ID: 965984127

View in Genome Browser
Species Human (GRCh38)
Location 3:174731128-174731150
Sequence AACATTTATGACTTTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 392}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965984121_965984127 25 Left 965984121 3:174731080-174731102 CCGCACACTATCATGGAAAGTGC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 965984127 3:174731128-174731150 AACATTTATGACTTTGAGCTGGG 0: 1
1: 0
2: 1
3: 46
4: 392
965984125_965984127 -1 Left 965984125 3:174731106-174731128 CCACACACTATCATGGAAAGGCA 0: 1
1: 0
2: 1
3: 12
4: 123
Right 965984127 3:174731128-174731150 AACATTTATGACTTTGAGCTGGG 0: 1
1: 0
2: 1
3: 46
4: 392
965984120_965984127 26 Left 965984120 3:174731079-174731101 CCCGCACACTATCATGGAAAGTG 0: 1
1: 0
2: 0
3: 3
4: 109
Right 965984127 3:174731128-174731150 AACATTTATGACTTTGAGCTGGG 0: 1
1: 0
2: 1
3: 46
4: 392
965984124_965984127 0 Left 965984124 3:174731105-174731127 CCCACACACTATCATGGAAAGGC 0: 1
1: 0
2: 1
3: 9
4: 82
Right 965984127 3:174731128-174731150 AACATTTATGACTTTGAGCTGGG 0: 1
1: 0
2: 1
3: 46
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965984127 Original CRISPR AACATTTATGACTTTGAGCT GGG Intronic
901592232 1:10354367-10354389 ATCATCTATGACTTTCAGTTTGG + Intronic
901621390 1:10590936-10590958 AACATTTATAGCATTCAGCTGGG + Intronic
903402810 1:23069538-23069560 AAAATTTATGAATTTGTGTTGGG + Intronic
903584681 1:24403023-24403045 AATATTTGTGACCTTGAGTTAGG - Intronic
903983707 1:27209117-27209139 AAAATTTATGAATTTGTGTTGGG - Intergenic
904830652 1:33304474-33304496 AAAATTTCTGCCTGTGAGCTGGG - Intergenic
905112709 1:35608493-35608515 AACATTTATCATTTTGTGTTGGG - Intronic
906182987 1:43837672-43837694 AAGAATTATGAGTTTGAGCTGGG + Intronic
907197807 1:52700832-52700854 AACAGGAATGACTTTGAGCCAGG - Intergenic
907591760 1:55680673-55680695 TATATTTATGACCTTGAGGTAGG - Intergenic
908661607 1:66443066-66443088 AACTTTTGTGACTTTGGGTTAGG - Intergenic
910621350 1:89259364-89259386 AACATTATTGGCTTTCAGCTTGG + Intronic
910956160 1:92708071-92708093 AATCTTCATGACTTTGAGTTAGG + Intronic
911280409 1:95920405-95920427 AAAGTTTATGAATTTGTGCTGGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911651765 1:100396992-100397014 AACGTTTATGAATTTGTGTTAGG - Intronic
911973525 1:104464869-104464891 AACATTTATGACCTTCTGCTGGG - Intergenic
912086223 1:106008684-106008706 AATATTTGTGACTTTGGGTTAGG + Intergenic
912320633 1:108709396-108709418 AGCAGGTATGACTTTGAGCCAGG + Intergenic
912616412 1:111104657-111104679 AACATTTATTTCTTTGTGCTGGG + Intergenic
913572694 1:120136905-120136927 AATCTTTGTGACTTTGAGTTAGG + Intergenic
914293958 1:146301690-146301712 AATCTTTGTGACTTTGAGTTAGG + Intergenic
914555002 1:148752473-148752495 AATCTTTGTGACTTTGAGTTAGG + Intergenic
915221052 1:154374894-154374916 AAAATTTATGATTTTTGGCTGGG + Intergenic
916325280 1:163550243-163550265 AAATTTTGTGACTTTGGGCTAGG - Intergenic
918457921 1:184744002-184744024 AAAATTTGTGACATTGGGCTAGG + Intronic
918774888 1:188614680-188614702 AACATGTATGACATTGTCCTGGG + Intergenic
919443766 1:197674545-197674567 AACATTTATATTTTTGAGCCAGG - Intronic
919488303 1:198171698-198171720 AACCTTTATGATTTTGGCCTTGG + Intronic
920050310 1:203160837-203160859 AACATTTATTTCTATGTGCTGGG - Intronic
920318206 1:205095332-205095354 AAAATTTATGAATTTGTGTTGGG - Intronic
921835274 1:219772078-219772100 AATATTTATTACTCTAAGCTTGG + Intronic
922286938 1:224178478-224178500 AACATTCATGAATTTGGGCCAGG + Intronic
922545734 1:226455382-226455404 CACAGTTCTGACTTGGAGCTGGG + Intergenic
922990403 1:229904585-229904607 AACAATTATGACATTGGGTTAGG + Intergenic
923387806 1:233482940-233482962 AACGTTTATGAATTTGTGTTGGG + Intergenic
923899356 1:238309044-238309066 AACATTCATGACACTGAACTAGG - Intergenic
924079505 1:240379395-240379417 AAGCTTTCTGACTTTTAGCTGGG - Intronic
924649391 1:245910817-245910839 AACACTTCAGACATTGAGCTGGG + Intronic
1063946769 10:11183983-11184005 AACCTTTATGACCTTGGGTTAGG - Intronic
1064469866 10:15625167-15625189 AACATTTATGAGTTGGAACATGG + Intronic
