ID: 965984206

View in Genome Browser
Species Human (GRCh38)
Location 3:174732034-174732056
Sequence AACAGGCATCCGGCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965984203_965984206 -1 Left 965984203 3:174732012-174732034 CCAATGAAATTTTACTTATAAAA 0: 1
1: 2
2: 53
3: 511
4: 2496
Right 965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG 0: 1
1: 0
2: 7
3: 66
4: 292
965984202_965984206 0 Left 965984202 3:174732011-174732033 CCCAATGAAATTTTACTTATAAA 0: 1
1: 0
2: 14
3: 136
4: 970
Right 965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG 0: 1
1: 0
2: 7
3: 66
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965984206 Original CRISPR AACAGGCATCCGGCCAAATT TGG Intronic
900568677 1:3347765-3347787 AGCAGGCATCAGGCCAGATCTGG - Intronic
901176963 1:7310485-7310507 AACAGGCAGTGAGCCAAATTTGG + Intronic
902190687 1:14760995-14761017 GACAGGCAGCGGGCCAGATTTGG + Intronic
902559134 1:17266147-17266169 AACAGGCAGTAGGCCAGATTTGG + Intronic
903727643 1:25462888-25462910 AACAGGCAGTGGGCCAGATTTGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
907967899 1:59350976-59350998 AACAGGCAGTAGGCCAGATTTGG - Intronic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
908741640 1:67334841-67334863 AACAGGCAGAGGGCCAGATTTGG + Intronic
909986526 1:82167428-82167450 AACAGGTAGTGGGCCAAATTTGG - Intergenic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
913008922 1:114663621-114663643 AACAGGCAGTGGGCCAAATTTGG - Intronic
914736368 1:150421071-150421093 AATAGGCAGCAGGCCAGATTTGG + Intronic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
916083002 1:161247901-161247923 CACAGGCAGCAGGCCAGATTGGG - Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
917648423 1:177051343-177051365 AACAGGCAGTGGGCCACATTTGG - Intronic
918198705 1:182246953-182246975 AACAGGCAGTGGGCCAGATTTGG + Intergenic
919147742 1:193656203-193656225 CACAGACATCCTCCCAAATTAGG - Intergenic
920997008 1:211002982-211003004 AACAGGCCACTGGCAAAATTTGG - Intronic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
921871623 1:220146604-220146626 TACAGGCATCAGTTCAAATTTGG + Intronic
922251341 1:223851388-223851410 AACAGGCAGAAGGCCAAATTTGG - Intergenic
923562528 1:235052110-235052132 AACAGGCCACTGGCCAGATTTGG + Intergenic
924662872 1:246038055-246038077 AACAGGCAGCAGGCCAGATATGG + Intronic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1063025252 10:2171952-2171974 AACAGCCATTCAGCAAAATTAGG - Intergenic
1063890095 10:10620145-10620167 AACAGGTAGTGGGCCAAATTCGG - Intergenic
1064199471 10:13272391-13272413 AACAGGCATCCCGCCAGATGTGG - Intergenic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1064797907 10:19034591-19034613 AACAGGACACAGGCCAAATTTGG + Intergenic
1068581675 10:58747834-58747856 CACAGGCAGCTGGCCAGATTTGG - Intronic
1069337848 10:67374289-67374311 AACAGGTAGCCAGCCAGATTTGG + Intronic
1070431971 10:76349351-76349373 AACAGGCAGTGGGCCAGATTTGG + Intronic
1071021655 10:81064348-81064370 AACAGGCCACCAGCCATATTTGG - Intergenic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072865733 10:99059147-99059169 AACAGGAAGCAGGCCAGATTTGG + Intronic
1072952138 10:99857181-99857203 AACAGGTAGCAGGGCAAATTTGG - Intergenic
1073993766 10:109293080-109293102 AACAGGCAGTGGACCAAATTTGG - Intergenic
1074538456 10:114345607-114345629 ATCAGGGATGTGGCCAAATTGGG - Intronic
1075038109 10:119086248-119086270 AACAGGCAGTAGACCAAATTTGG + Intergenic
