ID: 965979753

View in Genome Browser
Species Human (GRCh38)
Location 3:174673585-174673607
Sequence ACTAAAAGCGGATCTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965979750_965979753 24 Left 965979750 3:174673538-174673560 CCAGGCACAGAAAAACAAATATT 0: 23
1: 351
2: 1707
3: 3965
4: 6387
Right 965979753 3:174673585-174673607 ACTAAAAGCGGATCTCATGGAGG 0: 1
1: 0
2: 6
3: 26
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965979753 Original CRISPR ACTAAAAGCGGATCTCATGG AGG Intronic
904412184 1:30331202-30331224 AGAAAAAGGGGATCCCATGGAGG - Intergenic
907778300 1:57540755-57540777 ATCATAAGCTGATCTCATGGAGG + Intronic
909372247 1:74897650-74897672 ACTAAAAGTGGATGCCAAGGTGG - Intergenic
909405033 1:75279247-75279269 TAAAAAAGTGGATCTCATGGAGG - Intronic
909668316 1:78160449-78160471 ACTAACAGCGGATCTCTCAGCGG + Intergenic
909708870 1:78620916-78620938 AATAAAAGTTGATTTCATGGAGG - Intronic
910741664 1:90525811-90525833 AAAAAAAGCTGATCGCATGGAGG + Intergenic
912005146 1:104890231-104890253 AATAAAAGTGGATCTCATGGAGG + Intergenic
913132329 1:115852149-115852171 ACTAAAAGTTGATCTCATGGAGG - Intergenic
916596315 1:166247414-166247436 ACTAACAGCGGATCTCTCGGCGG - Intergenic
917400992 1:174649555-174649577 ACTAACAGCGGATCTCTCTGAGG - Intronic
917558055 1:176112757-176112779 AAAAAAAGTGGATCTCATGGAGG - Intronic
919112628 1:193240060-193240082 GTTAAAAGTTGATCTCATGGAGG - Intronic
919597989 1:199588415-199588437 ACTAGAAGCGCATGTCATCGTGG + Intergenic
921302489 1:213764427-213764449 CCTAAAAGAGGGTCTGATGGAGG - Intergenic
921466825 1:215498282-215498304 AAAAAAAGCTGATCTCATGGAGG - Intergenic
923553727 1:234984688-234984710 ACTAAAATAAGATCTCAAGGTGG + Intergenic
1063229110 10:4046410-4046432 ACTTAAAACTGAACTCATGGCGG + Intergenic
1065799833 10:29342088-29342110 ACTAAAATGGGAGCTAATGGAGG - Intergenic
1067961903 10:50863670-50863692 ACAAAAAGTGGATCTCATGGAGG + Intronic
1068254739 10:54494849-54494871 AGTAAAAGAGGATGTCTTGGTGG + Intronic
1069011722 10:63381544-63381566 ACAAAAAGTGGATCTCATGGAGG + Intronic
1071912344 10:90250521-90250543 TAAAAAAGTGGATCTCATGGAGG + Intergenic
1073835921 10:107442250-107442272 AATAAGAGCTGATCACATGGAGG - Intergenic
1077450590 11:2640875-2640897 TATAAAAGTTGATCTCATGGAGG - Intronic
1078865901 11:15296959-15296981 ATGAAAAGGGGATCCCATGGAGG + Intergenic
1079271701 11:18993031-18993053 ACTAACAGCTGATCTCTTGGTGG - Intergenic
1079828638 11:25232440-25232462 AAAAAAAGTGTATCTCATGGAGG - Intergenic
1081050593 11:38335954-38335976 AGAAAAAGTTGATCTCATGGAGG - Intergenic
1083046874 11:59744578-59744600 AAAAAAAGTGGATCTCATGGAGG + Intronic
1085310531 11:75514012-75514034 GATGAAAGCGGATCTCATGTGGG + Intronic
1085466174 11:76724894-76724916 TTAAAAAGTGGATCTCATGGAGG - Intergenic
1086282341 11:85205327-85205349 AAAAAAAGTGGATCTCATGGAGG + Intronic
1087994692 11:104789638-104789660 ATTAAAAGTTGATCTCATAGAGG + Intergenic
1088773184 11:113056182-113056204 CTAAAAAGTGGATCTCATGGAGG + Intronic