1065337269 10:24665759-24665781 AACACGTATGACCTTGAACTAGG + Intronic
1066134548 10:32431332-32431354 AAGCTTTATGACATTGATCTAGG - Intergenic
1066296512 10:34058598-34058620 AATATTTATGAATTTGTGTTGGG - Intergenic
1066476524 10:35752420-35752442 AACATTTTTGACATAGATCTAGG + Intergenic
1067265102 10:44735101-44735123 AAGATTTATAACTTTGGTCTTGG + Intergenic
1067842670 10:49693872-49693894 AACATTAAGGACTTGGAGTTCGG + Exonic
1069426664 10:68294528-68294550 AAGATGTATGACTTTGGGCAAGG - Intronic
1069783517 10:70972779-70972801 AATCTTTATGACCTTGAGTTAGG + Intergenic
1070246254 10:74734513-74734535 AATATTTGTGACTTTGGGCTAGG - Intergenic
1070323265 10:75370997-75371019 CACTTTTCTCACTTTGAGCTAGG - Intergenic
1071846785 10:89528971-89528993 ATCATTTATGCCTGTGAGTTTGG + Intronic
1072408725 10:95180669-95180691 AAAATTTCTTACTTTCAGCTAGG + Intergenic
1072643792 10:97235453-97235475 ATCATTTCTGACTTTGTGATTGG - Intronic
1072912255 10:99513624-99513646 AACATTTATTAGTTAGAGCTGGG + Intergenic
1073772255 10:106747810-106747832 AACATTTATTTCTTTGGGCTGGG - Intronic
1074217530 10:111400911-111400933 AATGTTCATGACTTTGAGTTAGG - Intergenic
1074461542 10:113642643-113642665 AGCATTCATCACTATGAGCTGGG + Intronic
1074582414 10:114732628-114732650 AATCTTTATGACTTTGGACTAGG - Intergenic
1075625531 10:123961825-123961847 AATGTTTATTTCTTTGAGCTAGG - Intergenic
1076317546 10:129553019-129553041 AAAATTAATGACATAGAGCTTGG + Intronic
1076681643 10:132175178-132175200 AATATTTGTGACTTTGAGTTAGG - Intronic
1077757167 11:5044736-5044758 AAAATTTTTGACTCTGATCTAGG - Intergenic
1078299813 11:10117048-10117070 AATATTTATCTCTTTGATCTGGG - Intronic
1078587550 11:12606385-12606407 ATCATTAATTACTTGGAGCTTGG + Intergenic
1078706149 11:13746136-13746158 AAGACTGATGACTTTGAGCTTGG + Intergenic
1079745778 11:24127717-24127739 AACATTAATGATTTTTAGATAGG - Intergenic
1079762149 11:24342445-24342467 AAAAATTATGACTTTGGGGTAGG - Intergenic
1080109480 11:28549256-28549278 TACTCTCATGACTTTGAGCTGGG - Intergenic
1084129463 11:67121766-67121788 AGGATTTGTGACTTTGAGCGGGG + Intronic
1084291540 11:68173016-68173038 AACTTTTATCCCTTTTAGCTGGG + Intronic
1084582148 11:70030695-70030717 GACATTAAGGACTTTGAGATGGG - Intergenic
1084677266 11:70642952-70642974 AACATGTATTTCTTTGTGCTGGG - Intronic
1085086652 11:73672409-73672431 AACAGTGATGACCTTCAGCTAGG - Intergenic
1085123246 11:73980867-73980889 CACATTCCTGACCTTGAGCTGGG + Intronic
1086269175 11:85039544-85039566 AACATATATAACTATGAGATAGG - Intronic
1086829326 11:91540396-91540418 CAAATTCATGCCTTTGAGCTTGG + Intergenic
1087031187 11:93706160-93706182 AACATTTAAGACTATGCACTTGG - Intronic
1087164352 11:94985969-94985991 AATCTTTATGACATTGAGCTGGG + Intronic
1087231464 11:95670625-95670647 AATCTTTATGACTTTGGGTTTGG - Intergenic
1088881989 11:113979769-113979791 AGGAATTATGGCTTTGAGCTGGG + Intronic
1089789316 11:120931233-120931255 AGCAGTTATGTCTTTGACCTTGG + Intronic
1090198552 11:124838200-124838222 AACATATATGAATTTGTGTTGGG + Intergenic
1091861446 12:3788519-3788541 AAGCTTTATGACATTGATCTTGG - Intergenic
1092014547 12:5147487-5147509 AACCTTTGTGATCTTGAGCTGGG - Intergenic
1093387063 12:18570089-18570111 CACATTTATGACATTGAGGTAGG - Intronic
1093911797 12:24756520-24756542 AATAATTGTGACATTGAGCTGGG - Intergenic
1094016465 12:25870143-25870165 AATATTCATGACTTTGGGTTGGG + Intergenic
1094571381 12:31644307-31644329 AACATGTATGGCTCTGGGCTGGG - Intergenic
1095643494 12:44512975-44512997 AGCATTTATTACTTTGTGGTGGG - Intronic
1095692913 12:45110892-45110914 AACATTTAAGTCTGTGGGCTGGG + Intergenic
1097500020 12:60390107-60390129 AACCTTTTTGACTTTTTGCTTGG - Intergenic
1097849061 12:64393704-64393726 GACATTTATGAATTTGTGTTGGG - Intergenic
1097947185 12:65383197-65383219 AACATTTGTGAAATTGAGCACGG - Intronic
1098007276 12:66010950-66010972 AATATTTATGGCTTTTTGCTAGG - Intergenic
1098658391 12:73062221-73062243 AACCTTTATTACATTGAGCTTGG + Intergenic
1099703763 12:86123568-86123590 AACATTTATTACTGAGTGCTTGG + Intronic
