ID: 965983394

View in Genome Browser
Species Human (GRCh38)
Location 3:174721772-174721794
Sequence GGGTCACGTGGAGCACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965983388_965983394 -4 Left 965983388 3:174721753-174721775 CCCAGCCCAGAATACCGCAGGGT 0: 1
1: 0
2: 1
3: 6
4: 119
Right 965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 147
965983389_965983394 -5 Left 965983389 3:174721754-174721776 CCAGCCCAGAATACCGCAGGGTC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 147
965983391_965983394 -10 Left 965983391 3:174721759-174721781 CCAGAATACCGCAGGGTCACGTG 0: 1
1: 0
2: 0
3: 0
4: 44
Right 965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 147
965983390_965983394 -9 Left 965983390 3:174721758-174721780 CCCAGAATACCGCAGGGTCACGT 0: 1
1: 0
2: 0
3: 2
4: 30
Right 965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 147
965983385_965983394 18 Left 965983385 3:174721731-174721753 CCAGATTAGTTGTGCTGGTTCTC 0: 1
1: 0
2: 0
3: 14
4: 173
Right 965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965983394 Original CRISPR GGGTCACGTGGAGCACCAGC TGG Intronic
900159890 1:1218559-1218581 GGGCACCGTGGAGAACCAGCAGG - Exonic
900600401 1:3500314-3500336 GGCTCACTTGGAGCCGCAGCAGG - Intronic
902807913 1:18872371-18872393 GGGGCACAGGGGGCACCAGCTGG - Exonic
906295271 1:44645637-44645659 GAGTCACGCTTAGCACCAGCTGG - Intronic
907338328 1:53715412-53715434 GAGTCATGTGGAGGACAAGCAGG + Intronic
917080333 1:171251587-171251609 GCCTCACATGGGGCACCAGCTGG + Intronic
920095530 1:203484060-203484082 GGGACAGGTGGAGCACAAGCAGG - Exonic
920552810 1:206878355-206878377 GGTTCAGGTGGACCATCAGCTGG - Intergenic
920903140 1:210132325-210132347 GTGGCACGTGGCACACCAGCAGG - Intronic
921168698 1:212526392-212526414 AGTTCACGTGAAGCACCTGCAGG - Intergenic
921379752 1:214512343-214512365 GGGCCACATGGAGAAGCAGCAGG - Intronic
921580097 1:216886249-216886271 GGGTCACCTGGAGCTGCAACAGG + Intronic
922717052 1:227883267-227883289 GGCTCACGTGGAAAAGCAGCAGG - Intergenic
923630969 1:235649500-235649522 GTGTCGCGTGCAGCAGCAGCTGG + Intronic
924623419 1:245681542-245681564 GGGTCACGTGGAGATACAGGGGG + Intronic
1069897226 10:71687317-71687339 GGCTCAGCTGGAGGACCAGCGGG + Intronic
1070813646 10:79310679-79310701 GGGCCACGTGGAGCCCCAGGAGG - Intronic
1072737975 10:97891882-97891904 GGGTCACGAGGCGCCTCAGCAGG - Intronic
1077030125 11:461750-461772 GGGTCACGTGCAGAACCTGCAGG + Intronic
1077062629 11:624568-624590 GAGTCACGTTGAGAAACAGCTGG + Exonic
1077092835 11:787493-787515 GGCTCCCCTGGAGCACAAGCTGG + Exonic
1077321534 11:1944873-1944895 GGGTCACGTGTAGCCCAGGCTGG - Intergenic
1078264917 11:9747900-9747922 GTGGCACTTGGAGCAGCAGCAGG + Exonic
1082810433 11:57476266-57476288 GGTTCCCGTGCAGCAGCAGCCGG - Exonic
1084041728 11:66546554-66546576 GGCTCACGAGGAGCTCCAGAGGG + Exonic
1089152472 11:116374570-116374592 GGGGCATGTGGAGCATCAGCAGG - Intergenic
1090949753 11:131463306-131463328 GGGGCACGTGCATCACCAGGAGG + Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1202804552 11_KI270721v1_random:186-208 GGGTCACGTGTAGCCCAGGCTGG - Intergenic
1091691754 12:2601919-2601941 GGGACACGCTGACCACCAGCAGG - Exonic
