ID: 965973724

View in Genome Browser
Species Human (GRCh38)
Location 3:174595162-174595184
Sequence CACATTCAGGTCTCATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965973721_965973724 18 Left 965973721 3:174595121-174595143 CCCATATTCAGTCACTAAATGCA 0: 1
1: 0
2: 2
3: 12
4: 202
Right 965973724 3:174595162-174595184 CACATTCAGGTCTCATGAGCTGG 0: 1
1: 0
2: 2
3: 20
4: 141
965973722_965973724 17 Left 965973722 3:174595122-174595144 CCATATTCAGTCACTAAATGCAC 0: 1
1: 0
2: 0
3: 17
4: 133
Right 965973724 3:174595162-174595184 CACATTCAGGTCTCATGAGCTGG 0: 1
1: 0
2: 2
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965973724 Original CRISPR CACATTCAGGTCTCATGAGC TGG Intronic
902182500 1:14699874-14699896 CACAGTCAGCTCTCATGAGCTGG + Intronic
905324694 1:37142761-37142783 GACTTTCAGGGCTAATGAGCAGG + Intergenic
905967512 1:42111672-42111694 CACAGTCAGCTGTCATGAGTAGG + Intergenic
908200998 1:61795282-61795304 CAAATTCAGGTCACTTGAGATGG + Intronic
909656755 1:78041619-78041641 CACAATCAGCTCTCAGGAGCTGG - Intronic
909814549 1:79975683-79975705 AACAATCAGCTCTCATGAACTGG + Intergenic
910229171 1:84968654-84968676 CGCCTTAAGGCCTCATGAGCAGG + Intronic
915014814 1:152723164-152723186 CACAATCAGGGCTCCTGAGAAGG - Intergenic
915058313 1:153157953-153157975 AACAATCAGATCTCATGAGACGG + Intergenic
915078869 1:153337620-153337642 AACAATCAGCTCTCATGAGCTGG + Intronic
915577681 1:156791319-156791341 CTCATTGGGGTCTTATGAGCAGG + Intronic
917150235 1:171935639-171935661 CACAATCAGATCTTAGGAGCTGG - Intronic
920749529 1:208660413-208660435 CACATTGAGGACTTGTGAGCTGG - Intergenic
922019863 1:221692702-221692724 AACAATCAGCTCTCATAAGCTGG - Intergenic
924106112 1:240650807-240650829 CAGATTCAGGCCTCAAGAGAGGG - Intergenic
1063467712 10:6258316-6258338 GACATTCAGATTTTATGAGCAGG + Intergenic
1065043376 10:21720312-21720334 AACTTTCAGGTCCCATGAGTAGG - Intronic
1072410489 10:95197672-95197694 GACATTCAGTTCCCAGGAGCAGG + Intronic
1075827794 10:125374739-125374761 CACAGTCAGCCCTCGTGAGCAGG + Intergenic
1080279755 11:30543246-30543268 CACATACAGGTCTCTTCAGAGGG + Intronic
1080735097 11:35006431-35006453 AACAATCAGCTCTCACGAGCTGG + Intronic
1083252825 11:61479164-61479186 CGCCTTCAGCTCTCCTGAGCCGG - Intronic
1083417503 11:62535177-62535199 CACAATCTGGTCCCCTGAGCAGG + Exonic
1084167985 11:67385574-67385596 CAGAGTCCGGTCTCCTGAGCTGG - Intronic
1084378451 11:68794865-68794887 CACATTCAGGCAGCAAGAGCCGG - Exonic
1084577191 11:69996987-69997009 CACATTAAGGTCTCATGGCCTGG - Intergenic
1084699624 11:70777853-70777875 GACATTCAGGTTTCATGAGGTGG + Intronic
1085219292 11:74859826-74859848 CACATTCAGCTCCCACGGGCAGG - Intronic
1085877950 11:80431396-80431418 CACAATCAGCTCTCATGTGTAGG - Intergenic
1086910322 11:92464476-92464498 CACATTCTGCTCCCATTAGCAGG + Intronic
1088366720 11:109047642-109047664 CACATTCAAGTAACATGAGATGG - Intergenic
1089776021 11:120836593-120836615 GAAATTCTGGTCTCAAGAGCGGG - Intronic
1089778280 11:120854626-120854648 CACTTTCAGGGATCATTAGCAGG - Intronic
