ID: 965985260

View in Genome Browser
Species Human (GRCh38)
Location 3:174745456-174745478
Sequence CTGGCCCCAGACTTTTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965985260_965985266 22 Left 965985260 3:174745456-174745478 CCAACCAAAAAGTCTGGGGCCAG 0: 1
1: 0
2: 1
3: 35
4: 224
Right 965985266 3:174745501-174745523 CTAGAGGTACAAAGAGGAGCTGG 0: 63
1: 2364
2: 4236
3: 6087
4: 2897
965985260_965985264 6 Left 965985260 3:174745456-174745478 CCAACCAAAAAGTCTGGGGCCAG 0: 1
1: 0
2: 1
3: 35
4: 224
Right 965985264 3:174745485-174745507 TTACAGCAGAATTCTACTAGAGG 0: 1
1: 12
2: 379
3: 7571
4: 4646
965985260_965985265 16 Left 965985260 3:174745456-174745478 CCAACCAAAAAGTCTGGGGCCAG 0: 1
1: 0
2: 1
3: 35
4: 224
Right 965985265 3:174745495-174745517 ATTCTACTAGAGGTACAAAGAGG 0: 66
1: 2856
2: 7785
3: 2940
4: 939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965985260 Original CRISPR CTGGCCCCAGACTTTTTGGT TGG (reversed) Intronic
900358412 1:2275838-2275860 CTGGCCCCTGGCTCTTTGGGAGG + Intronic
904278716 1:29402671-29402693 CTGGTCCTGGACTTTTTGGTTGG + Intergenic
904852320 1:33468340-33468362 CTGCCCCAAGACTTTGGGGTTGG + Intergenic
906854501 1:49290271-49290293 TTGGCTCCAGACTTCTGGGTTGG + Intronic
908598801 1:65717142-65717164 CTGGCAGCAGACTTTTCAGTGGG - Intergenic
908908866 1:69048999-69049021 CTGGTCCTGGGCTTTTTGGTTGG + Intergenic
910121312 1:83793352-83793374 CCCTCCCCAGACTTTTTGGTGGG - Intergenic
910339052 1:86164974-86164996 CTGGTCTTGGACTTTTTGGTTGG + Intergenic
910620329 1:89246667-89246689 CTGGTCCTGGACTTTTTGGTTGG - Intergenic
910866400 1:91792123-91792145 TTGGCTCCAGGCTTTTTGGCAGG - Intronic
912763536 1:112388964-112388986 CTGGCTCCAGACTTTTGGAGAGG + Intergenic
915975779 1:160387224-160387246 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
920864783 1:209743032-209743054 CTCCACCCAGACTTTTTGTTAGG - Intergenic
1065222284 10:23508555-23508577 CTGGTCCCGGACTCTTTGGTTGG + Intergenic
1065879864 10:30029000-30029022 CTGGCCCCAGCCTTCTCGGTCGG + Exonic
1067057778 10:43062259-43062281 CTGGGCCCAGACTCCCTGGTGGG + Intergenic
1067329427 10:45301276-45301298 CTGGCCACAGCCTCTTTGCTGGG + Intergenic
1067718130 10:48705062-48705084 CTGGCCCCAGAGTCTGTGCTGGG + Intronic
1068366990 10:56064527-56064549 CTGGTCCCAGACTCTTTTTTTGG + Intergenic
1069591497 10:69644920-69644942 CTGGTCCCAGACCCTTTGGAAGG + Intergenic
1071062948 10:81595575-81595597 CTGGTCCTGAACTTTTTGGTCGG - Intergenic
1072797128 10:98364638-98364660 CTGCCCCCACACCCTTTGGTGGG - Intergenic
1074037067 10:109750615-109750637 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1076167852 10:128296772-128296794 CTGGCCCCACCCCTTTTGGCAGG - Intergenic
1077332540 11:1989810-1989832 CTGGCCCCACACTTACTGGTTGG + Intergenic
1078339011 11:10485842-10485864 TTGGCCCCTCACTTCTTGGTGGG + Intronic