1093073626 12:14734155-14734177 ACTAAATGAGCAGCTCATGGAGG + Intergenic
1093924859 12:24899839-24899861 AAAAAAAGTTGATCTCATGGAGG + Intronic
1094044379 12:26151219-26151241 AACAAAAGCTGATCTCATGCTGG - Intronic
1094646125 12:32326160-32326182 TCTTAAAGCAGATCTCATGATGG + Intronic
1097304029 12:58049499-58049521 TCAAAAAGTGGATCTCATCGAGG + Intergenic
1100420918 12:94432534-94432556 AAAAAAAGTTGATCTCATGGAGG + Intronic
1100563998 12:95776947-95776969 AGTAACAGCTGATCTCTTGGTGG + Intronic
1102443362 12:112980444-112980466 AAAAAAAGTTGATCTCATGGAGG - Intronic
1106626824 13:31429038-31429060 AAAAAAAGTTGATCTCATGGAGG - Intergenic
1107379212 13:39837596-39837618 ACAAAAAGTGCATCTCATGAAGG - Intergenic
1107965327 13:45592705-45592727 ACTAAAAGGGGGTCTCATTATGG + Intronic
1110330563 13:74267523-74267545 TTTAAAAGTTGATCTCATGGAGG + Intergenic
1110824082 13:79952110-79952132 ACAAACAGCAGATCTCTTGGCGG + Intergenic
1111936708 13:94565367-94565389 ACTAAACACGGAGCTCCTGGGGG - Intergenic
1112181963 13:97091876-97091898 TAAAAAAGTGGATCTCATGGAGG + Intergenic
1113181028 13:107626725-107626747 TAAAAAAGTGGATCTCATGGAGG + Intronic
1114723324 14:24906956-24906978 AAAAAAAGTGGATCTCATGGAGG + Intronic
1114898902 14:27031301-27031323 GCTAAAAGTGGATTTCATAGAGG + Intergenic
1115051257 14:29066395-29066417 AAAAAAAGTTGATCTCATGGAGG - Intergenic
1116555327 14:46296257-46296279 ATAAAAAGTTGATCTCATGGAGG - Intergenic
1117124142 14:52603144-52603166 TACAAAAGTGGATCTCATGGAGG - Intronic
1117719046 14:58610595-58610617 CTAAAAAGTGGATCTCATGGAGG + Intergenic
1118040987 14:61916784-61916806 AAAAAAAGTGGATCTCATGGAGG - Intergenic
1118371399 14:65140175-65140197 AAAAAAAGTTGATCTCATGGAGG + Intergenic
1120170125 14:81239723-81239745 AAAAAAAGTGGATCTCATAGAGG - Intergenic
1125098654 15:35884354-35884376 AAAAAAAGTTGATCTCATGGAGG - Intergenic
1125287001 15:38104376-38104398 AAAAAAAGCTGATCTCATGGAGG + Intergenic
1126374275 15:47979508-47979530 TAGAAAAGTGGATCTCATGGAGG + Intergenic
1126741891 15:51785616-51785638 AAAAAAAGTGGTTCTCATGGAGG + Intronic
1136601322 16:31291731-31291753 AAAAAAAATGGATCTCATGGAGG + Intronic
1137407437 16:48200667-48200689 CTTAAAAGCTGATCTCGTGGAGG + Intronic
1137940998 16:52684487-52684509 ACAGAAAGGGAATCTCATGGGGG + Intergenic
1139050761 16:63121602-63121624 ACTAACAGCAGATCTCTCGGCGG + Intergenic
1141505526 16:84475518-84475540 AAAAAAAGTGGATCTCATGGAGG + Intergenic
1143436334 17:6930271-6930293 AGAAAAAGTGGATCTCATGAAGG + Intronic
1149106211 17:52969793-52969815 GTTAAAAGTTGATCTCATGGTGG - Intergenic
1150094279 17:62358735-62358757 ACTAACAGCGGATCTCTCTGTGG + Intergenic
1150540301 17:66089972-66089994 ACTAGCAGCGGATTTCATGGAGG + Intronic
1151554031 17:74837613-74837635 ACTAAAAGCGGCTCCCTTAGGGG + Exonic
1151707846 17:75780371-75780393 ACAAAAAGCAGGTCTCTTGGTGG + Intronic
1153440427 18:5111860-5111882 AAAAAAAGTTGATCTCATGGAGG - Intergenic
1154012219 18:10584599-10584621 CTAAAAAGTGGATCTCATGGAGG - Intergenic