1090413410 11:126524401-126524423 AACAGGCAGGTCTCATGTGCTGG + Intronic
1092632252 12:10394697-10394719 CACATTCAGTTCCCAGGGGCAGG - Intronic
1098931336 12:76418541-76418563 CATATTCAGGTCAGATGAGGTGG + Intronic
1102205142 12:111085196-111085218 CACAGTCAGCTCTCAGGAGCTGG - Intronic
1102469771 12:113153160-113153182 GACCTTCAGGACTCAGGAGCTGG - Intronic
1103376925 12:120463946-120463968 CAAATTCCGCTCTCATGAGGTGG - Exonic
1108163456 13:47666957-47666979 CACATTCAAGTCTCATTGCCAGG + Intergenic
1119425904 14:74534600-74534622 AACAATCAGGTCTAATGAGCGGG - Intronic
1119941118 14:78642696-78642718 CACCTCCAGGTCTCCTGAGCAGG + Intronic
1120504885 14:85343013-85343035 CACATGCCTGTCTCTTGAGCAGG + Intergenic
1121295725 14:92820459-92820481 GACATTCAGTTCCCATGGGCAGG + Intronic
1124510636 15:30321410-30321432 CAGAAACAGGTTTCATGAGCAGG - Intergenic
1124732252 15:32209117-32209139 CAGAAACAGGTTTCATGAGCAGG + Intergenic
1125562293 15:40644421-40644443 GACATTCAGTTCCCATGGGCAGG + Intronic
1126252201 15:46581111-46581133 TACAATCAGCTCTCATGAGCTGG - Intergenic
1127341801 15:58053685-58053707 CACATTCTGGTATCATTACCAGG - Intronic
1128780528 15:70356079-70356101 CACATTCAGGTTCCAAGATCAGG - Intergenic
1132419561 15:101653212-101653234 AACATTCAGGGCTTATGTGCCGG - Intergenic
1135046739 16:19162126-19162148 GACATTCAGAGCTGATGAGCAGG - Intronic
1137928617 16:52565367-52565389 CATAATCAGGTCTCGTGAGATGG + Intergenic
1139407444 16:66730287-66730309 CACATTCAGGACTCCTGGGTAGG + Intronic
1141704636 16:85658141-85658163 CAGACACAGGTCTTATGAGCTGG + Intronic
1142896982 17:2986893-2986915 CACAGTCTGGCCTCATGACCTGG + Intronic
1147155584 17:38543123-38543145 CTCTTTCAGGTCTAATGAGCAGG - Intronic
1147523062 17:41193072-41193094 CACCTTCAGGTCTCTTAAGAAGG - Intronic
1157074480 18:44450052-44450074 CATATTAAGTTCTCATCAGCTGG - Intergenic
1157282943 18:46358176-46358198 GTCATGCAGGCCTCATGAGCTGG + Intronic
1159254243 18:65925133-65925155 CATAATCAGATCTCCTGAGCAGG - Intergenic
1160307957 18:77758622-77758644 GACATTCAGGACTTCTGAGCAGG + Intergenic
1160534369 18:79584382-79584404 CACTCTCAGGTCTCAGGGGCTGG + Intergenic
1162931669 19:13960707-13960729 CACTTTCAGGGCTGCTGAGCTGG - Intronic
1164763815 19:30747771-30747793 CACAGGCAGGTTGCATGAGCAGG - Intergenic
1166368822 19:42290562-42290584 CACTTTCGGGTCTCTTGCGCCGG - Exonic
925272392 2:2621488-2621510 AACAATCAGTTCTCATGCGCTGG - Intergenic
926165303 2:10519167-10519189 CACATTCAGGTCTAAGAGGCAGG - Intergenic
926580861 2:14632411-14632433 CACAATCAGCTCGGATGAGCTGG + Intergenic
927141401 2:20133419-20133441 CACATCCAGTTCTCAGGAGCAGG - Intergenic
928051921 2:28007612-28007634 CACATACAGGTTTTATGAACTGG + Intronic
931838996 2:66128981-66129003 GACATCCAGGTCCCATCAGCTGG + Intergenic
931990236 2:67782957-67782979 CTGATTCAGGTCTAATGAGCTGG - Intergenic
932609375 2:73187477-73187499 CACATTAAGGTTTGAGGAGCTGG + Intergenic
932680143 2:73817850-73817872 AAGATTCAGGTCTCATCAACAGG + Intergenic
934164706 2:89283505-89283527 CTCATTCAGATTTCATGAGTTGG + Intergenic
934202568 2:89899019-89899041 CTCATTCAGATTTCATGAGTTGG - Intergenic