1078829110 11:14962297-14962319 CTGGTCCTGGACTCTTTGGTTGG - Intronic
1079735988 11:23997912-23997934 CTGGTCCAGGGCTTTTTGGTAGG - Intergenic
1079748819 11:24168953-24168975 CTGGTCCTAGACTCTTTGGTTGG + Intergenic
1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG + Intergenic
1083235841 11:61350263-61350285 CTGGGCCCAGACTTCTTGCCTGG - Exonic
1083431211 11:62614398-62614420 TTGGGCCCAGAGGTTTTGGTTGG - Exonic
1084580931 11:70022849-70022871 ATAGCCCCAGACTATCTGGTGGG + Intergenic
1085068425 11:73519359-73519381 CAGGCCCCAGACATTGTGTTAGG + Intronic
1085122808 11:73978072-73978094 CTGGCCCCTGACTTTCTCCTTGG + Exonic
1085293684 11:75418192-75418214 CTGGCCCCAGATTCTCTGGGTGG + Intronic
1086560142 11:88158297-88158319 CTGGCCTGCAACTTTTTGGTTGG - Intronic
1086997580 11:93375908-93375930 CTGGTCCTGGACTTTTTTGTTGG + Intronic
1090673016 11:128963711-128963733 CTGGCCACAAAATTTGTGGTTGG + Intergenic
1091356959 11:134944567-134944589 CTGGGCCCAGACTTATTAGGTGG - Intergenic
1202815521 11_KI270721v1_random:44986-45008 CTGGCCCCACACTTACTGGTTGG + Intergenic
1092332453 12:7597691-7597713 CTGGTCCTGGCCTTTTTGGTTGG - Intergenic
1095657181 12:44684043-44684065 CTGGTCCTGGACTCTTTGGTTGG + Intronic
1097537114 12:60886126-60886148 CTGGCCCTGGACTTTTTTGGGGG + Intergenic
1100059243 12:90552622-90552644 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1102970143 12:117159986-117160008 CTAGCCCTAGAGTATTTGGTGGG - Intronic
1107455328 13:40549678-40549700 CTGGCTCCAAACTTCTTGTTAGG + Intergenic
1108568860 13:51729613-51729635 CTGGCCCCAGTCTATTTGCAGGG + Intronic
1109002393 13:56822156-56822178 CTGGCCCTGGACTTCTTTGTTGG + Intergenic
1111779138 13:92699048-92699070 CTGGTCCTAGACTTTTTTTTTGG + Intronic
1114645514 14:24254018-24254040 CTGGCCCCAACCTGCTTGGTTGG + Intronic
1116594601 14:46823837-46823859 CTAGCCTCAGTCTTCTTGGTGGG - Intergenic
1119540640 14:75435878-75435900 CTTGCCCCAGAGTTTTTATTTGG - Intronic
1120089020 14:80309704-80309726 ATGGCCATAGATTTTTTGGTGGG - Intronic
1120277662 14:82397830-82397852 CTGACCCCAGAATTTTTGTAAGG - Intergenic
1120776773 14:88446109-88446131 CTGGTCCTGGACTCTTTGGTTGG + Intronic
1121254701 14:92522743-92522765 TTGGCCCCTGAATTTTTGCTGGG + Intronic
1124205219 15:27712815-27712837 CTGGCCCAGGATTTTTTTGTGGG + Intergenic
1125343922 15:38699777-38699799 CCTGCCCCAGACTTCTTGGATGG + Exonic
1127155541 15:56121330-56121352 CTGGCAGCAGACTTTTCAGTGGG - Intronic
1127339848 15:58029900-58029922 CTGGTCCTGGACTTTTTGGTTGG - Intronic
1130762387 15:86833938-86833960 CTGGCACCAGACTTCTTTTTTGG - Intronic
1130810566 15:87373435-87373457 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1131248500 15:90816334-90816356 TTGGCCCCAGCATCTTTGGTAGG + Intergenic
1131833061 15:96366437-96366459 CTGGACCCTGACTTTTTTGGAGG - Intergenic