1075358575 10:121807743-121807765 AACAAGCAGCAGACCAAATTTGG - Intronic
1075448173 10:122528251-122528273 AACAGGCTTGCTGCCAAAGTGGG - Intergenic
1075913084 10:126142639-126142661 AACAGGCCCCCCGCCAAATCTGG - Intronic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1076714257 10:132355319-132355341 AACAGGCATCTGGCCAAGGCGGG - Intronic
1077952200 11:6972338-6972360 AACAGGTGACAGGCCAAATTTGG + Intronic
1080871929 11:36243880-36243902 AGCTGGCATCCAGCTAAATTTGG - Intergenic
1081066977 11:38555085-38555107 AACAGGCTTGTGGCCAATTTTGG + Intergenic
1082196671 11:49315086-49315108 AAAAGGCATCTGGCTACATTTGG - Intergenic
1084682526 11:70674844-70674866 AACAGGCAATGGGCCAGATTTGG + Intronic
1086659155 11:89393119-89393141 AAAAGGCATCTGGCTACATTTGG + Intronic
1087949183 11:104199201-104199223 AACAGGCACTGGGCCAAATTTGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093316114 12:17652170-17652192 ATTAAGCATCAGGCCAAATTTGG - Intergenic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1095254447 12:40018128-40018150 AACAGAAAGCCGGCCAGATTTGG - Intronic
1095549900 12:43423303-43423325 AATAGGCAACAGGCCAGATTTGG + Intronic
1095632341 12:44392937-44392959 AACAAACATCAGGGCAAATTTGG + Intergenic
1096371865 12:51075670-51075692 AACAGGCATTGGGCCAGATTTGG + Intronic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1098276073 12:68812582-68812604 AACAGGTAACAGGCCAAAGTTGG - Intronic
1098377346 12:69831216-69831238 AACAGGCTGCAGGCCAGATTTGG - Intronic
1099126436 12:78764005-78764027 AATAGGCAGTGGGCCAAATTTGG + Intergenic
1099517875 12:83621307-83621329 AACAGGCAGTGGTCCAAATTTGG + Intergenic
1100392706 12:94158015-94158037 AACAGGCAACAAGCCAGATTTGG + Intronic
1101014839 12:100489593-100489615 AACAGGCAGCCGACCGGATTTGG + Intronic
1101039560 12:100740682-100740704 AACAGGTAGCCAGCCAGATTTGG - Intronic
1101208013 12:102508208-102508230 AACAGGCAATGGGCCAGATTTGG - Intergenic
1101814541 12:108135797-108135819 AACAGGCAGTGGGCCAGATTTGG - Intronic
1101844394 12:108350853-108350875 AACAGGCAGTGGGCCAAATCTGG - Intergenic
1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG + Intronic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1102862340 12:116346989-116347011 AACAGGCCTCTGGCAGAATTTGG - Intergenic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103048510 12:117759250-117759272 AACAGGTACCTGGCCCAATTTGG - Intronic
1105661616 13:22502119-22502141 TACAGGCATCAGGCCAGATTTGG + Intergenic
1107125251 13:36839459-36839481 AACATGCCTTTGGCCAAATTAGG + Intergenic
1110403420 13:75120956-75120978 AACAGGCAGGGGGCCAGATTTGG + Intergenic
1110605747 13:77430117-77430139 AATAGGCATCCGACCAGATTTGG - Intergenic
1111436662 13:88219776-88219798 AACAGGCACCAGCCCAAATTGGG + Intergenic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1115523423 14:34255593-34255615 AACAGGCCACAGGCCCAATTTGG + Intronic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1121206742 14:92175401-92175423 AAAAGGGATCCTGACAAATTTGG + Intergenic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1121615897 14:95313458-95313480 AAGAGGCAGCAGGCCAGATTTGG + Intronic
1121659139 14:95621727-95621749 AACAGGCAGACAGCTAAATTTGG + Intergenic
1121950826 14:98169841-98169863 AAGAGGCATCAGTGCAAATTAGG + Intergenic
1122621712 14:103061678-103061700 AACAAGCAGCAGGCTAAATTTGG + Intergenic