1099918255 12:88923677-88923699 TGCCTTTTTGACTTTGAGCTTGG + Intergenic
1101333932 12:103779699-103779721 AACTTTTCTGACTTTGTGCATGG - Intronic
1102502457 12:113361704-113361726 AACATTTATGATTTGGTGCTTGG + Intronic
1103257979 12:119559378-119559400 AACATTGATCACTTTGTGTTTGG + Intergenic
1103508767 12:121459446-121459468 AATCTTTATGACTTTGAATTAGG + Intronic
1103846329 12:123904098-123904120 AACATTTGTGAATTTGAGCATGG + Intronic
1104062461 12:125280236-125280258 AACATTTATTTCTTTGTGTTGGG - Intronic
1104545503 12:129709057-129709079 AAAATATATCACTCTGAGCTTGG - Intronic
1104658881 12:130594595-130594617 AAAATTTATGAATTTGTGTTGGG + Intronic
1104765751 12:131328902-131328924 AAGCTTTGTGACTTTGAGTTAGG + Intergenic
1105394153 13:20012473-20012495 AAAATTTAAGACTTCCAGCTGGG - Intronic
1105823126 13:24097474-24097496 AGTATTTTTGCCTTTGAGCTAGG - Intronic
1105946690 13:25196398-25196420 AACTTTTCTGACTTGGGGCTTGG - Intergenic
1105954908 13:25272218-25272240 AACCTTTATGACTTTGACATAGG + Intronic
1106698022 13:32199182-32199204 AACAGATATGACCTTGACCTAGG + Intronic
1106699543 13:32214395-32214417 AAAATTTATGAATTTGTGTTGGG - Intronic
1108976679 13:56452972-56452994 AATATGCATGACTTTGAGCTTGG - Intergenic
1109452108 13:62530376-62530398 AATCTTTATGACTTTGGGTTGGG - Intergenic
1109815120 13:67571810-67571832 AGCATTTGTGAATTTTAGCTAGG + Intergenic
1110669959 13:78166164-78166186 TACCTTTATGACTTTTAGGTAGG - Intergenic
1110773697 13:79380612-79380634 AACATTTATTTCTTTGTGTTGGG + Intronic
1110787874 13:79554802-79554824 AACATTTTTGAGTGTGAACTGGG + Exonic
1111262396 13:85758565-85758587 AAAATTTAAGACTTTGAGCAAGG + Intergenic
1112153258 13:96787827-96787849 AACCTTCCTGACTTTGAGTTAGG - Intronic
1112211171 13:97379188-97379210 ACCATTTCTGATATTGAGCTTGG - Intronic
1113269073 13:108653458-108653480 GACATTTATGACATTGGACTTGG - Intronic
1113543647 13:111129278-111129300 AACATTTGTGACTTTGGACTAGG + Intronic
1113810114 13:113135810-113135832 AAAATTTATGACATGGAGCTAGG + Intronic
1114864786 14:26576416-26576438 TACATTTATGCCTGTCAGCTGGG - Intronic
1116451015 14:45065454-45065476 AAAATTTATGAATTTGTGTTAGG + Intronic
1116759442 14:48992949-48992971 AACCGTTAGGACATTGAGCTGGG - Intergenic
1117086045 14:52202365-52202387 AAGAATTATGACTTTCAGCTAGG + Intergenic
1117365221 14:55020574-55020596 AATATTTATTACTGTGAACTTGG - Intronic
1117480574 14:56140125-56140147 AACATGTATAATTTAGAGCTGGG + Intronic
1117504697 14:56390446-56390468 AAAATTTATGAATTTGTGTTGGG - Intergenic
1119450416 14:74704827-74704849 AATCTTTGTGACCTTGAGCTAGG - Intronic
1120294114 14:82617823-82617845 AATATATATGACTTAGAGTTAGG - Intergenic
1121855149 14:97261969-97261991 AACATTTATGACCTTGGATTAGG + Intergenic
1122002594 14:98673256-98673278 AATATTTGTGACCTTGAGTTAGG - Intergenic
1122373160 14:101240474-101240496 TACATTCAGGATTTTGAGCTGGG + Intergenic
1123969450 15:25493028-25493050 AATATTTATGACTTTAAGTTAGG + Intergenic
1125315259 15:38424783-38424805 AAAATTTATGAATTTGTGTTGGG + Intergenic
1126296405 15:47141630-47141652 AACATTTATTTCTTTGTGTTGGG - Intergenic
1126647265 15:50887466-50887488 AATCTTTATGACCTTGGGCTAGG - Intergenic
1126698603 15:51347366-51347388 AAAGTTTATGAATTTGAGTTGGG - Intronic
1126769995 15:52046488-52046510 AACATTCATGGTTTTGATCTGGG + Exonic
1127115320 15:55720832-55720854 AACATTTATGAATTTGTGTTGGG + Intronic
1129100876 15:73262182-73262204 AATCTTTATGACTTTGGGATAGG + Intronic
1129919114 15:79304083-79304105 AATATTTATGACCTTGAATTAGG - Intergenic
1130372636 15:83298782-83298804 AAAATTTATGAATTTGTGTTGGG + Intergenic
1131245485 15:90788319-90788341 AACATAAATGACAGTGAGCTGGG - Intronic
1131725539 15:95219173-95219195 AAGGTTTATGACTTTGATCTGGG - Intergenic
1132135360 15:99332396-99332418 AATATTTACGAATTTGTGCTAGG - Intronic
1134308756 16:13057219-13057241 AACGTTCATGGATTTGAGCTAGG + Intronic
1134824577 16:17274359-17274381 AAGATTTGTGACATTGAGCAGGG + Intronic
1135098671 16:19586719-19586741 AATCTTCATGACCTTGAGCTAGG - Intronic
1135463759 16:22667660-22667682 AACTCCTGTGACTTTGAGCTAGG - Intergenic