1095291093 12:40481188-40481210 GGGACAACTGGAGCACCAGCTGG + Exonic
1095291677 12:40485704-40485726 GGGACAATTGGATCACCAGCTGG + Exonic
1095292229 12:40489481-40489503 GGGACAATTGGATCACCAGCTGG + Exonic
1102956231 12:117060837-117060859 GGACCACGTGGAGCTCCAGAGGG + Intronic
1103944738 12:124519779-124519801 GGGTCCCCTGGTTCACCAGCTGG + Intronic
1104041544 12:125134255-125134277 GGGAAACATGGCGCACCAGCCGG - Intronic
1104569904 12:129916076-129916098 GGCTCAAGTGGAGCCCCTGCTGG + Intergenic
1105544296 13:21340504-21340526 GGGTCAGGTGGGGCTCCAGAGGG - Intergenic
1113311964 13:109140751-109140773 GGGTCGGGGGGAACACCAGCAGG - Exonic
1113403486 13:110017480-110017502 AGCGCACGTGCAGCACCAGCTGG - Intergenic
1113431158 13:110251361-110251383 GGGGCAGGGGAAGCACCAGCAGG + Intronic
1114483356 14:23048456-23048478 GGGCCACGAAGAGCACCACCAGG + Exonic
1117577158 14:57110896-57110918 GGGACACGTGCAGAACCTGCAGG - Intergenic
1118292929 14:64542028-64542050 GGGTCACGTCGAGTAGCAGCAGG - Exonic
1120418072 14:84244658-84244680 GGGTCAAGGGGAGGACCAGGTGG - Intergenic
1120937188 14:89908999-89909021 GTGTCATCTGGAGCACCAACTGG - Intronic
1127922454 15:63504393-63504415 GGGTCCCGGCGAGCTCCAGCTGG - Intergenic
1132519882 16:382071-382093 GGGTCACGTGGGGCGCCGGTAGG + Intronic
1132819931 16:1859917-1859939 GGTTCACCTGGAGCCTCAGCAGG - Intronic
1132890272 16:2200283-2200305 GTGGCAGGTGGAGCCCCAGCAGG + Intergenic
1133188081 16:4114881-4114903 GGGTCAGGGCGAACACCAGCAGG + Exonic
1133426448 16:5694490-5694512 GGGTGATTTGGAGGACCAGCTGG + Intergenic
1137692718 16:50440778-50440800 GGTTCCTGTGGAGAACCAGCAGG + Intergenic
1141140616 16:81494561-81494583 GGGTCAGGAGGAGCCCCAGCCGG + Intronic
1142224764 16:88872024-88872046 GGGCCACCTGGAGCTCCAGGTGG - Intergenic
1142278977 16:89137928-89137950 GGGACACATGGAGCCCCAGCTGG - Intronic
1142501674 17:336578-336600 GGGCAACGGGGAGCCCCAGCAGG - Intronic
1142552002 17:746593-746615 GGATCAGGTGGATCACCTGCCGG + Exonic
1144788753 17:17846062-17846084 GGGTCATGCTGAGCACCAACAGG - Intronic
1145218429 17:21069428-21069450 GGGGCAGGAGGAGCAGCAGCAGG + Intergenic
1147567546 17:41547077-41547099 GGGTCAGGTAAAGCACCAGAGGG - Intergenic
1148794946 17:50192494-50192516 GCTTCACCTGGAGGACCAGCAGG + Exonic
1149249769 17:54754840-54754862 TGGTCACGCAGCGCACCAGCTGG + Intergenic
1151390851 17:73785824-73785846 GGGCCACGTGGAGCTGCAGCCGG + Intergenic
1152901071 17:82941468-82941490 GGGTTACCTGGGGCACCAGCTGG - Exonic
1154325823 18:13389699-13389721 GAGCCACGTGGACCACCATCAGG - Intronic
1160781314 19:878944-878966 GGGGCACGTGGAGCTGCGGCCGG - Intronic
1160987216 19:1844629-1844651 GAGTCGCCTGGAGCCCCAGCTGG + Intronic
1160991425 19:1861876-1861898 GGGACACGTGGAGCAGCCGAAGG - Intronic
1161510892 19:4670383-4670405 GGGACACGTGGAGCGTCCGCCGG + Intergenic
1162728741 19:12705281-12705303 TGGTCACGTGGAGCAGCTGGTGG - Exonic
1164672768 19:30082361-30082383 GGGCCACGTGGGGCAGCACCAGG + Intergenic
1165429588 19:35764966-35764988 GGGCCACGTGGAGCCGCAGTAGG - Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
925704493 2:6670931-6670953 GGGTCAAGGGAAACACCAGCTGG - Intergenic
926581270 2:14634210-14634232 GAGTCTCGTTGAGGACCAGCTGG - Exonic