1125826357 15:42679801-42679823 AACAGGCAGCAGACCAGATTTGG + Intronic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1125894539 15:43291603-43291625 AACAGGCAGTAGGCCACATTTGG + Intronic
1126614499 15:50563122-50563144 AACAGGCAACAGACCAGATTTGG - Intronic
1126651926 15:50931807-50931829 ACCAGGCATTTGGCCAGATTAGG + Intronic
1126748785 15:51854318-51854340 GACAGGCAGCAGGCCGAATTTGG + Intronic
1126934793 15:53694902-53694924 AACAGGCAGCAGGCCTGATTTGG - Intronic
1128190705 15:65692926-65692948 AACAGGCCTCAGGCTAGATTTGG - Intronic
1128190906 15:65695480-65695502 AATAGGCTTCAGGGCAAATTTGG + Intronic
1129557514 15:76528174-76528196 AACAGGCAGTGGGCCAGATTTGG + Intronic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1133418138 16:5622614-5622636 CACAGGCATCGGGCCGGATTTGG - Intergenic
1134303923 16:13015140-13015162 AACAGGCGGCAGGCCAGATTTGG - Intronic
1134649517 16:15897563-15897585 AACAGGCAGGCGGCCAGATGCGG - Intergenic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1134694574 16:16214008-16214030 AACAGGCAGTGGGCCAGATTTGG - Intronic
1134977261 16:18580629-18580651 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1135720010 16:24808374-24808396 AGCAGGCAGTGGGCCAAATTTGG - Intronic
1139048325 16:63090848-63090870 AACAGGCAGTAGACCAAATTTGG - Intergenic
1139780463 16:69347275-69347297 AACAGGCAATGGGCCAGATTTGG + Intronic
1140761549 16:78113475-78113497 AACAGGCAGTGGGCCAGATTTGG + Intronic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1141885162 16:86886693-86886715 AACAGGCAGCAGGCAAGATTTGG - Intergenic
1143823039 17:9580146-9580168 AACAGGCAGTGGGCCAGATTTGG - Intronic
1146113531 17:30113389-30113411 ACCAGGCAGCTGGCCAGATTTGG - Intergenic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1146631160 17:34470435-34470457 AGCAGGCATCTGGTCAGATTTGG + Intergenic
1148978798 17:51553114-51553136 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1148983072 17:51596038-51596060 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1149030282 17:52074808-52074830 AACAGGCAATGGGCCATATTTGG - Intronic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150056931 17:62025703-62025725 AACAGGCAGTGGGCCAAATATGG + Intronic
1150192746 17:63260425-63260447 AACAGGTAGCAGGCCATATTTGG + Intronic
1151142096 17:72003432-72003454 AACAGGCTGCGGGCCTAATTTGG + Intergenic
1152507561 17:80760624-80760646 AACAGGCAGTTGGCCAGATTTGG + Intronic
1153141305 18:1975461-1975483 AAGAGGCAACAGGCCATATTTGG + Intergenic
1155690930 18:28621348-28621370 TACAGGCGCCCGGCCAAAATTGG + Intergenic
1156753467 18:40490740-40490762 AACTGACAGCCGGCCAGATTTGG + Intergenic
1156877066 18:42027591-42027613 AACAGGCAACAGGCTGAATTTGG - Intronic
1157018631 18:43751084-43751106 AACAAGCAACAGGCCAGATTTGG + Intergenic
1157268902 18:46254470-46254492 AACAGGCAGCAGGCCAGAATTGG - Intronic
1157534088 18:48445829-48445851 AACAGGCAACGGACCAGATTTGG + Intergenic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1157938348 18:51897867-51897889 AACAGGCAACTGGCCCGATTTGG + Intergenic
1158011878 18:52737978-52738000 AACAGGCAGAGGGCCAAAGTTGG - Intronic
1158947847 18:62463457-62463479 AACAGGCAGCTGGCCTGATTTGG + Intergenic
1161743992 19:6043522-6043544 AACAGGCAGTGGGCCAGATTTGG - Intronic
1162882585 19:13671085-13671107 AACAGGCAGCCAACCAAATTTGG + Intergenic
1163409172 19:17142835-17142857 AACAAGCATCAGACCAGATTTGG + Intronic
1164571937 19:29380896-29380918 AGCAGGAATCCGGGCACATTTGG + Intergenic
1164850701 19:31481019-31481041 AATAGGCAGCGGGCCAGATTTGG + Intergenic