1137813729 16:51377966-51377988 AAAATGTTTTACTTTGAGCTGGG + Intergenic
1138489087 16:57365797-57365819 AACATTTATGTCCTTTACCTGGG - Exonic
1138808925 16:60126336-60126358 AACCTTTATGACCTTGGGTTAGG - Intergenic
1139944583 16:70631345-70631367 AACAGAAAGGACTTTGAGCTGGG - Intronic
1141263280 16:82473120-82473142 AGCATTTACTACTATGAGCTGGG - Intergenic
1141465215 16:84201179-84201201 AAATTTTATGACCTTGAGTTAGG + Intergenic
1142346372 16:89556694-89556716 ATCATTTATGAGGTTGAGATGGG + Intronic
1143523490 17:7459673-7459695 AAAATATATGTATTTGAGCTGGG - Exonic
1143642535 17:8207335-8207357 ACAATTGATGACTTTGAGATTGG - Exonic
1143897097 17:10144872-10144894 GTCTTTTATGTCTTTGAGCTAGG + Intronic
1145041054 17:19579044-19579066 TACATTTTTGACTTAGTGCTAGG + Intergenic
1147023834 17:37563489-37563511 AACATATAGGACTTTGGGGTTGG - Intronic
1148950953 17:51311922-51311944 AACATTTAAGTCAGTGAGCTGGG - Intergenic
1149332355 17:55597532-55597554 AACCTTCATGACTTTGAATTTGG - Intergenic
1151260541 17:72912585-72912607 ACCTTTAATGACCTTGAGCTTGG - Intronic
1151284871 17:73103198-73103220 AACATTTCTGATTTTGTGATAGG + Intergenic
1153898364 18:9590816-9590838 GATATTTATGACTTTGAGATTGG + Intronic
1153971078 18:10227908-10227930 TACATTTAAAACTTTGATCTTGG + Intergenic
1155180951 18:23345973-23345995 AATATATAAAACTTTGAGCTGGG + Intronic
1155684240 18:28528353-28528375 AACCTTTATGAATTTGTGTTGGG + Intergenic
1156424217 18:36991627-36991649 ACCATTCTTGAATTTGAGCTAGG + Intronic
1157220091 18:45823234-45823256 CAAATTTAGGAATTTGAGCTTGG + Intergenic
1157345809 18:46831871-46831893 AATATTTGTGACCTTGAGTTAGG + Intronic
1157636248 18:49157832-49157854 AACCTTCATGACTTTGGGTTAGG - Intronic
1157769088 18:50328847-50328869 AACATTTATGATTTTCAACAAGG - Intergenic
1157786256 18:50485672-50485694 AAAATTTATGAATTTGTGTTGGG - Intergenic
1158030522 18:52958934-52958956 AACGTTTATAAATTTGTGCTGGG - Intronic
1158108644 18:53914726-53914748 AACCTTTATGACATTGGTCTAGG - Intergenic
1159515732 18:69455211-69455233 CACATTAATGAATTTCAGCTTGG - Intronic
1160495246 18:79369765-79369787 TACACATATGACTTTGAGGTTGG + Intronic
1165056429 19:33179161-33179183 AATCTTTATGACCTTGAACTTGG - Intronic
1165889719 19:39103819-39103841 AACATTTTTGTTTTTGAGATGGG - Intronic
1167570426 19:50284308-50284330 AACCTTTGTGACCTTGAGTTAGG - Intronic
924968721 2:102781-102803 AATATTTATTTCTTTGTGCTTGG + Intergenic
925111042 2:1337777-1337799 AACACTTATGACATTGGGTTTGG - Intronic
925790862 2:7486793-7486815 AATATTTGTGACTTTGAGTAAGG + Intergenic
926164337 2:10510001-10510023 AATCTTTATGACCTTGAGTTAGG + Intergenic
926469834 2:13240358-13240380 AACATTTATGAATTCCAACTAGG - Intergenic
926550861 2:14299338-14299360 AACATTTATTCCATTGAGTTTGG - Intergenic
926596509 2:14795899-14795921 AATATTTATGACTTCGAGTTAGG - Intergenic
926623105 2:15066285-15066307 AACCTTCATGACATTGATCTCGG + Intergenic
926989680 2:18664525-18664547 ATCATTTATGACCTTGAGAAGGG + Intergenic
927039543 2:19214417-19214439 AACATTTATTTCTTTGGCCTTGG - Intergenic
928050012 2:27982415-27982437 AATCTTTATAACTTTGGGCTAGG - Intronic
928365650 2:30698810-30698832 AATCTTTGTGACTTTGGGCTAGG - Intergenic
929181228 2:39041813-39041835 CATATTTATGACTTTGACATAGG - Intronic
931314305 2:61112903-61112925 AATCTTTGTGACTTTGAGGTAGG - Intronic
932618868 2:73254156-73254178 ATCATTTCTGACTCTCAGCTAGG - Intergenic
935176492 2:100653774-100653796 AACATTTCAGTCTGTGAGCTGGG + Intergenic
935402587 2:102675689-102675711 AATTTTTATGACTTGGATCTAGG - Intronic
936247877 2:110844347-110844369 AACATTTGTAAATTTGTGCTGGG + Intronic
936716023 2:115188641-115188663 ACCATTTATCACCTTGAGATTGG + Intronic
937454195 2:122027233-122027255 AAAATTTATGAATTTGTGTTGGG + Intergenic
939379213 2:141413237-141413259 AAGATTAAGGACTTTGAGATGGG + Intronic
940015986 2:149104781-149104803 AATCTTTATGACTTTGGGTTAGG - Intronic
942496156 2:176541818-176541840 AACATTTAAGAATTTAACCTGGG + Intergenic
942549319 2:177098105-177098127 AAAGTTTATGAATTTGTGCTGGG + Intergenic