1165129704 19:33623792-33623814 ATTAAAAGAGGATCTCCTGCTGG - Intronic
926810041 2:16747863-16747885 ACTAAAAATGGAACTCATTGTGG + Intergenic
928354113 2:30593112-30593134 TAAAAAAGTGGATCTCATGGAGG - Intronic
929011152 2:37446433-37446455 AAAAAAAGTTGATCTCATGGAGG - Intergenic
931834243 2:66082321-66082343 CTAAAAAGTGGATCTCATGGAGG - Intergenic
935552459 2:104472390-104472412 TCTAAAAGTAGATCTCAAGGTGG + Intergenic
935566123 2:104609103-104609125 ACTAACAGTGGATCTCAAGGCGG + Intergenic
937129846 2:119501416-119501438 AAAAAAAGTGGATCTCTTGGAGG + Intronic
941642669 2:168005866-168005888 AGGAAAAGAGCATCTCATGGGGG + Intronic
942039991 2:172051171-172051193 ACTAAAAGCTGATCATTTGGTGG - Intronic
942424004 2:175839941-175839963 TATAAAAGTTGATCTCATGGAGG - Intergenic
943667448 2:190624746-190624768 GCTAAATGTGGATCTCATGGAGG + Intergenic
946605954 2:221404935-221404957 TTAAAAAGTGGATCTCATGGAGG - Intergenic
947063655 2:226195517-226195539 CCAAAAAGTGGATCTTATGGTGG - Intergenic
1169055617 20:2618212-2618234 TAAAAAAGTGGATCTCATGGAGG - Intronic
1169352656 20:4881601-4881623 TCTAAAAGCTGATCTCTTGAGGG - Intronic
1170186337 20:13595012-13595034 ACTAACAGCTGATTTCTTGGTGG + Intronic
1171904205 20:30887241-30887263 ACTAACAGCTGATCTCTCGGCGG - Intergenic
1174566392 20:51467639-51467661 AGTAAAATGGGATCTCATTGTGG - Intronic
1177790323 21:25715720-25715742 ACGAAAAGTGGATCTAATGTGGG + Intronic
1179631977 21:42684345-42684367 ACAAAAAGCGGTTCCCATGTGGG - Intronic
1180306863 22:11134533-11134555 ACTAACAGCAGATCTCTTGGCGG + Intergenic
1180541180 22:16449002-16449024 ACTAACAGCTGATCTCTTGGCGG + Intergenic
1180545383 22:16496716-16496738 ACTAACAGCAGATCTCTTGGCGG + Intergenic
1181388588 22:22562300-22562322 ACAAAAAGTGGAACTCATAGAGG - Intronic
1181428624 22:22862198-22862220 AAAAAAAGCTGATCTCATGGAGG + Intronic
1181819636 22:25465622-25465644 TTAAAAAGTGGATCTCATGGAGG - Intergenic
1182671880 22:32002980-32003002 AGGAAAAGTGTATCTCATGGAGG - Intergenic
949147842 3:724700-724722 AAAAAAAACTGATCTCATGGAGG + Intergenic
949306516 3:2647668-2647690 AGTAAAAGGAGGTCTCATGGAGG - Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
954496308 3:50967217-50967239 TAAAAAAGTGGATCTCATGGAGG - Intronic
954949908 3:54463131-54463153 ACTAACAGCGGATCTCTCGGCGG - Intronic
955425489 3:58785222-58785244 TCAAAAAGTGGATCTCATGGAGG + Intronic
956834795 3:73088031-73088053 AGAAAAAGTGGATTTCATGGAGG - Intergenic
958166464 3:89883806-89883828 ACTAACAGCTGATCTCTTGGCGG - Intergenic
958724337 3:97886218-97886240 AATAAAAGCTGATCTCATCGGGG - Intronic
959016513 3:101140242-101140264 ACCAAATGCTGATCTCACGGAGG - Intergenic
959129167 3:102331417-102331439 AGAAAAAGTTGATCTCATGGAGG - Intronic
962591707 3:136896338-136896360 TTTAAAAGATGATCTCATGGAGG - Intronic
965979753 3:174673585-174673607 ACTAAAAGCGGATCTCATGGAGG + Intronic
966158187 3:176940856-176940878 AAAAAAAGTGGATCTCATGGAGG + Intergenic
966924349 3:184634779-184634801 ATTAAAAACGATTCTCATGGAGG - Intronic