1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG + Intergenic
1165526865 19:36363537-36363559 AAAAGACATCCGGCCATATCTGG + Intronic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1168411835 19:56145095-56145117 AACAGGCTGCAGGCCAGATTCGG + Intronic
927456492 2:23254835-23254857 AACAGGTGTCCGGTCATATTTGG - Intergenic
928140881 2:28727932-28727954 AACAGGCTCCTGGCCACATTTGG - Intergenic
928243475 2:29606628-29606650 AACAGGCAATGGGCCAGATTAGG - Intronic
929196433 2:39189605-39189627 AACAGGCAGTAGGCCAGATTTGG - Intronic
929987992 2:46756467-46756489 AACAGGCCACAGGCCAGATTTGG + Intronic
930875907 2:56215808-56215830 AACAGGCAACAGGCTAAATGTGG - Intronic
931119926 2:59205086-59205108 AACAGGCATCAGGTCTGATTTGG + Intergenic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933979036 2:87535719-87535741 AACAGGCAGAGGGCCAGATTTGG + Intergenic
934648806 2:96075576-96075598 AGCAGGCAGCAGGTCAAATTTGG + Intergenic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
936314791 2:111415073-111415095 AACAGGCAGAGGGCCAGATTTGG - Intergenic
938748261 2:134302196-134302218 AACAGGCAGTGGGCCAGATTTGG + Intronic
939457766 2:142460597-142460619 AACAGGCAGCTAGCTAAATTTGG + Intergenic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
940793507 2:158052932-158052954 AACAGGCATTGGGTCAGATTTGG + Intronic
940996990 2:160160063-160160085 AACAAGCAACAGGCCAAATATGG - Intronic
942936745 2:181566382-181566404 AACAGGCACCAGGACAAATTGGG - Intronic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
944487580 2:200223006-200223028 AACAGGCAGCGGGCCAGGTTTGG + Intergenic
946842100 2:223829289-223829311 AACAGGCAGAAGGCCAGATTTGG - Intronic
947181333 2:227413885-227413907 AATAGGCCTCCAGCCAGATTTGG - Intergenic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1169104018 20:2978844-2978866 AACAGGCAGTGGGCTAAATTTGG + Intronic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169809030 20:9590387-9590409 AACAGGCAGAGGGCCAGATTTGG - Intronic
1169837910 20:9900941-9900963 AAGAGGCAGCAGGCCAGATTTGG - Intergenic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170853345 20:20023982-20024004 AACAGGCAGTGGGCCAGATTTGG - Intronic
1172972628 20:38884556-38884578 AACAGGCTGCCTGCCAGATTTGG + Intronic
1173150674 20:40564159-40564181 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1173451107 20:43164891-43164913 AACAGGCAGCAGGCCAGATCTGG + Intronic
1173877413 20:46383009-46383031 AACAGGCAACAGGCCTAATATGG - Intronic
1173971993 20:47160400-47160422 AACAGGCGACAGGCCAGATTTGG + Intronic
1174190053 20:48734217-48734239 AACAGGCAGAGGGCCAGATTAGG - Intronic
1174543732 20:51309289-51309311 AACAGGCAGTGGGCCATATTTGG - Intergenic
1174792906 20:53497130-53497152 AACAAGTAGCAGGCCAAATTTGG + Intergenic
1174937889 20:54892520-54892542 AACAGGCAGCAGACCTAATTCGG - Intergenic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1177351468 21:19947272-19947294 AACAATCATACAGCCAAATTAGG + Intergenic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177607986 21:23407156-23407178 AACAGGCAGCAAGCCAGATTTGG + Intergenic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1178604023 21:34019535-34019557 AACAGGCAATGGGCCAGATTTGG - Intergenic
1179182051 21:39053889-39053911 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1179411140 21:41164260-41164282 AACAGGCAGTTGGCCAGATTTGG + Intergenic
1179415490 21:41195081-41195103 AACAGGTAGCTGGCCAGATTTGG - Intronic