1132247231 15:100307026-100307048 CTGAACCCAGACTTTTGGGATGG - Intronic
1140956993 16:79875121-79875143 CTGGCCCCAGAGTTGCTGCTTGG + Intergenic
1142595345 17:1027091-1027113 GAGGCCCCAGACATTTTGGAAGG - Intronic
1143413907 17:6730943-6730965 CTGGCAGCAGACTTTTCAGTGGG + Intergenic
1143991127 17:10962956-10962978 CTGGTCCTGGACTTTTTTGTTGG - Intergenic
1146180389 17:30694250-30694272 CTGGCCCCAGATGTGTTGTTTGG + Intergenic
1147972056 17:44223627-44223649 CTGGCCCTGAACTTTTTGGCTGG + Intergenic
1148365492 17:47052810-47052832 CTGTCCCCAGCCCTTTTGGGAGG + Intergenic
1149408930 17:56383846-56383868 CTGGTCCTGGACTCTTTGGTTGG - Intronic
1151468547 17:74303274-74303296 CTAGCCTCAGACTTCATGGTGGG - Intronic
1152092893 17:78256850-78256872 CTGGCTCCAGACCTTCTGCTGGG + Intergenic
1152359737 17:79826231-79826253 CTCTCCCCAGACTTGTTGGCAGG + Intergenic
1153105243 18:1518812-1518834 CTGGTCCGACTCTTTTTGGTTGG + Intergenic
1153450514 18:5222578-5222600 CTGGTCCTGGACTTTTTGGGAGG - Intergenic
1154371663 18:13768921-13768943 CTGGCCCTGGACTTTCTGGTTGG - Intergenic
1155111504 18:22720007-22720029 CTGGTCCTGGACTCTTTGGTTGG - Intergenic
1157062072 18:44303366-44303388 CTGGTCCTGGATTTTTTGGTTGG - Intergenic
1157298658 18:46463897-46463919 CTGACCCCAAACTTTTTGGAGGG - Intergenic
1157569621 18:48703868-48703890 CTGGCCACAGCCCTTTTGGCAGG - Intronic
1158024814 18:52884049-52884071 CTGGCAGCAGAGTTTTCGGTGGG - Intronic
1158392490 18:57054939-57054961 CTGGCCCTACATTTTATGGTGGG + Intergenic
1158472025 18:57745566-57745588 CTGGCCACAAAATTTTTGATTGG + Intronic
1159327488 18:66941856-66941878 CTGGCCCCTGGCTTTTTGAATGG - Intergenic
1159515457 18:69452429-69452451 CTGGTCCTGGACTCTTTGGTTGG - Intronic
1159906885 18:74100927-74100949 CTGTCCCTGGACTTTTTTGTTGG - Intronic
1160289795 18:77581264-77581286 CTGGTCCTGGACTTTTTAGTTGG - Intergenic
1162931051 19:13958008-13958030 CTGGCCCCTGGCTTATTTGTGGG - Intronic
1162978211 19:14221287-14221309 CTGGCCCCAGATGTGTTGTTTGG - Intergenic
1164384003 19:27758215-27758237 CTGGCCCCAGACATTCTAATGGG - Intergenic
1164978093 19:32590136-32590158 CTGGTCCTGGACTCTTTGGTTGG + Intergenic
1165983160 19:39743218-39743240 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1166648044 19:44547382-44547404 CTGGACCCAGATTTTGTGATTGG - Intergenic
1167664415 19:50815568-50815590 CTGCCCCAAGACTTTTTATTAGG - Intergenic
925088717 2:1135032-1135054 CTGGACCCAGACTTTTTTGCAGG - Intronic
928165608 2:28969572-28969594 CTGGTGCCAAACTTTTTGTTTGG - Intronic
928442945 2:31308164-31308186 CTGGTCCTAGACTTTTTTGTTGG + Intergenic
928501201 2:31897840-31897862 CTGGTCCTGGGCTTTTTGGTTGG + Intronic
930159742 2:48142757-48142779 CTGGTCCTAGACTTTTTTTTTGG + Intergenic
932438601 2:71717725-71717747 CTTGACCCAGGCTGTTTGGTTGG + Intergenic