936643185 2:114339216-114339238 AAGTTTCAGGTCTCAAGAGCTGG + Intergenic
937292646 2:120790830-120790852 CACAGGCAGGTCTGAGGAGCTGG + Intronic
942783351 2:179671982-179672004 CACCTGCAGTTCTCTTGAGCTGG - Intronic
943633528 2:190280523-190280545 CCCATTAAGATCTCAGGAGCTGG + Intronic
945850326 2:214998617-214998639 AACTTTCAGGTTTCATGAGCAGG - Intronic
946176165 2:217923010-217923032 CACATTCCGGGCTCCTGAGAGGG - Intronic
946441122 2:219696898-219696920 GACAATCAGCTCTCATGAGCTGG - Intergenic
1172578658 20:36029567-36029589 CACGGTCAGCTTTCATGAGCGGG + Intronic
1173576400 20:44115397-44115419 CAGAGACAGTTCTCATGAGCAGG - Intronic
1178123036 21:29488844-29488866 CCCAGTAAGATCTCATGAGCTGG + Intronic
1179456029 21:41500865-41500887 CGCATTCTTGTCTCATAAGCAGG + Intronic
1182426827 22:30278072-30278094 CAAAGGCAGGTCTCGTGAGCAGG + Intergenic
1182450955 22:30420819-30420841 CACATTCAGTTCTCCTGAAGCGG + Intronic
1184441398 22:44518784-44518806 CAAATGCAGGTCACATGACCAGG + Intergenic
1185083956 22:48726333-48726355 CACCTCCAGGTCTCATTTGCTGG - Intronic
952562356 3:34610072-34610094 TACATTCTGGTCTGATGAGATGG + Intergenic
954955203 3:54512680-54512702 CACATCCATGCATCATGAGCAGG - Intronic
955531037 3:59873410-59873432 GCCATTCAAGGCTCATGAGCAGG - Intronic
955995980 3:64681336-64681358 CACATTCCGGTCTCATGATGGGG - Exonic
957646090 3:82929950-82929972 CACATTAAGACCACATGAGCTGG + Intergenic
958884064 3:99706397-99706419 AACATCCAGTTCTCCTGAGCTGG - Intronic
959963268 3:112324985-112325007 CATATTCCAATCTCATGAGCTGG - Intergenic
960966350 3:123107578-123107600 CACATTCAGGTCAGGTGGGCAGG - Intronic
962047679 3:131777836-131777858 CACATGGAGATCTCTTGAGCAGG + Intronic
963006215 3:140728307-140728329 CACAATCAGCTCTCATAAGTTGG - Intergenic
964052532 3:152413442-152413464 ACCTTACAGGTCTCATGAGCTGG - Intronic
965973724 3:174595162-174595184 CACATTCAGGTCTCATGAGCTGG + Intronic
967910011 3:194534926-194534948 TACATTCAGCTCTCAAGAGTAGG - Intergenic
969730756 4:8956093-8956115 GACATTCAGTTCCCATGGGCAGG - Intergenic
969790353 4:9490201-9490223 GACATTCAGTTCCCATGTGCAGG - Intergenic
972670903 4:41213819-41213841 CCCTTTCATGTCTCATGGGCTGG + Intronic
975173365 4:71258966-71258988 CATATTAAGGTGACATGAGCTGG + Intronic
979493547 4:121358406-121358428 CACAATCAGCTCTCATGGGCTGG + Intronic
979756390 4:124345356-124345378 CACAATCAGCTCTCTTTAGCTGG + Intergenic
981890252 4:149727890-149727912 CACAGTCAGCTCTCCTGAGCAGG - Intergenic
982201481 4:152965766-152965788 CACAGTTGGTTCTCATGAGCAGG + Intronic
983750049 4:171256746-171256768 CACACTCAAGTCTCTTGAGTAGG + Intergenic
988420468 5:30999719-30999741 CAAGTTCAGGTCTCATTTGCTGG + Intergenic
988494501 5:31733469-31733491 CACACTCTGGTCCCAGGAGCAGG + Intronic
993434616 5:87876646-87876668 CAAAATCAGCTCTCATGAACTGG - Intergenic
1000507769 5:162143075-162143097 CACAATCAACTTTCATGAGCTGG - Intronic
1000932353 5:167266835-167266857 CACATTCACATTTCATGAACCGG - Intergenic
1001876914 5:175209654-175209676 GTCACTCAGGTCTCATGGGCAGG + Intergenic