1179420739 21:41234386-41234408 AACAGGCAGCAGGTCAGATTTGG - Intronic
1179943873 21:44657506-44657528 AACAGGCAGTGGGCCAAATGTGG + Intronic
1182010018 22:26992851-26992873 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
1182891422 22:33822095-33822117 ACCAGGCATCAGGCCAAGGTTGG - Intronic
1183026740 22:35070996-35071018 AACAGGGGTCAGGCCAGATTTGG + Intronic
949121661 3:391955-391977 AACAGGCAGCAGGCTGAATTTGG - Intronic
949168991 3:976232-976254 AACAGGCGGCCTGCCAAATTTGG + Intergenic
949345593 3:3073379-3073401 AACAGGCAACAAGCCAGATTTGG - Intronic
950159380 3:10748249-10748271 AACAGGCAGTGGGCCAGATTTGG + Intergenic
951106910 3:18755055-18755077 AACAGGCAGTAGGCCATATTTGG - Intergenic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
951983588 3:28592975-28592997 AACAGGCATTAGGACCAATTTGG + Intergenic
955511833 3:59688840-59688862 AACAGGCTGTGGGCCAAATTTGG + Intergenic
955591723 3:60543233-60543255 AACAGGCAGCAGCCCAGATTTGG + Intronic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956524008 3:70137336-70137358 AATAGGCAACAGGACAAATTTGG - Intergenic
956732926 3:72213454-72213476 AACAGGCTGCAGGCCAAATTCGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
956865499 3:73364992-73365014 AACAGGCATCAGGCTGGATTTGG - Intergenic
957023472 3:75151596-75151618 CTCAGGCATCTAGCCAAATTTGG + Intergenic
957110326 3:75947377-75947399 AACAGGCAGCAGGCCAGATCTGG - Intronic
959343828 3:105166521-105166543 AACAAGCATCCCCCCAAAATTGG + Intergenic
960263655 3:115595979-115596001 AATAGGTAGCAGGCCAAATTTGG - Intergenic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
960765577 3:121126211-121126233 AACAGGCAGCATGCCAGATTTGG - Intronic
961472328 3:127123710-127123732 AATAGGCAACAGGCCAGATTTGG + Intergenic
961776016 3:129286117-129286139 AACAGGCAGTAGGCCAGATTTGG - Intronic
962502169 3:136006584-136006606 AACAGGCAGTGGGCCAGATTTGG + Intronic
963081415 3:141398135-141398157 AACAGGTATCAGGCCAGATGTGG + Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
967654660 3:192032578-192032600 AACAGGCAGTGGGCTAAATTTGG - Intergenic
970291849 4:14581647-14581669 AACAGCCATTTGGACAAATTTGG - Intergenic
971462907 4:26921557-26921579 AACAAGCAGCCAGCCATATTTGG + Intronic
972119020 4:35677775-35677797 AACAGGCAACCTACAAAATTGGG - Intergenic
972715493 4:41641894-41641916 AACTGGCTTCTGGCCACATTTGG + Intronic
973282521 4:48374532-48374554 AACTGGCACCCGGCCAATTGTGG + Intronic
974021894 4:56698915-56698937 AGCAGGGATGGGGCCAAATTGGG - Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
976084146 4:81389926-81389948 AACAGGCAGCAGGCCAGACTTGG + Intergenic
976121328 4:81785594-81785616 AACAGGAAGCTGGCCACATTTGG + Intronic
976126260 4:81836552-81836574 AACAGGCAATCGGCCAGATTTGG + Intronic
978387814 4:108193187-108193209 AACAGCAATCTGACCAAATTTGG - Intergenic
979841139 4:125441930-125441952 AACAGGCACTAGGCCCAATTTGG - Intronic
979934705 4:126677031-126677053 AACAGGTAGCAGGCCAGATTTGG + Intergenic
979975736 4:127194197-127194219 AACAGGAAGCGGGCCAAATTTGG + Intergenic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
982050551 4:151497369-151497391 AACAGGTGACTGGCCAAATTTGG - Intronic
984155185 4:176187653-176187675 AACAGGCAACAGGCTGAATTTGG + Intronic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
986341092 5:6790048-6790070 AACAGGCAACAGGTCAGATTTGG - Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