933502333 2:83129786-83129808 CTGGATCCAGAGTTTTAGGTAGG + Intergenic
935106227 2:100046327-100046349 CTGGTACCAGACTTATAGGTTGG - Intronic
941772293 2:169358178-169358200 ATGTCCCCAGCCTGTTTGGTTGG - Intronic
942730514 2:179056602-179056624 CCGGCGCCAGAGTTTTGGGTCGG + Intergenic
942984717 2:182125521-182125543 CTGGTCCTGGGCTTTTTGGTTGG + Intronic
943185033 2:184597573-184597595 CTGGAGACAGACTTTCTGGTTGG - Intergenic
943227276 2:185193986-185194008 CTGGTCCTGGGCTTTTTGGTTGG - Intergenic
1170345201 20:15378188-15378210 CTGGCCCCATGCTTTTTTCTAGG - Intronic
1171185174 20:23119823-23119845 CTCCCTCCAGCCTTTTTGGTAGG + Intergenic
1171811494 20:29747124-29747146 CTGGCAACAGACTTTTTTGAAGG - Intergenic
1171867047 20:30493918-30493940 CTGGCAACAGACTTTTTTGAAGG - Intergenic
1171908177 20:30918615-30918637 CTGGCAACAGACTTTTTTGGAGG + Intergenic
1173408141 20:42785236-42785258 CTGGCACCAGACTTTTGGCAAGG - Intronic
1173828057 20:46059589-46059611 CTGGGCCCAGATTGTCTGGTTGG + Intronic
1174695870 20:52557616-52557638 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1175617805 20:60416960-60416982 CTGGCCTTGGACTTTTTTGTTGG + Intergenic
1176316603 21:5250969-5250991 CTGGTCCTGGACTTTTTGGTTGG + Intergenic
1176516611 21:7789155-7789177 GTGGCCCCAGACTTCTTGGAGGG - Intergenic
1177463079 21:21438615-21438637 CTGTAGCAAGACTTTTTGGTTGG + Intronic
1178107980 21:29342211-29342233 CTGCCCCAAGAGTTTTGGGTGGG + Intronic
1178650639 21:34419167-34419189 GTGGCCCCAGACTTCTTGGAGGG - Exonic
1178834434 21:36084573-36084595 CTGGATCAAGACTTTTTGGGAGG - Intergenic
1179268587 21:39828957-39828979 CTGTCCCTGGACTTTTTAGTAGG + Intergenic
1180313728 22:11258778-11258800 CTGGCAACAGACTTTTTTGAAGG - Intergenic
1180341613 22:11624777-11624799 CTGGCAACAGACTTTTTTGAAGG + Intergenic
1180394413 22:12316898-12316920 CTGGTCCTGGACTTTTTGGTTGG + Intergenic
1180405331 22:12547850-12547872 CTGGTCCTGGACTTTTTGGTTGG - Intergenic
1181958507 22:26605709-26605731 TTGAACCCAGACATTTTGGTTGG - Intronic
1184115818 22:42421578-42421600 CTGGCCCATGACTTGGTGGTGGG - Intronic
949201999 3:1390922-1390944 CTGGTCCTGGACTTTTTGGTTGG - Intronic
949824705 3:8153377-8153399 CTGGCTCCAGACATCGTGGTTGG - Intergenic
950825487 3:15815278-15815300 TTGGCCCCACACTTTTATGTAGG - Intronic
951219629 3:20055552-20055574 CTGGCCCCAGAGTCTTTGCACGG - Intronic
951763951 3:26176092-26176114 CTGGTCCTGGACTTTTTTGTCGG + Intergenic
952689573 3:36189072-36189094 CTGGTCCCGGACTTTTTTGCTGG + Intergenic
953375371 3:42423778-42423800 TTGGCTACAGACTTCTTGGTTGG - Intergenic
954801175 3:53187771-53187793 CTGACCTCAGCCTTTTTGGTGGG - Intronic
955685147 3:61541737-61541759 ATGGTGCCAGACTTTTTGGTTGG + Intergenic
956057318 3:65313709-65313731 TGGGACCCTGACTTTTTGGTAGG - Intergenic
