820-228847842 GCAAAGTTGCATTCTGCATCTGG - Intergenic
1168764400 20:371969-371991 GCAAGGTTTTCTGATGCAACTGG + Intronic
1169270175 20:4193061-4193083 GGAAAGTTCTTTCCTGCACCAGG + Intergenic
1170403108 20:16008964-16008986 TCAAAGATGTTGGCAGCAACAGG - Intronic
1177037552 21:16061486-16061508 GCAAAGATGCTGGCTGCAGCGGG - Intergenic
1177920980 21:27152300-27152322 GGAAAGTTCTTTACTGCAAATGG + Intergenic
1179057350 21:37948362-37948384 GCAAAATTCTTTGCTAAAACTGG + Intergenic
1179455838 21:41499416-41499438 GCAAGGTTTTTTGCTAAAACTGG - Intronic
1180727127 22:17954533-17954555 GCAATGTTCTTTGCTAAAACTGG + Intronic
1185140951 22:49100939-49100961 GAGAAGGTGTGTGCTGCAACTGG - Intergenic
955505285 3:59626562-59626584 GCAAAGTGGTCTGCTGCCACCGG + Intergenic
959106267 3:102068470-102068492 GCAAAGTTGCTGTCTGCAAGGGG - Intergenic
959778489 3:110199760-110199782 GCATACTTGTCTGCTGCAATAGG - Intergenic
962446844 3:135473574-135473596 GCAAAGTGGTGTCCTGCAGCAGG + Intergenic
963210666 3:142686049-142686071 GCAATGCTGTTTCCTGCACCTGG - Intronic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
969890583 4:10256223-10256245 GCAAAGTTGTGTGTTGTAAGGGG + Intergenic
970933131 4:21537002-21537024 TCATAGTTGTTTTCTGCCACTGG - Intronic
976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG + Intergenic
977761332 4:100740567-100740589 CCAAAGTTCTATGCTGCAAAGGG - Intronic
977902846 4:102442477-102442499 CCAAAGTTGTGTGCCCCAACAGG - Intergenic
978144775 4:105359530-105359552 GCAGAGTTGTTTGTTCCAACCGG - Intergenic
980240872 4:130173308-130173330 GCAAAGTTTTTTGCTACCCCTGG + Intergenic
982669055 4:158298470-158298492 GCACAGATGTGTGCAGCAACAGG - Intergenic
986571784 5:9173257-9173279 GGAAAGTTGTTTTCTTCACCCGG + Intronic
987952071 5:24687861-24687883 GCAAAGATGCTGGCTGCAGCAGG - Intergenic
994186759 5:96823505-96823527 GCAAAGTTGTTTTCTTAAAATGG + Intronic
995258588 5:110075285-110075307 GCAAGCTTGTTGGCTGCAGCAGG + Intergenic
999773391 5:154792325-154792347 GCAAAATTATTCCCTGCAACAGG - Intronic
1000370984 5:160536403-160536425 GCAAAGTAGTTTGCGTCACCAGG - Intergenic
1003855512 6:10269896-10269918 CCATAGTGGTTTGCTGCACCGGG + Intergenic
1010508825 6:76692122-76692144 GCAGAGTTCTTTGCTAAAACTGG + Intergenic
1011207967 6:84921941-84921963 GCAAAATTGTTTGCTTGCACAGG - Intergenic
1013438718 6:110139403-110139425 GCAAAGATGCTGGCTGCAACGGG - Intronic
1016381446 6:143486508-143486530 GTAAAGTTTTTTACTGTAACTGG + Intronic
1021464623 7:20928208-20928230 GCAGCTTTGTTTGCTGCCACTGG - Intergenic
1025006911 7:55362664-55362686 GCAAGGCTGTTTGCTAAAACTGG + Intergenic
1030744763 7:113151825-113151847 TCAAAGTTATTTGCTGCAAAGGG + Intergenic
1034725298 7:153330356-153330378 GCCAAGGTGTTTGCTCCAAGGGG - Intergenic
1039571249 8:38588118-38588140 GCAGAGTTGATTGCTGCATTGGG - Intergenic
1041760586 8:61362073-61362095 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1044004590 8:86925962-86925984 CCCAAGTTGTTTGCTGCTGCTGG + Intronic
1044770572 8:95626805-95626827 GCAAAGTTATTTTTTCCAACTGG + Intergenic
1046976561 8:120285131-120285153 GGAAAGTTGGTTGCTGCAGTGGG + Intronic
1049020465 8:139954078-139954100 GCAAAGTTATCTGCAGCGACAGG + Intronic
1050941853 9:11471076-11471098 GCAAAGATGCTGGCTGCAGCAGG + Intergenic
1051107562 9:13597149-13597171 GGAAAGTACTTTGCTGCAACAGG - Intergenic
1057318223 9:93986310-93986332 GGAAAGTTGTTTACTGAAACTGG - Intergenic
1059406960 9:114107159-114107181 GCAAAATTGTTTTCTGAAAATGG - Intergenic
1062037236 9:134387915-134387937 TCAGAGTTCTTTGCTGCAAGAGG - Intronic
1187764285 X:22622551-22622573 GGAAAGATGTATGCTGTAACAGG + Intergenic
1188493134 X:30756594-30756616 GCACACTTGTTAGCTGCAGCAGG - Intergenic
1191210373 X:57878223-57878245 GCATAGATGTGTGCAGCAACAGG - Intergenic
1191729024 X:64314292-64314314 GCATGCTTGTTTGCTGCAGCAGG + Intronic
1196785310 X:119416828-119416850 GAAAAGTTGTTTTCTTCAAAGGG + Intronic
1198019960 X:132647686-132647708 GCCAAGTTGTTGGATGCAAGAGG + Intronic
1201668147 Y:16482943-16482965 GCTGAGTTGTTTGCTGCAAGTGG - Intergenic
1202089542 Y:21175546-21175568 GCAAAGTGGGTTGCTGCTGCTGG + Intergenic