987287431 5:16471073-16471095 AACAGGTAGCAGGCCAGATTTGG + Intergenic
987425797 5:17771454-17771476 AACAGGCATAGAACCAAATTTGG + Intergenic
987669246 5:20985994-20986016 AACAGACAAAAGGCCAAATTTGG - Intergenic
988430457 5:31112975-31112997 AAAAGGCAACCAGCCAAAGTAGG - Intergenic
988555583 5:32233137-32233159 AACAGGCGCCAGGCCAGATTTGG - Intronic
992570016 5:78045893-78045915 AATAGGCAGCAGGCCATATTTGG - Intronic
992594087 5:78328028-78328050 AACAGGCATTGGGCCAGATTTGG + Intergenic
993090167 5:83415801-83415823 AACAGGCTGCGGGCCAGATTTGG - Intergenic
993179796 5:84538030-84538052 TACAGGCATCTGACCATATTTGG - Intergenic
994900894 5:105767878-105767900 GACAGGCATCAGGCCAGATTTGG - Intergenic
995659109 5:114461414-114461436 AACAGGCAGCCAGCCTGATTAGG - Intronic
998790494 5:145761738-145761760 AGCAGGCAGCCGGCTAAATTTGG + Intronic
998852280 5:146362760-146362782 AACAGGCAGCAGGCCAGCTTTGG + Intergenic
1000618314 5:163455064-163455086 AACAGGTAGTGGGCCAAATTTGG + Intronic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1001010379 5:168092333-168092355 AACAGGCAGTGGGCCAGATTAGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001149588 5:169215616-169215638 AGCAGGCAGTGGGCCAAATTTGG + Intronic
1001709791 5:173769084-173769106 AACAGGCAAGGGGCCAGATTTGG - Intergenic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1003026587 6:2560300-2560322 AACAGGCTTCAGGCCAAATGTGG - Intergenic
1004568710 6:16824137-16824159 AACAGGCAGCAGGCCAGAATTGG - Intergenic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1005489945 6:26338527-26338549 AACAGGTAGCAGGCCACATTTGG - Intergenic
1007224630 6:40304272-40304294 AACAGGCATCGGGCTGGATTTGG + Intergenic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1010082550 6:71881202-71881224 AACAGTCATTTGGCTAAATTTGG + Intergenic
1010416082 6:75613149-75613171 AACAGGCAGCTGGACAAATTTGG - Intronic
1010437344 6:75849138-75849160 AACAGGCAGTGGGTCAAATTTGG - Intronic
1010735044 6:79434762-79434784 AACAGGCAGCGGGCTGAATTTGG - Intergenic
1010816750 6:80366872-80366894 AACAGACATCTGGCAGAATTAGG + Intergenic
1011669848 6:89673046-89673068 AACAGGCATCCAAACAAATGGGG + Intronic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013801748 6:113953802-113953824 AAGAGGCAATTGGCCAAATTTGG - Intronic
1015126436 6:129760391-129760413 AGCAGGTGTCCGGCCAGATTTGG + Intergenic
1015170049 6:130242365-130242387 AACAGGCAGTAGGCCAGATTTGG + Intronic
1015283521 6:131459201-131459223 AACAGGCAGCAGACCAGATTTGG + Intergenic
1015726799 6:136307427-136307449 AACAGGCTGCAGGCTAAATTTGG - Intergenic
1017265932 6:152446275-152446297 AACAGGCAACTGGCTAAATGTGG + Intronic
1017631756 6:156402774-156402796 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1020884142 7:13801828-13801850 AACAGGCAGTTGGCCACATTTGG - Intergenic
1020912984 7:14156610-14156632 AACAGGCAGCTGGTCAGATTTGG + Intronic
1020925768 7:14322131-14322153 AACAGGCAGCAGGCCAGATCTGG - Intronic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1022054161 7:26711961-26711983 AACTGGCAACTGACCAAATTAGG + Intronic
1023385252 7:39650263-39650285 AACAGGCAGCAGGCTGAATTTGG - Intronic
1023532046 7:41168074-41168096 AACAGGCATCAGGCTGGATTTGG - Intergenic
1026291053 7:69006515-69006537 AACGGGCATCAGGCCAGATTTGG - Intergenic
1027329523 7:77077267-77077289 AACAGGCCCCTGGCCAGATTTGG - Intergenic
1027680622 7:81216267-81216289 AACAGGACACAGGCCAAATTTGG - Intergenic