927517004 2:23677683-23677705 GAGGCGCGTGGAGCAGCAGCGGG + Intronic
928170688 2:29001144-29001166 GGGCCACCTTGAGCCCCAGCTGG - Intronic
928410723 2:31052065-31052087 TGGTCCCGTGGAGCGCCATCGGG - Intronic
929221480 2:39468996-39469018 GGGTCCTCTGGAGCAGCAGCAGG - Intergenic
931264875 2:60651930-60651952 GTGTTCCGTGCAGCACCAGCTGG + Intergenic
931833996 2:66080222-66080244 GCATCACGTGGAGCTCCAGGAGG + Intergenic
937839776 2:126513400-126513422 GTGTGACATGGACCACCAGCAGG - Intergenic
940808215 2:158211781-158211803 TGGGCAAATGGAGCACCAGCTGG - Intronic
944440966 2:199743017-199743039 GGGTTACCTGGAGGGCCAGCTGG + Intergenic
948808143 2:240461745-240461767 GGGCCACGGGGAGCACAAGTGGG + Intronic
948901940 2:240960566-240960588 GGGTCAGCTGGAGCCCCAGCGGG + Intronic
1173955996 20:47033115-47033137 GGCTCACCTGCAGCAGCAGCTGG - Intronic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1176235343 20:64051140-64051162 GGGGCCCGTGGGGCACCAGGAGG + Intronic
1179491028 21:41741719-41741741 GGGTGTCGTGGAGCTCCTGCTGG - Exonic
1179900595 21:44391496-44391518 GGGCCACGTGGTGCATCTGCAGG - Exonic
1180057733 21:45367539-45367561 GTGTCGCCTGGAGCTCCAGCAGG + Intergenic
1180899741 22:19361612-19361634 GGGTCACCTTGGGAACCAGCTGG - Intronic
1181047738 22:20223616-20223638 TGGTCAAGTGGAACCCCAGCAGG + Intergenic
1183032173 22:35114472-35114494 CGTGCACGTGGAGCTCCAGCTGG - Intergenic
1183524105 22:38313793-38313815 GGGTCAGCTGGGTCACCAGCTGG - Intronic
1184785160 22:46668134-46668156 GGGCGACGTCCAGCACCAGCTGG - Exonic
1185413630 22:50698269-50698291 AGGCCACGTGATGCACCAGCTGG - Intergenic
950456139 3:13093785-13093807 GAGTCACGTGGACCAACAGTGGG - Intergenic
952961536 3:38594365-38594387 GGATCACTTGGATCCCCAGCGGG - Intronic
954539558 3:51384716-51384738 CGGTCAGGTGGAGGATCAGCAGG + Intergenic
956327010 3:68064201-68064223 GGATCACGTGAAAAACCAGCTGG + Intronic
957695684 3:83635836-83635858 GTGTCACCTGGAGCGCTAGCGGG + Intergenic
960307419 3:116078854-116078876 GGGTTACTTGGAGAAACAGCTGG - Intronic
965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG + Intronic
966196918 3:177323024-177323046 GGGTCACGTGGGCCAATAGCGGG - Intergenic
969207097 4:5655300-5655322 AGTTCACCTGGAGCACCAGATGG - Intronic
969577905 4:8047124-8047146 GGGCCACGTGCAGCAGCAGGAGG + Intronic
975724169 4:77276005-77276027 GGGTCAGTTGGAGCCTCAGCTGG + Intronic
976698621 4:87945213-87945235 GTGGCACGTGGAGCCCAAGCAGG + Intergenic
984925561 4:184803371-184803393 GGGTCTCGTGGCGTACCAGAAGG + Exonic
985826109 5:2192721-2192743 GGGTCAGGTGGAGCTGCACCTGG - Intergenic
985913082 5:2897944-2897966 GGGTCACGGGCAGAGCCAGCAGG - Intergenic
986363923 5:7010471-7010493 GGGTCACATGGAGCTTCAGAGGG - Intergenic
992534804 5:77689017-77689039 AGGTCAGGAGGATCACCAGCTGG - Intergenic
993709726 5:91212953-91212975 TGGTCATGTGAGGCACCAGCAGG - Intergenic
995841381 5:116446577-116446599 GGGTCAGGTGTCGAACCAGCAGG - Exonic
1000830311 5:166093918-166093940 GGGTCCCTTTGAGCCCCAGCTGG + Intergenic
1001148389 5:169204639-169204661 GGGTCACCTGTGGCAACAGCGGG + Intronic
1001256185 5:170185133-170185155 GGGGCTCTTGGAGCACCACCTGG + Intergenic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1002442822 5:179273179-179273201 GGTTCAAGCTGAGCACCAGCTGG - Intronic
