ID: 965991599

View in Genome Browser
Species Human (GRCh38)
Location 3:174825659-174825681
Sequence TGTTTAAGGAATAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 387}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965991599 Original CRISPR TGTTTAAGGAATAGGGAAGA AGG (reversed) Intronic
900838602 1:5027902-5027924 TCTTTAAGGATGAGAGAAGAGGG + Intergenic
901144970 1:7058579-7058601 TGTTTAATGAGTAGGGAGGAGGG + Intronic
901155224 1:7132274-7132296 TGTTGAAGGAGAAGGGAAGGAGG - Intronic
902972825 1:20067337-20067359 TGTCTAAAGAAGAGAGAAGAGGG + Intronic
903082482 1:20821544-20821566 AGTATACGTAATAGGGAAGATGG - Intronic
903082485 1:20821587-20821609 TGTATACATAATAGGGAAGATGG - Intronic
903082505 1:20821800-20821822 TGTATACATAATAGGGAAGATGG - Intronic
903912923 1:26741485-26741507 TGTATAAGGCAGATGGAAGAGGG + Intronic
904229753 1:29058706-29058728 TTTTTAAGGAAAAGGGAGTAAGG - Intronic
905372723 1:37493388-37493410 TGTTCAAGGAACAGGAAAAATGG - Exonic
906893923 1:49750268-49750290 TGTATAAGGTGTAGGGAAGGGGG + Intronic
906996767 1:50803901-50803923 TGGTAAAGGAATAGAGAATAGGG + Intronic
907379118 1:54070955-54070977 TGTGTTAGGAGTAGGGCAGAAGG + Intronic
908067219 1:60419850-60419872 TCTTTTAGGAAGAGAGAAGATGG + Intergenic
908240103 1:62181801-62181823 TATTTCAGGAAACGGGAAGAGGG - Intergenic
909218720 1:72926857-72926879 TTCCTAAGGAATAGGGAAGAAGG - Intergenic
909911000 1:81257745-81257767 TGTTTTAGCAATAGGGGGGATGG + Intergenic
910493648 1:87801442-87801464 TGCTGAAGGAAAAGGGAATACGG - Intergenic
912020029 1:105096718-105096740 TTTTTAAGGAATAGGAGACAAGG + Intergenic
912475271 1:109930673-109930695 TGTTTAAGGTAGGGGGATGAAGG - Exonic
912671349 1:111629938-111629960 AGTTTAAGGAGTAGGAATGATGG - Intronic
912862457 1:113226151-113226173 TGTTTACTGAACAGGGAAGGAGG - Intergenic
913692410 1:121291610-121291632 TTTTTAAGGCAAAGGGTAGAAGG + Intronic
914145147 1:144988492-144988514 TTTTTAAGGCACAGGGTAGAAGG - Intronic
914260972 1:145998941-145998963 TTTTGAGGGAATAGGAAAGATGG + Intergenic
915503242 1:156334975-156334997 TGTTGGAGTAATAGGGAAAAGGG + Intronic
916755358 1:167764129-167764151 TCTTTAAAAAATATGGAAGATGG + Intronic
917511683 1:175674198-175674220 AGTTAAAGGAAAAGGGAAAAGGG + Intronic
919773921 1:201181259-201181281 AGTTTTAGGAAAAGGGAAGCTGG + Intergenic
919811373 1:201410868-201410890 TCTGTAAGGAACAGGGATGAAGG - Intronic
920479730 1:206309967-206309989 TTTTTAAGGCAAAGGGTAGAAGG + Intronic
921671285 1:217926683-217926705 TGTATATGCAATAGGCAAGAGGG - Intergenic
921936934 1:220804221-220804243 TTTATAAGGAATAGGTAAGATGG - Intronic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
923472215 1:234302034-234302056 TGTTGAAGGATGAGGGATGAGGG + Intronic
924144509 1:241060092-241060114 TGTATAAAGAATAGAGTAGAAGG - Intronic
1063036736 10:2293698-2293720 TGTTAAAGAAATAGAGAAAATGG - Intergenic
1065233007 10:23618560-23618582 TGTTTAGGGAATAGTGATGAGGG - Intergenic
1065535969 10:26715088-26715110 TGTTTATGGGATAGGCAAGAAGG + Intronic
1066243154 10:33557308-33557330 AGTTGCAGGAACAGGGAAGATGG - Intergenic