957772372 3:84710924-84710946 CTGGTCCTGGACTTTTTTGTTGG - Intergenic
958078535 3:88714475-88714497 CTGGCAGCAGACTTTTCAGTGGG + Intergenic
959897248 3:111618276-111618298 CTGGCCACAGAATTTCTGGCTGG + Intronic
961395800 3:126588602-126588624 CTCGTCCTGGACTTTTTGGTTGG + Intronic
962836961 3:139198059-139198081 CTGCCCCCAGACTTATTGAGAGG - Intronic
963695477 3:148561545-148561567 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
964602156 3:158513743-158513765 CTGGTCCTGGACTCTTTGGTTGG + Intronic
964644120 3:158939968-158939990 CTGGTCCTGGACTTTTTTGTTGG - Intergenic
965985260 3:174745456-174745478 CTGGCCCCAGACTTTTTGGTTGG - Intronic
966214859 3:177491570-177491592 ATAGCTCCAGGCTTTTTGGTGGG - Intergenic
968861345 4:3173310-3173332 CTGGCCACACACTTCTTGGAAGG - Intronic
969044442 4:4326592-4326614 GTGGTCCCAGACTATTTGGGAGG - Intergenic
970354400 4:15237709-15237731 CTGGCCCCATATTTTCTGCTTGG - Intergenic
970896133 4:21106219-21106241 CTGGTCCTGGACTCTTTGGTTGG + Intronic
971299618 4:25430938-25430960 CTGTCTCCAGAGCTTTTGGTTGG - Intergenic
972683577 4:41330208-41330230 CAGGACCCAGTCTCTTTGGTTGG + Intergenic
975175932 4:71288956-71288978 CTGGTTCTTGACTTTTTGGTGGG + Intronic
977272207 4:94931101-94931123 CTGGCCTCTGACTTTATGCTTGG + Intronic
979581693 4:122368293-122368315 CTGGTCCTGGACTTGTTGGTAGG - Intergenic
980231224 4:130048823-130048845 CTGGTCCTGGATTTTTTGGTTGG + Intergenic
980593715 4:134925637-134925659 CTGGTCTTGGACTTTTTGGTTGG + Intergenic
980632230 4:135450905-135450927 CTGGTCCTGGACTTTTTGGTTGG - Intergenic
982331942 4:154190794-154190816 CTGGCCTCAGACTTTGTTGCAGG - Intergenic
985307632 4:188560888-188560910 CTGGTCCTGGACTCTTTGGTTGG + Intergenic
986114883 5:4763722-4763744 CTGGTCCTGGACTTTTTGGTTGG - Intergenic
986767091 5:10938066-10938088 ATGGCTCCAGATTTTGTGGTAGG + Intergenic
988420843 5:31004248-31004270 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
989586816 5:43080278-43080300 CTGGCCTCAGCCTTTTGAGTAGG - Intronic
989805637 5:45600544-45600566 CTGGCCTGAGAATTTTTGGAGGG - Intronic
992338190 5:75795244-75795266 CTGGTCCTGGACTTTTTCGTTGG + Intergenic
993053030 5:82947528-82947550 CTGGTCCTGGACTTTTTGGTTGG - Intergenic
994870714 5:105347096-105347118 CCGGCCCCAGACTATTTTTTAGG - Intergenic
995161485 5:108988410-108988432 CTGGTCCTGGACTTTTTTGTTGG + Intronic
995814484 5:116151482-116151504 CTGGTCCTGGACTCTTTGGTTGG + Intronic
996657245 5:125955509-125955531 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
998147706 5:139739631-139739653 CTGGCCCCAGGCCTTTTTGAGGG + Intergenic
998422264 5:141998665-141998687 CAAGCCCCAGACTTTTTTTTTGG + Intronic
999350795 5:150869602-150869624 CTGGTCCTGGACTTTTTTGTTGG + Intronic
999420391 5:151436889-151436911 CTGGTCTCAGACTTTTTTTTTGG + Intergenic
1000618288 5:163454746-163454768 CAGGCCTTAGTCTTTTTGGTGGG + Intronic