1028932920 7:96433747-96433769 AACAAGCAGTGGGCCAAATTTGG + Intergenic
1029011274 7:97264272-97264294 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1029786239 7:102794094-102794116 AACAGGCCCCTGGCCAGATTTGG + Intronic
1030173476 7:106627882-106627904 AACAGCCATCCTGCCCAAGTAGG - Intergenic
1030797740 7:113809684-113809706 AACAGGCAACGGGCCAGATGGGG - Intergenic
1031715732 7:125106900-125106922 AACAGGCATCTGGAAAAAGTTGG - Intergenic
1032214917 7:129950526-129950548 AAAAGGCATCAGGTCAAGTTAGG + Intronic
1032865763 7:135922476-135922498 AACAGGCAATGGGCCAGATTCGG + Intergenic
1033205856 7:139421666-139421688 TACAGGCTACCGGCCAGATTTGG - Intronic
1034507917 7:151509679-151509701 AACAGGCTGTAGGCCAAATTTGG - Intronic
1034542767 7:151769637-151769659 AACAGGAATCCGGGCAGCTTAGG + Intronic
1036214575 8:6868358-6868380 AACAGGCAGCAAGCCAGATTTGG - Intergenic
1036738335 8:11339474-11339496 AACAGGCAGCGGGCCAGATTTGG - Intergenic
1037352081 8:17971214-17971236 AACAGGCAGCAGGCTGAATTTGG + Intronic
1038079476 8:24117440-24117462 AAAAGATATCCGGCCAAGTTTGG - Intergenic
1042330909 8:67579677-67579699 AACAGGCAGCAGGCCAGATATGG - Intronic
1044051523 8:87511710-87511732 TACAGGGATAGGGCCAAATTAGG + Intronic
1044313240 8:90719529-90719551 AACAGGTAGCAGGCCAGATTTGG + Intronic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1046364305 8:113205969-113205991 AAAGGGCATCAGGCCATATTTGG - Intronic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1050440534 9:5657767-5657789 AACAGGCACCAGGGCATATTTGG - Intronic
1051066560 9:13111141-13111163 AACAGGCAGTGGGCCAAATTTGG - Intronic
1051677056 9:19569261-19569283 AACAGGCTGCAGGCCAGATTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1055022996 9:71690087-71690109 AACAGGCATCCCTCCAAGGTAGG - Exonic
1055311643 9:74988803-74988825 AATAGGCTACAGGCCAAATTGGG + Intronic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1055949908 9:81720881-81720903 AACAGGCTTCAGGCCAAAGCTGG - Intergenic
1057552538 9:96062621-96062643 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1058646776 9:107138403-107138425 AACAGGCAGTGGGCCAAATTTGG - Intergenic
1059319600 9:113458342-113458364 AACAGGCAGCCAGCCAGATTTGG + Intronic
1060382712 9:123191738-123191760 AACAGGCAATGGGCCAAATTTGG + Intronic
1061538537 9:131264698-131264720 AAAAGGCTTCAGGTCAAATTAGG - Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1186157654 X:6742303-6742325 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1186370592 X:8942921-8942943 AACATGTAGCAGGCCAAATTTGG + Intergenic
1186393594 X:9185390-9185412 AACAGGCATGGGGTCACATTTGG - Intergenic
1186708674 X:12169926-12169948 AACAGGCAGTGGGCCAGATTTGG + Intronic
1186748105 X:12591514-12591536 AACAGGCAGAGGGCCAGATTTGG - Intronic
1187027885 X:15455022-15455044 AAAAGGAATCAGGACAAATTAGG - Intronic
1187708279 X:22028666-22028688 AACAGGCAGTGGGCCAAATTTGG + Intergenic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1188530024 X:31129669-31129691 AACAGGTATTGGGCCAGATTTGG + Intronic
1189339717 X:40195564-40195586 AACAGGCAGCTGGCCAGATCTGG + Intergenic
1190755330 X:53396410-53396432 AGCAGGCAGCCTGCCAGATTTGG - Intronic
1192182562 X:68925369-68925391 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1196855782 X:119982196-119982218 GACAGGCAAGCTGCCAAATTGGG - Intergenic
1198175399 X:134149576-134149598 AACATCCATCCAGTCAAATTAGG + Intergenic
1201751618 Y:17438131-17438153 AACAAACATCAGGGCAAATTGGG + Intergenic