967481676 3:189980239-189980261 ACTAAAAGGGGATGTCAGGGAGG - Intronic
968278884 3:197460384-197460406 TCCAAAAGCAGATCTCATGAAGG + Intergenic
969200849 4:5604492-5604514 AAAAAGAACGGATCTCATGGAGG + Intronic
969591381 4:8123662-8123684 CCTTAAAGCGGGTCTCCTGGGGG + Intronic
973035809 4:45404858-45404880 ACAAAAAGTTAATCTCATGGAGG + Intergenic
978020047 4:103797474-103797496 AAAAAAAGTTGATCTCATGGAGG - Intergenic
979813400 4:125066911-125066933 TATAAAAGCTGATCTCATGGAGG + Intergenic
979980163 4:127245276-127245298 AATAAAAGTGGATCCCTTGGAGG + Intergenic
983009388 4:162527518-162527540 TGAAAAAGTGGATCTCATGGAGG - Intergenic
983799783 4:171912747-171912769 TGAAAAAGTGGATCTCATGGTGG - Intronic
984673685 4:182522385-182522407 GAGAAAAGTGGATCTCATGGAGG - Intronic
985151405 4:186950653-186950675 AAAAAAAGATGATCTCATGGAGG - Intergenic
989175359 5:38519671-38519693 TAAAAAAGCTGATCTCATGGAGG - Intronic
989337699 5:40337673-40337695 ACTAACAGCAGATCTCTCGGTGG + Intergenic
989996874 5:50845391-50845413 AATAAATACGGATTTCATGGTGG + Exonic
990246492 5:53868206-53868228 AAAAAAAGCTGAGCTCATGGAGG + Intergenic
991906580 5:71519508-71519530 TTAAAAAGTGGATCTCATGGAGG - Intronic
993349404 5:86829471-86829493 GCTAAAAGTTGATCTTATGGAGG - Intergenic
993429115 5:87809970-87809992 AAAAAAAGTGGATCTCATGAAGG - Intergenic
993541019 5:89151714-89151736 ATAAAAAGTTGATCTCATGGAGG - Intergenic
995116835 5:108490715-108490737 AATGAAAGTTGATCTCATGGAGG + Intergenic
995953369 5:117744138-117744160 AAAAAAATTGGATCTCATGGAGG - Intergenic
996473997 5:123894359-123894381 TAAAAAAGTGGATCTCATGGGGG + Intergenic
1000525782 5:162355831-162355853 TAAAAAAGTGGATCTCATGGAGG - Intergenic
1004026701 6:11826434-11826456 TCTAGAAGTTGATCTCATGGAGG - Intergenic
1004815886 6:19311346-19311368 AGAAAAAGTTGATCTCATGGGGG + Intergenic
1008202587 6:48609855-48609877 AAAAAAAGTGAATCTCATGGAGG + Intergenic
1009636452 6:66271205-66271227 AAGTAAAGTGGATCTCATGGAGG + Intergenic
1010516834 6:76783666-76783688 AAAAAAAGTGGATCTCATGGAGG + Intergenic
1010615533 6:78007326-78007348 ACTAACAGCAGATCTCTCGGCGG + Intergenic
1011353615 6:86450780-86450802 ACAAAAAGTAAATCTCATGGAGG - Intergenic
1017060511 6:150480460-150480482 ACTCAAAGTTGATCTCAAGGAGG + Intergenic
1017661225 6:156675902-156675924 CAAAAAAGCAGATCTCATGGAGG + Intergenic
1020762934 7:12290230-12290252 GCTGAATGTGGATCTCATGGCGG + Intergenic
1021393202 7:20119604-20119626 GCTAAAAGCAGATCTCATGGTGG + Intergenic
1021746977 7:23751073-23751095 AAAAAAAGTTGATCTCATGGAGG - Intronic
1022765443 7:33406790-33406812 ACTAACAGCGGATCTCTTGGCGG - Intronic
1023704039 7:42920943-42920965 TAAAAAAGTGGATCTCATGGAGG + Intronic
1027406655 7:77869446-77869468 TATAAAAGTTGATCTCATGGAGG - Intronic
1029806054 7:102997619-102997641 TAAAAAAGTGGATCTCATGGAGG - Intronic
1029810230 7:103039612-103039634 ACTAACAGGGGATCTCTCGGCGG + Intronic
1030422045 7:109319373-109319395 TAAAAAAGTGGATCTCATGGAGG + Intergenic
1030802903 7:113875465-113875487 AAGAAAAGTGGATCTCAGGGAGG - Intergenic