1002003285 5:176211220-176211242 CTGGCCCTGGGCTTTTTTGTGGG + Intergenic
1002223167 5:177699724-177699746 CTGGCCCTGGGCTTTTTTGTGGG - Intergenic
1002924591 6:1597674-1597696 CTGGTCCCATGCTTATTGGTGGG + Intergenic
1006218823 6:32470222-32470244 CTGGTCCTGGACTTTTTGGTTGG + Intergenic
1006462626 6:34171662-34171684 CTGGCAGCAGACTTTTCAGTGGG - Intergenic
1007812923 6:44498997-44499019 CTCTCCCCAGCCCTTTTGGTTGG + Intergenic
1007819151 6:44547745-44547767 CTGTCCCCAATCTTTTTGGCAGG - Intergenic
1009328577 6:62385065-62385087 CTGGTCCTGGACTCTTTGGTTGG + Intergenic
1010125714 6:72429301-72429323 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1010164815 6:72902957-72902979 CTGGTCCTGGACTTTTTTGTTGG + Intronic
1011467737 6:87676166-87676188 CCGGTCCCAGCCTTTTTGTTAGG - Intronic
1011586990 6:88936877-88936899 CCGGTCCTAGACTTTTTGTTGGG + Intronic
1012332252 6:98007414-98007436 CTGGCCTCATACTCCTTGGTAGG + Intergenic
1014055759 6:117014033-117014055 CTGGTCCTGGACTTTTTTGTTGG - Intergenic
1014176710 6:118339168-118339190 CTGGTCCTGGGCTTTTTGGTTGG + Intergenic
1014341037 6:120207263-120207285 CTGGTCCAGGGCTTTTTGGTTGG - Intergenic
1014384878 6:120787102-120787124 CTGGCCACAGAGGTTTTGGCTGG + Intergenic
1015593446 6:134843955-134843977 CAGTCCCCAAACTTTTTGGCTGG + Intergenic
1017155339 6:151317932-151317954 CTGCTCCCTGACTATTTGGTTGG - Intronic
1017272741 6:152528073-152528095 CTGGTCACAGAGTTTTGGGTAGG - Intronic
1018546987 6:164948442-164948464 CTGGTCCTGGACTCTTTGGTTGG + Intergenic
1018832418 6:167453803-167453825 TTGGCCCCAGCCTTATTGGGCGG + Intergenic
1019173857 6:170149896-170149918 CAGGCAGCAGACTTTTTGGGAGG - Intergenic
1022165507 7:27756423-27756445 CTTGCCCCCAACTTCTTGGTAGG + Intronic
1023583902 7:41709025-41709047 CTGCCCCCAGGCTTTTCTGTCGG - Intergenic
1024045782 7:45584677-45584699 CTGGCTCTAGACTGTGTGGTAGG - Intronic
1024620675 7:51154671-51154693 CTGGCTCCACACCTTTAGGTTGG - Intronic
1024738410 7:52330255-52330277 CTGGTCCTGGACTCTTTGGTTGG - Intergenic
1025183838 7:56841029-56841051 CTGGTCCTGGACTTTTTGGTTGG + Intergenic
1025688087 7:63735958-63735980 CTGGTCCTGGACTTTTTGGTTGG - Intergenic
1025857631 7:65296900-65296922 CTGGCCCTGGACTTTTTTTTGGG + Intergenic
1026898867 7:74026533-74026555 CTGGCTCTAGCCTTTCTGGTAGG - Intergenic
1027574426 7:79914940-79914962 CTGGCCCCTGACATTTTGAGTGG - Intergenic
1028258437 7:88630913-88630935 CTGGTCCTGGAATTTTTGGTTGG - Intergenic
1029319421 7:99744897-99744919 CTGGTCCTGGACTTTTTGGTTGG - Intergenic
1030163827 7:106533170-106533192 CTGGCCCTGGAGTTTTGGGTCGG + Intergenic
1031740271 7:125420884-125420906 CTGGACCTGGACTTTTTTGTTGG - Intergenic
1031811245 7:126371975-126371997 CTGGTCCAGGACATTTTGGTTGG - Intergenic
1033234771 7:139629595-139629617 CTGGCCCCAGAGTTTGTGGCTGG + Intronic