942933043 2:181519348-181519370 AATATTTATTTCCTTGAGCTAGG + Intronic
943380741 2:187143299-187143321 CAAATTAATGAGTTTGAGCTTGG - Intergenic
943487482 2:188504177-188504199 AACATTAATAACATAGAGCTAGG + Intronic
943939297 2:193970545-193970567 AAAATTTATGAATTTGTGTTGGG + Intergenic
943949648 2:194116154-194116176 CACATATATGATTTTGAGATAGG + Intergenic
944052262 2:195483739-195483761 CTAATTTATGATTTTGAGCTTGG + Intergenic
944180945 2:196893334-196893356 AACATTTATTACTCTGAGCCAGG + Intronic
944424405 2:199564422-199564444 AATTTTTATGACTTTGAATTAGG - Intergenic
944530563 2:200664034-200664056 AACAGTGATCACTTTGAGCATGG + Intronic
944753016 2:202730818-202730840 AACATTTGTGACATTGCGTTAGG + Intronic
945738421 2:213630505-213630527 AACATTTATCAGTGTGGGCTGGG + Intronic
946647936 2:221859290-221859312 AATGTTTATGACTTTGAGTTTGG - Intergenic
947407774 2:229798630-229798652 AACGTATAAGACTTTCAGCTAGG + Intronic
948005962 2:234607685-234607707 AACATTTATTTATGTGAGCTAGG + Intergenic
948928951 2:241118607-241118629 AATCTTTATGACCTTGGGCTTGG + Intronic
1170393085 20:15896131-15896153 AACATTGATAACTCTAAGCTGGG - Intronic
1171408379 20:24929100-24929122 TACATTGATGACTTTCTGCTGGG + Intergenic
1172172866 20:32952325-32952347 AACATTTGTGACCTTGGGTTAGG - Intronic
1177590745 21:23163266-23163288 ATCATTCATGCATTTGAGCTAGG - Intergenic
1177705042 21:24692213-24692235 AACATTTATTTCTTTAAGGTTGG - Intergenic
1178078931 21:29042304-29042326 AACATTGAGGACTTTGGGTTGGG - Intronic
1178586811 21:33877536-33877558 AACATTTCTGTTTTTGACCTTGG - Intronic
1179082496 21:38184933-38184955 AATATTTGTGATTTTGAGTTAGG + Intronic
1179136583 21:38684989-38685011 AACCTTAATGACTTTTGGCTGGG + Intergenic
1179319735 21:40278808-40278830 AACATTTATCACTATATGCTAGG - Intronic
1181718422 22:24753218-24753240 AATCTTTTTGACTTTGAGCTAGG - Intronic
1182154570 22:28057667-28057689 AATATTTCTGACTTAGAGGTAGG - Intronic
1184848935 22:47107932-47107954 AACCTTTATGCCCTTGAGTTAGG + Intronic
1185274831 22:49945919-49945941 CACATTTATGACTTCCAGGTGGG - Intergenic
949395467 3:3610199-3610221 TATATTTATGACTTTGGGCTTGG - Intergenic
949452327 3:4200046-4200068 AAAATTTGTGACCTTGGGCTAGG - Intronic
949644727 3:6079565-6079587 AAAATCTGTGACTTTGGGCTAGG - Intergenic
950962448 3:17120135-17120157 CATGTTTATGACTTTGATCTGGG - Intergenic
951144654 3:19213053-19213075 TATATTGATGGCTTTGAGCTTGG + Intronic
951223294 3:20092523-20092545 AACATTAATAAATCTGAGCTGGG - Intronic
951635892 3:24776291-24776313 AATGATTATGACATTGAGCTAGG - Intergenic
951774834 3:26298312-26298334 AACATTTATTTCTTTGGGATAGG - Intergenic
952915357 3:38234168-38234190 AACCTTTGGGAATTTGAGCTAGG + Intronic
954113415 3:48449116-48449138 ATCATTTATGAGTTTCAGCCGGG + Intronic
954219965 3:49147297-49147319 AAAATTTATGTCTCTGAGCCAGG + Intergenic
955131967 3:56179102-56179124 AAAATTTATGAATTTGTGTTGGG + Intronic
955489141 3:59465040-59465062 AATATTTATGAATTTGTGTTGGG - Intergenic
955563071 3:60213894-60213916 TCCATTTATGACTTAGAGATAGG - Intronic
955667135 3:61362403-61362425 AATCTTCATGACCTTGAGCTAGG + Intergenic
955880210 3:63535852-63535874 AATTTTTATGACCTTGGGCTAGG + Intronic
956154991 3:66286266-66286288 AACCTTAATGACTTAGAGTTAGG - Intronic
956161679 3:66361317-66361339 AATCTTTGTGACTTTGAGTTAGG + Intronic
956352763 3:68355958-68355980 AATATTTATTTCTTTTAGCTAGG - Intronic
956829992 3:73037354-73037376 AAATTTTGTGACTTTGATCTTGG + Intronic
957766784 3:84635382-84635404 AAAGTTTATGAATTTGTGCTTGG - Intergenic
959726856 3:109552979-109553001 AACATTTATGTCTAAGTGCTGGG - Intergenic
960544102 3:118892182-118892204 AAGCTTTATGACCTTGAGCAAGG + Intergenic
960867907 3:122220676-122220698 AATATTAAGGACTTTGTGCTGGG + Intronic
960901017 3:122554578-122554600 AGCATTTATATCTTAGAGCTGGG - Intronic
963287914 3:143454400-143454422 AGTATTTATGACTTTGAATTAGG - Intronic
963361804 3:144283101-144283123 AATATATATGACTCTGAGTTAGG + Intergenic
963780893 3:149485366-149485388 AACATTCATGACTTTAACCTAGG - Intronic
963840543 3:150100883-150100905 AATATTCATGACATTGAACTTGG - Intergenic