1002650581 5:180690028-180690050 GACATTCAGTTCTTAGGAGCAGG + Intergenic
1004257706 6:14080225-14080247 AACACTTAGGTCTCAGGAGCTGG + Intergenic
1004740041 6:18450688-18450710 CACAATTGGTTCTCATGAGCTGG + Intronic
1005404902 6:25476226-25476248 CAAAGTCAGGTCTCAGGAGTAGG - Intronic
1005711065 6:28503205-28503227 CCCGTTCAGGTCTCTTGACCAGG - Intergenic
1008271844 6:49499274-49499296 CACATTTAGGTCTCATAAAATGG - Intergenic
1008585846 6:52948177-52948199 GACATTCAGTTCCCAGGAGCAGG + Intergenic
1010423837 6:75704557-75704579 GACATTCAGTTCCCAGGAGCAGG + Intronic
1011142688 6:84177418-84177440 CACATACAGGCCACGTGAGCTGG - Intronic
1014332635 6:120088870-120088892 CAGAATCAGGTCATATGAGCTGG + Intergenic
1015134367 6:129851146-129851168 CACATATAGGCCACATGAGCTGG - Intronic
1018583875 6:165334488-165334510 CACAGTCAGCACTCATGACCTGG + Intronic
1018871656 6:167788410-167788432 CGCATTCAGGTCTCACCATCTGG + Intronic
1019046022 6:169146806-169146828 CACACTCAGGGCTCATGCTCTGG + Intergenic
1023619229 7:42052775-42052797 CACATTAGGCTCTCGTGAGCTGG + Intronic
1032021154 7:128407799-128407821 CACAGTCAGGTCACCTGAGATGG - Intronic
1035518035 8:253282-253304 GACATTCAGTTCTCAGGGGCAGG - Intergenic
1036284200 8:7429526-7429548 CTGATTCATGTCTCATCAGCTGG + Intronic
1036337276 8:7882004-7882026 CTGATTCATGTCTCATCAGCTGG - Intronic
1038713769 8:29973438-29973460 CACATTCTGGCCTCAAGGGCAGG - Intergenic
1042647138 8:70999350-70999372 GACATTCAGATCTCATGATATGG - Intergenic
1042956726 8:74259139-74259161 CACAGTGAGATCTCTTGAGCTGG - Intronic
1045439637 8:102196951-102196973 CACAATCAGGTCTGGAGAGCAGG - Intergenic
1047359912 8:124159796-124159818 CACATTGAGGTCACTTGAGCAGG + Intergenic
1047439107 8:124860653-124860675 TACATGCAGGTCTCATGAGCAGG + Intergenic
1048334460 8:133492272-133492294 CATCTCCAGGACTCATGAGCTGG - Intronic
1048501950 8:134986187-134986209 CACAATCAGCTTTCATGAGCTGG + Intergenic
1048643944 8:136396548-136396570 CAGCTTCATCTCTCATGAGCAGG + Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1052421645 9:28250606-28250628 CCCATTCAGCCATCATGAGCGGG - Intronic
1055382536 9:75724604-75724626 CAAATTCAGCTCACATGGGCAGG + Intergenic
1055667486 9:78567096-78567118 CACATTCTGTTCCAATGAGCTGG - Intergenic
1056546177 9:87615817-87615839 CACATATAGGTCACAGGAGCCGG + Intronic
1058675796 9:107398949-107398971 CACCTACAGCTCTCTTGAGCTGG + Intergenic
1061745879 9:132740087-132740109 CACATTCAGACCTCAGCAGCTGG + Intronic
1186035790 X:5422010-5422032 CCCAATAAGGTCTCATGAGCTGG - Intergenic
1186756102 X:12673102-12673124 AACATTCAGGTCCAATGAGCTGG + Intronic
1189747953 X:44189481-44189503 CACATGCATCTCTCATGAGTGGG - Intronic
1192184880 X:68940257-68940279 CACCTTAAGGTCTCATCAGTGGG + Intergenic
1193496577 X:82220233-82220255 CACAGTCAGTGCTCTTGAGCTGG - Intergenic
1196768774 X:119273002-119273024 CACCTTCAGTTCCCATTAGCGGG + Intergenic
1197759191 X:130015736-130015758 CACCTACATGTCCCATGAGCTGG + Exonic
1198399404 X:136254574-136254596 CACATACAGGTGGCATGAGTAGG + Intronic
1200555751 Y:4634551-4634573 GACATTCAGTTCTCAGGGGCAGG - Intergenic