1035287496 7:157815516-157815538 CTGGGCCCAGACTCTGTGCTGGG + Intronic
1037398638 8:18470429-18470451 CTAGTCCCAGACTTTTTGGTTGG - Intergenic
1037964976 8:23127294-23127316 CTGACCCCAACCATTTTGGTTGG + Intergenic
1043642118 8:82467460-82467482 CTGGTCCTGGACTTTTTTGTGGG - Intergenic
1050033442 9:1410267-1410289 CTGGTCCTGGACTCTTTGGTTGG + Intergenic
1051115936 9:13694435-13694457 CTGGTACTGGACTTTTTGGTTGG + Intergenic
1051299336 9:15631538-15631560 CTGATCCTGGACTTTTTGGTTGG - Intronic
1052401895 9:28011244-28011266 CTGGCACCAGAATTTTTCGTAGG + Intronic
1052951098 9:34212725-34212747 CTGGTCCTGGACTTTTTTGTTGG - Intronic
1053540305 9:38966832-38966854 CTGAAGCCAGACCTTTTGGTTGG - Intergenic
1054140634 9:61526473-61526495 CTGAAGCCAGACCTTTTGGTTGG + Intergenic
1054625837 9:67397091-67397113 CTGAAGCCAGACCTTTTGGTTGG + Intergenic
1055125381 9:72713397-72713419 CTGGTCCTGGACTTTTTGGTTGG + Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056322442 9:85449009-85449031 CTGCTCCCGGACTTTTTTGTTGG + Intergenic
1057772667 9:97982789-97982811 TTGGCCCCAGACTGTGTGGCAGG + Intergenic
1203362120 Un_KI270442v1:224990-225012 CTGGCAACAGACTTTTTTGAAGG - Intergenic
1187145558 X:16633773-16633795 CTTTCCCTAGTCTTTTTGGTAGG - Intronic
1190039685 X:47060135-47060157 ATGGCTCCAGCCTTTTTGTTTGG - Exonic
1190967644 X:55316496-55316518 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1191055144 X:56233043-56233065 CCGGCCCCTGATTTTTGGGTTGG + Exonic
1191246286 X:58230873-58230895 CTGACCCCAGACATTCTGATGGG + Intergenic
1191629421 X:63305551-63305573 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1192728113 X:73773934-73773956 CTGGTCCTGGACTTTTTTGTTGG - Intergenic
1193245993 X:79230759-79230781 CTGGCAACAGACTTTTTAGTGGG - Intergenic
1193631876 X:83899491-83899513 CTGTGCTCAGACTCTTTGGTGGG - Intergenic
1193840011 X:86398013-86398035 CTGGTCCTGGACTTTTTGGTTGG + Intronic
1194471193 X:94299357-94299379 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1194547408 X:95254627-95254649 CTGGTCCTGGACTTTTTTGTTGG + Intergenic
1194633916 X:96320800-96320822 CTGGTCCTAGACTTTTTTATTGG + Intergenic
1195454201 X:105050614-105050636 CTGGCCACAGAGGTTTTGGGAGG - Intronic
1196307743 X:114124442-114124464 CTGGTCCTGGACTTTTTGTTCGG + Intergenic
1196850354 X:119931880-119931902 TTAGAACCAGACTTTTTGGTAGG + Intronic
1197024100 X:121726737-121726759 GTGCCCCAAGATTTTTTGGTGGG + Intergenic
1197678336 X:129355320-129355342 CTGGTCCTGGACTTTTTGGTTGG - Intergenic
1197981288 X:132219603-132219625 CTGTCTCCAGACTGTCTGGTGGG + Intergenic
1198030594 X:132750140-132750162 CTGGCCCCACAGATTGTGGTGGG - Intronic
1198669707 X:139066644-139066666 CTGGCCCTCGACGTTTTGGTTGG - Intronic
1201391862 Y:13506693-13506715 CTGACCCTGGACTTTTTTGTTGG - Intergenic