965984127 3:174731128-174731150 AACATTTATGACTTTGAGCTGGG + Intronic
966084423 3:176051422-176051444 AAACTTTATGACTTTGAATTTGG - Intergenic
966855640 3:184192261-184192283 AACATTTATCACTTTATGTTGGG + Intronic
967627000 3:191698588-191698610 AAACTTTATGACTTTGGGCTTGG - Intergenic
967809224 3:193742644-193742666 AAAAATTTTGACTGTGAGCTGGG + Intergenic
967903059 3:194476918-194476940 ATCAGTTTTGACTTTGACCTTGG - Intronic
969915220 4:10484140-10484162 AATTTTTAAGACTTTGAGATAGG - Intergenic
970786900 4:19808795-19808817 CCCATTTATGACTTTGGGATAGG - Intergenic
971712183 4:30128744-30128766 AGCATTTATCACTCTGAGATGGG + Intergenic
972108745 4:35527565-35527587 AACATTTTTGACTTTCCTCTTGG - Intergenic
972822690 4:42719930-42719952 AATATTTATAAATTTCAGCTAGG + Intergenic
973665513 4:53154872-53154894 AACATTTATGGCTTTGAAGATGG + Intronic
974025484 4:56729741-56729763 AAAATTTAAGAATTTTAGCTGGG + Intergenic
974961098 4:68701668-68701690 AAGTTTTATGACATTGGGCTGGG - Intergenic
978007918 4:103640696-103640718 AAAATTTATGAATTTGTGTTGGG - Intronic
978520582 4:109611076-109611098 AACTTTTATTCCTTTGAGATAGG + Intronic
979190825 4:117856254-117856276 AAAATTCATGACTTTGGGTTAGG + Intergenic
979355748 4:119702298-119702320 AATATTTATGACCTTGGACTAGG + Intergenic
979488471 4:121296273-121296295 AACCTTTTTGACATTGATCTGGG + Intergenic
979551206 4:121992995-121993017 AACCTTAATTACTTTGAGCCTGG - Intergenic
979657908 4:123218533-123218555 AACATTTATGAGTCTGGGATTGG - Intronic
979782108 4:124665198-124665220 AACATAAATGACTTTGAGTTAGG - Exonic
980402208 4:132305862-132305884 AACCTTTATGACTTTCTTCTTGG - Intergenic
980451480 4:132978724-132978746 AATATTTGTGACTTTAAGTTAGG - Intergenic
980652917 4:135744141-135744163 AATATTTGTAACCTTGAGCTGGG + Intergenic
980890991 4:138815426-138815448 TACTTTTATCACTTTGAGATTGG - Intergenic
981770830 4:148305698-148305720 AAAGATTATGACTTAGAGCTAGG + Intronic
983095812 4:163560145-163560167 AACCTTTATGACTTTGGGTGAGG - Intronic
983095863 4:163561269-163561291 AATTTGTATGACTTTGAGATGGG - Intronic
983341987 4:166472772-166472794 AACCTTTGTGACATTGAGTTAGG + Intergenic
983417593 4:167479017-167479039 AACAATTTTGAATTTGAGATAGG + Intergenic
983436908 4:167727320-167727342 AATATTTATGACTGTTAGTTTGG - Intergenic
983772827 4:171571900-171571922 AACATTTATCACTGTAACCTGGG + Intergenic
985036076 4:185841181-185841203 AGCATTGATGACTCTAAGCTGGG + Intronic
985179621 4:187243346-187243368 AACACTTATTTCTTTGTGCTGGG + Intergenic
986207642 5:5640463-5640485 GACATCTCTGACTTTGAGGTTGG + Intergenic
986765292 5:10920385-10920407 AAAATTTGTGAAGTTGAGCTGGG - Intergenic
987445104 5:18007219-18007241 ATCATTTATGCATTGGAGCTGGG - Intergenic
987770945 5:22304427-22304449 TACATGTATGACTTTGAAGTTGG - Intronic
989702863 5:44291309-44291331 AACATTTACAACTTTAAGTTGGG + Intergenic
990379594 5:55209255-55209277 AATATTTATGACTTTGAGTGAGG + Intergenic
990588411 5:57235890-57235912 AACATGTATGATTCTGAGATTGG + Intronic
991634548 5:68691413-68691435 TATCTTTATGACTTTGAGGTAGG - Intergenic
992182206 5:74209223-74209245 AATCTCTATGACTTTGAGTTAGG + Intergenic
992913734 5:81425795-81425817 AAGGTTTATGACTTTGGGCTGGG + Intronic
992959592 5:81945635-81945657 AATCTTTGTGACTTTGAGTTAGG - Intergenic
993522253 5:88917131-88917153 GATATTCATGACTTTGTGCTTGG + Intergenic
994108420 5:95972782-95972804 AATATTTGTGACCTTGAGCTAGG - Intergenic
994475215 5:100259694-100259716 AAGATTTATGACATTGAATTTGG - Intergenic
995191632 5:109324301-109324323 AAAATTTATGAATTTGTGTTGGG - Intergenic
995349232 5:111156042-111156064 AACATCTATTATCTTGAGCTTGG - Intergenic
996663846 5:126035085-126035107 AAAATTTATGTCACTGAGCTTGG + Intergenic
997306414 5:132840264-132840286 AATGTTTATGACTTTGAACCAGG - Intergenic
997803542 5:136890645-136890667 CACTTTTATGACTATGAGCCAGG + Intergenic
999646467 5:153722391-153722413 TATCTTTATGACTTTGAGGTAGG - Intronic
999769861 5:154767226-154767248 ATCATTGATGAATGTGAGCTAGG + Intronic
1000001913 5:157147177-157147199 AAAATCTTTGACTTTGAGTTAGG - Intronic