1005418595 6:25626919-25626941 GGGCCACATGGAGAAGCAGCAGG + Intergenic
1005710566 6:28500252-28500274 TGGTCACCTGGAGCAACTGCAGG + Intergenic
1008308298 6:49933599-49933621 GGGTCCCATGGTGCAGCAGCGGG - Intergenic
1015244576 6:131062719-131062741 GGGCCCCGTGGAGCAACAGCGGG - Intronic
1018363544 6:163096391-163096413 GGGTCACCTGGTGGACAAGCAGG + Intronic
1019176054 6:170160087-170160109 GGGCCTCGGGCAGCACCAGCAGG + Intergenic
1019399652 7:844910-844932 GGCTCACGTGCAGCACCCCCGGG - Intronic
1019440493 7:1043815-1043837 GGGCCGAGTGGAACACCAGCAGG - Intronic
1019466520 7:1192587-1192609 GGGACATGGGGAGCACCAGCAGG + Intergenic
1019609121 7:1928110-1928132 GGGTCGTGGGGAGCAGCAGCAGG - Intronic
1019713276 7:2526976-2526998 GGGCCTCGTGGAGCTGCAGCAGG + Intronic
1020445510 7:8262573-8262595 TGGCCACGTGGAACACCTGCCGG - Intronic
1022972139 7:35528158-35528180 AGGTCACCTGGAGGCCCAGCTGG - Intergenic
1024109844 7:46133993-46134015 GGGTCAAGTGGAGTACCTGCTGG - Intergenic
1026057274 7:66995609-66995631 GCGTCAGGTGGAGCAGAAGCCGG + Intronic
1026202209 7:68224065-68224087 GGGGCACGGGGAGCACGAGGTGG + Intergenic
1026720840 7:72829442-72829464 GCGTCAGGTGGAGCAGAAGCCGG - Intergenic
1031186739 7:118490958-118490980 GGGTCACCTGAAGCATCTGCTGG + Intergenic
1032383636 7:131506854-131506876 GGCCTGCGTGGAGCACCAGCTGG - Intronic
1033726843 7:144127967-144127989 GGATCAGGTGCAGCCCCAGCTGG - Intergenic
1035530665 8:348314-348336 GGGTCGCCTGGAGCTCGAGCTGG + Intergenic
1040391527 8:46954762-46954784 GGGTCCCCCGGAGCACCCGCGGG + Intergenic
1040737681 8:50530170-50530192 TGGTCACTTGGAGCACCTGCAGG - Exonic
1042867862 8:73371295-73371317 GGGTTACATGGAGCACTAACAGG - Intergenic
1045696356 8:104812993-104813015 GGGTGCCGTGGAGCACCATTTGG + Intronic
1050203938 9:3177825-3177847 GGGTCACATGGAGAAGCACCTGG - Intergenic
1053557692 9:39154828-39154850 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1053821806 9:41975116-41975138 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1054139422 9:61464123-61464145 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1054608765 9:67212292-67212314 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1060840003 9:126785605-126785627 GGGTGAAGTGGAGAACCAGGAGG + Intergenic
1061810663 9:133161139-133161161 TGGTCACCGGGAGCAACAGCAGG + Intronic
1185777464 X:2816196-2816218 GGGTCATGAGGACCACCTGCTGG + Intergenic
1187098778 X:16171141-16171163 GGGGTACCTGGAGTACCAGCAGG + Exonic
1189446229 X:41084641-41084663 GCGTCACGTGACGCACGAGCTGG - Intergenic
1200951460 Y:8903089-8903111 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1201011071 Y:9548358-9548380 GGGGCAGGTGGAGGCCCAGCGGG + Intergenic
1201292523 Y:12434932-12434954 GGGTCATGAGGACCACCTGCTGG - Intergenic
1202161487 Y:21940223-21940245 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202229869 Y:22646150-22646172 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202313287 Y:23550015-23550037 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202557515 Y:26120579-26120601 GGCCGACGTGGAGCAGCAGCAGG - Intergenic