1032430949 7:131861057-131861079 CCTAACAGGGGGTCTCATGGTGG - Intergenic
1035818786 8:2569208-2569230 ATCAAAAGCGGAGCCCATGGCGG - Intergenic
1037970619 8:23169172-23169194 ACTGAAACAGGATCTCATGTTGG + Intergenic
1040736238 8:50512271-50512293 ACTAACAGCTGATCTCTCGGTGG - Intronic
1043279596 8:78446627-78446649 ACTAACAGCAGATCTCTTGGTGG + Intergenic
1043665987 8:82814706-82814728 TAAAAAAGCAGATCTCATGGAGG - Intergenic
1044498275 8:92917926-92917948 TGAAAAAGTGGATCTCATGGAGG - Intronic
1044753330 8:95436951-95436973 AGAACAAGGGGATCTCATGGGGG - Intergenic
1045622682 8:104000251-104000273 GCTAAAAATTGATCTCATGGAGG - Intronic
1046228570 8:111321105-111321127 AAAAAAAGCTGATCTCATTGAGG + Intergenic
1046318634 8:112540722-112540744 ACAAAAAATTGATCTCATGGAGG + Intronic
1048041504 8:130733234-130733256 CCTAAAAATGGCTCTCATGGGGG + Intergenic
1048466578 8:134669388-134669410 ACTAACAACGGATCTCTCGGCGG + Intronic
1049161027 8:141097709-141097731 AAAAAAAGTGGATCTCATGAAGG - Intergenic
1051110853 9:13633968-13633990 AAAAAAAACTGATCTCATGGAGG + Intergenic
1051202196 9:14639300-14639322 CAAAAAAGCTGATCTCATGGAGG + Intronic
1051626012 9:19100876-19100898 AAAAAAAGTGGACCTCATGGAGG + Intronic
1058716799 9:107729560-107729582 CAAAAAAGTGGATCTCATGGAGG - Intergenic
1059436769 9:114281833-114281855 ACTGGAAGCGGGTCTCATTGGGG + Intronic
1059685484 9:116631507-116631529 TGAAAAAGTGGATCTCATGGAGG + Intronic
1059843769 9:118247900-118247922 TAAAAAAGTGGATCTCATGGAGG - Intergenic
1061853191 9:133428098-133428120 ACCCAAAGCGGAACTGATGGAGG - Intronic
1188740350 X:33770711-33770733 TTTAAAAGGGGATCCCATGGTGG + Intergenic
1190271716 X:48869450-48869472 ACTAACAGCTGATCTCTCGGCGG + Intergenic
1192079970 X:68038349-68038371 AAAAAAAGTTGATCTCATGGAGG + Intergenic
1192762823 X:74112477-74112499 AAAAAAAAAGGATCTCATGGAGG + Intergenic
1192828320 X:74722945-74722967 GCTAAAACTGGTTCTCATGGAGG + Intergenic
1192989710 X:76437163-76437185 TTTAAAAGGTGATCTCATGGAGG - Intergenic
1193516845 X:82476430-82476452 ACTAACAGCAGATCTCTCGGTGG - Intergenic
1194610691 X:96039610-96039632 TAAAAAAGTGGATCTCATGGAGG - Intergenic
1195250077 X:103034982-103035004 GTAAAAAGTGGATCTCATGGAGG - Intergenic
1195791104 X:108587311-108587333 AAAAAAAGTTGATCTCATGGAGG - Intronic
1196132924 X:112176874-112176896 TAAAAAAGTGGATCTCATGGAGG - Intergenic
1196883180 X:120218950-120218972 ACAAAAAAAGGACCTCATGGAGG + Intergenic
1197060283 X:122171074-122171096 AATTAAAGCAGATATCATGGAGG - Intergenic
1197414240 X:126154609-126154631 ACTAACAGCGGATCTCTCAGCGG + Intergenic
1198395965 X:136219587-136219609 ACTAACAGAGGATCTGCTGGTGG + Exonic
1199275012 X:145930631-145930653 TCCAATAGTGGATCTCATGGAGG - Intergenic
1200177589 X:154127831-154127853 AGTAAAATGGTATCTCATGGTGG - Intergenic
1201650674 Y:16282402-16282424 TACAAAAGTGGATCTCATGGAGG - Intergenic
1201702905 Y:16903422-16903444 ACTAACAGTGGATCTCTCGGTGG + Intergenic
1202111923 Y:21429687-21429709 TCTAAAAGCAGATCTCACAGAGG + Intergenic