1000644274 5:163741830-163741852 AAAACTTATCACTTTGAACTGGG + Intergenic
1000954283 5:167523936-167523958 CACATTTACGACTTTGAATTTGG - Intronic
1001909190 5:175501035-175501057 AATCTTTATGACTTTGATATGGG + Intronic
1002151263 5:177233362-177233384 AAAATTTATGCCTTGGGGCTGGG - Intronic
1003706817 6:8541418-8541440 AATATTTGTGACTTTGTGTTAGG + Intergenic
1004710950 6:18169708-18169730 AACCTTTATGACCTTGAATTTGG - Intronic
1005123083 6:22412731-22412753 AAAATTTATGAATTTGTGTTGGG - Intergenic
1005435755 6:25810179-25810201 AAGCTCTATGACTTTGACCTGGG + Intronic
1006556710 6:34873195-34873217 AAAATTTCTGACGCTGAGCTAGG + Exonic
1006955375 6:37865613-37865635 AACATCTGTGACTTTGGGTTGGG + Intronic
1007337686 6:41165859-41165881 AATATTTGTGACTCTGAGATGGG - Intergenic
1008012082 6:46478867-46478889 AAGATTTGTGAATTTGGGCTAGG - Intronic
1009307592 6:62109946-62109968 AACTTTCATGACTTTGGGTTAGG + Intronic
1009308020 6:62116586-62116608 AATATTTATGTCTTTGTGTTGGG + Intronic
1009424839 6:63502654-63502676 AACATTGATGACTTTTATGTGGG - Intergenic
1010143630 6:72640222-72640244 AACATGTGTGACCTTGACCTTGG + Intronic
1010239899 6:73605680-73605702 AATAATTTTGACTTTGGGCTGGG + Intronic
1010734066 6:79422900-79422922 AACATTTAAGAATTTGCTCTGGG - Intergenic
1011045352 6:83075908-83075930 AAGCTTTATGACATTGAGTTTGG + Intronic
1011638303 6:89396056-89396078 AATATTTATGACTTTGCGTTAGG + Intronic
1011854228 6:91668872-91668894 AACCTTTAGGACATTGTGCTAGG + Intergenic
1012403477 6:98866130-98866152 TACATTGATAGCTTTGAGCTAGG - Intergenic
1012843101 6:104355469-104355491 AAGTTTTATGCCTTTGAGTTTGG + Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1013899971 6:115143395-115143417 AACATTTATAATTTTGAGGGTGG - Intergenic
1014517953 6:122401997-122402019 AAACTTTATGAATTTGTGCTGGG - Intronic
1014649093 6:124013372-124013394 AACCTTTGTGACTTTGGGCTCGG - Intronic
1016418946 6:143864216-143864238 AATATTTCTGATTTTGAACTAGG - Intergenic
1018565718 6:165150000-165150022 AAGATTAATGACATTTAGCTAGG - Intergenic
1020966466 7:14876017-14876039 TACATTTCTGCCTTTGAGGTAGG + Intronic
1021074998 7:16292094-16292116 GACATGTATGACTTTGATTTTGG - Intronic
1022425429 7:30264418-30264440 AACATTGAAGACATTGTGCTTGG - Intergenic
1023106125 7:36764758-36764780 AATTTTTATAAATTTGAGCTTGG - Intergenic
1023196844 7:37650061-37650083 AAAATTTTTTCCTTTGAGCTGGG - Intergenic
1023897910 7:44449791-44449813 AATCTTTGTGACTTTGAGTTAGG + Intronic
1024100742 7:46030286-46030308 AATATTTCTGACTTTGTGGTAGG + Intergenic
1025792642 7:64704537-64704559 AAAATATATGACTTTCAGCCAGG - Intronic
1025939435 7:66063598-66063620 AATCTTTATGACCTTGGGCTAGG + Intergenic
1026093583 7:67322195-67322217 GATATTCATGACTTTGTGCTTGG - Intergenic
1026858923 7:73772275-73772297 AACTTTTATTTCTTTGTGCTGGG + Intergenic
1026887168 7:73957607-73957629 AATCTTTATGACCTTGAGTTAGG - Intergenic
1027684227 7:81262099-81262121 AACCTTGATGACTTTGAGTATGG - Intergenic
1027764475 7:82322317-82322339 AAGATTTATGATTTTGGGCCGGG + Intronic
1028034242 7:85959559-85959581 AACTTTCATGACATTGAGGTGGG - Intergenic
1029021441 7:97368980-97369002 AATATTTATGACTGTGTGTTGGG - Intergenic
1030832451 7:114242402-114242424 AACTTTTATGATTTGGAGATGGG - Intronic
1031222526 7:118988331-118988353 AATATTTATGACTTAGAGTTAGG - Intergenic
1032116942 7:129125583-129125605 AAAATTTTTGAATTTGAGCTGGG - Intergenic
1032555755 7:132833040-132833062 AGTATTTATTACTTTGTGCTAGG + Intronic
1033160127 7:138988574-138988596 AATATTTGTGACCTCGAGCTAGG - Intergenic
1033262086 7:139852713-139852735 ACCAATTTTGCCTTTGAGCTTGG - Intronic
1033826432 7:145195992-145196014 AACCTTTTTGACCTTGAGTTAGG - Intergenic
1034180783 7:149136064-149136086 AATATTTATGACCTTGAATTAGG - Intronic
1034252499 7:149703541-149703563 AACATGGATGACTTTGACTTTGG + Intergenic
1034853745 7:154520972-154520994 AAAATTTAAGACTTTGAAATGGG - Intronic
1036409200 8:8482936-8482958 GAGTTTTATGAGTTTGAGCTAGG - Intergenic
1037508753 8:19560309-19560331 TATATTCATGACCTTGAGCTAGG + Intronic
1037648532 8:20815824-20815846 AACATTTGTTGCTTTAAGCTAGG + Intergenic
1038413096 8:27373519-27373541 GACATTTAAAACTTAGAGCTGGG + Intronic
1040393720 8:46974568-46974590 AACATTCATGGTTTTGATCTGGG - Intergenic
1041010427 8:53537087-53537109 AACATTCATGGTTTTGATCTGGG + Intergenic
1041386201 8:57306178-57306200 AACATTTATGACCTTTCTCTGGG - Intergenic
1041516588 8:58706241-58706263 AACTTTCATGACCTTGAGTTTGG - Intergenic
1041580525 8:59454423-59454445 AATCTTTATGACTTTTAGCTAGG - Intergenic
1041612290 8:59865154-59865176 CACATTTATTATTTTGAACTAGG + Intergenic
1041807463 8:61868230-61868252 AACCTTTATGTATTTGAACTTGG + Intergenic
1042729043 8:71910911-71910933 AAAGTTTATGAATTTGTGCTGGG - Intronic
1043323483 8:79020288-79020310 AACCTTTATGACCTTAAGTTAGG + Intergenic
1043612039 8:82076749-82076771 AATATTCATGACTTTGAATTAGG - Intergenic
1044025536 8:87166830-87166852 AACAATTATGAGTTTGTGGTGGG - Intronic
1044346333 8:91108680-91108702 AACATTTATGAATTTGAGTTGGG - Intronic
1044445386 8:92269469-92269491 AAAATTTATGAATTTGTGTTGGG - Intergenic
1044872705 8:96635452-96635474 AACCTTCATGACATTGGGCTTGG - Intergenic
1045425145 8:102058792-102058814 AAGATAAATGACTTTGAGATGGG + Intronic
1045880634 8:107034663-107034685 AAGCTCCATGACTTTGAGCTGGG + Intergenic
1045888364 8:107126146-107126168 AACATTGATGACTTTTTGCAAGG + Intergenic
1045999335 8:108400635-108400657 AACATTTATTTCTTTGTGTTGGG + Intronic
1047010340 8:120665645-120665667 AACATTTTTGAATTTGAGTTTGG - Intronic
1048794703 8:138138942-138138964 TGCAGTTATGAGTTTGAGCTTGG - Intronic
1052319140 9:27149053-27149075 AACCTTTATTACTATGGGCTGGG - Intronic
1054896883 9:70323542-70323564 AACATTTATTTCTTTGATTTTGG - Exonic
1055313358 9:75008215-75008237 AAAGTTTATGAATTTGTGCTGGG + Intronic
1055351368 9:75392440-75392462 AAAATTTATGAATTTGTGTTGGG + Intergenic
1055530742 9:77180517-77180539 AACATCTTTGACTTTGGGTTGGG - Intronic
1055888073 9:81089079-81089101 AAAATTATTGACTTTGAACTAGG + Intergenic
1056237547 9:84610331-84610353 GACATTTAAGCCTTTCAGCTAGG - Intergenic
1056878520 9:90364048-90364070 AACATTTTAGACTTTGAGCGAGG + Intergenic
1057103080 9:92382585-92382607 AACCTTTATGACATTGAATTTGG - Intronic
1058459595 9:105170645-105170667 AAGATTTATAAGTTGGAGCTGGG + Intergenic
1058469862 9:105266381-105266403 AATATTTGTGACCTTGAACTAGG - Intronic
1058479981 9:105382148-105382170 TACTTTTATGACCTTGACCTTGG + Intronic
1059391161 9:114000438-114000460 AAAATTTATGACTTTGTGTTGGG - Intronic
1061029739 9:128073700-128073722 GATAATTATGACTTTGAGCCAGG - Intronic
1187013485 X:15303383-15303405 AAAATTTATGAATTTGTGTTGGG + Intronic
1187049039 X:15677972-15677994 AACGTATATGAGTTTGAGATGGG - Intergenic
1187560720 X:20400624-20400646 AAAATGAATGCCTTTGAGCTAGG - Intergenic
1188203835 X:27326805-27326827 AACATTCAGGACATTGGGCTAGG + Intergenic
1188218074 X:27503372-27503394 AAAATTTATGACCTAGAGTTAGG - Intergenic
1188410930 X:29871242-29871264 AACATTATAGACTTTGAGATGGG - Intronic
1188593774 X:31871618-31871640 TACATTTAGGATTTGGAGCTAGG + Intronic
1188872573 X:35391227-35391249 CACACTTATGAGTTTAAGCTTGG - Intergenic
1190900141 X:54664121-54664143 AATCTTCATGACTTTGAACTAGG - Intergenic
1191664506 X:63685864-63685886 AACCGTTATGATTTTGAGATAGG + Intronic
1193670676 X:84381770-84381792 AACCTTTAGGACATTGGGCTGGG + Intronic
1195309097 X:103613178-103613200 AATATTCATGACCTTGAGTTAGG + Intronic
1195670880 X:107468960-107468982 AACATTGATGATTTTCAGGTGGG + Intergenic
1195929449 X:110059685-110059707 AAAATTTATGAATTTGTGTTGGG - Intronic
1196322483 X:114357854-114357876 AATATTTATGACTTTGGGTTAGG + Intergenic
1196924188 X:120616124-120616146 AATATTTATGACATTTTGCTTGG - Intronic
1197370943 X:125625530-125625552 ATCAGTAATGAATTTGAGCTAGG + Intergenic
1198082120 X:133250111-133250133 AAAGTTTATGAATTTGTGCTGGG - Intergenic
1199049657 X:143222077-143222099 AACATATATGACTTTGGGGTAGG + Intergenic
1199337412 X:146635422-146635444 AACCTTTATGACCTTGAGTTAGG + Intergenic
1201497439 Y:14603696-14603718 GATATATATGACTTTGAGTTTGG + Intronic