1066483530 10:35821967-35821989 TGTTTAAAGAATTTTGAAGATGG + Intergenic
1068365746 10:56047737-56047759 GTTTTAAGGAATAAGGTAGAAGG - Intergenic
1073444224 10:103571258-103571280 GGCATAAGGAAGAGGGAAGAGGG - Intronic
1073743404 10:106437599-106437621 TGTTTAAGAAATAGTAAACATGG + Intergenic
1074511348 10:114115392-114115414 TGTTGGAGGGATGGGGAAGAGGG - Intergenic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1075216234 10:120538667-120538689 TGTATAAGGAGGAGGGGAGAAGG - Intronic
1076164142 10:128268465-128268487 TGTTTCCTGAACAGGGAAGAAGG + Intergenic
1076369785 10:129945033-129945055 TGTAAAAGGAAAAGGGAAGATGG + Intronic
1077662287 11:4080417-4080439 AAAATAAGGAATAGGGAAGATGG - Intronic
1077896894 11:6459700-6459722 TGTTTAAGAAGGAGGGAAGGTGG + Intronic
1078110108 11:8385444-8385466 TGTTTTAGGCAGAGGGAACAGGG - Intergenic
1078197279 11:9146470-9146492 TATTTACAGAAGAGGGAAGAGGG - Intronic
1079063348 11:17268950-17268972 TGTGTTAAGAAAAGGGAAGAAGG - Intronic
1079973597 11:27065144-27065166 TGATTAAGGGAAAGGCAAGATGG + Intronic
1080486957 11:32718627-32718649 TGTAGAGGAAATAGGGAAGATGG - Intronic
1080816567 11:35763416-35763438 TATTTGAGGAATAAGGGAGAAGG + Intronic
1080901773 11:36500402-36500424 TGTTCAAGGGATAGCAAAGAGGG + Intronic
1081308230 11:41539678-41539700 TTTTTAAAAAATAGGAAAGAAGG + Intergenic
1083534668 11:63456853-63456875 AGGGTAAGGAACAGGGAAGAAGG - Intergenic
1084251475 11:67902753-67902775 TATTTAGGGCATAGGGAAGGAGG + Intergenic
1084409101 11:68996111-68996133 TGTTTAAGGCACAGGGAGAAAGG - Intergenic
1086213742 11:84352099-84352121 AGTCTAAGGAAAAAGGAAGATGG + Intronic
1087895767 11:103584115-103584137 TGTTTAAGGAGAAGGGAAGAAGG - Intergenic
1088891678 11:114049589-114049611 TGATTAATCAACAGGGAAGAAGG + Intergenic
1088949421 11:114551787-114551809 TGTGTGAGGAAGGGGGAAGAAGG + Intronic
1090619325 11:128547789-128547811 TTTTTAAAAAATAGGGATGATGG + Intronic
1090725729 11:129525816-129525838 TGTTTAGGGAATTGGAAACAGGG + Intergenic
1091488209 12:909932-909954 TGTTTCGGGAATAGTGAGGAGGG + Exonic
1091521793 12:1252909-1252931 TGCTTAGGGGATGGGGAAGAGGG + Intronic
1092036960 12:5344439-5344461 AGATTAGGAAATAGGGAAGAAGG - Intergenic
1093001012 12:13995776-13995798 TGTTTATACAACAGGGAAGAAGG + Intergenic
1093091296 12:14924006-14924028 TGGTGATGGAAGAGGGAAGAGGG - Intronic
1093837773 12:23857629-23857651 TGTGTAAGGCATATGGAAAAAGG + Intronic
1094235737 12:28163891-28163913 TGTTTAAAAAATATGAAAGATGG + Intronic
1094469265 12:30788337-30788359 TGTTAAGGGAAGAGGGTAGAAGG + Intergenic
1094493787 12:30977155-30977177 GGATTAAGGAATACGGGAGAGGG - Intronic
1094742745 12:33308556-33308578 TGTTAAAGGAACAGGCAACATGG + Intergenic
1095768441 12:45923617-45923639 AGTTGAAGGAATAGGGAAATTGG - Intronic
1096320616 12:50609468-50609490 TGATGAAGGAACAGGGTAGAAGG - Intronic
1097263294 12:57731735-57731757 AGTCTAGGGACTAGGGAAGATGG + Intronic
1097999462 12:65924342-65924364 TGTAAAATGAATATGGAAGAGGG + Intronic
1099577267 12:84396423-84396445 TGATTAAGGAAAAGAGTAGAAGG - Intergenic
1099930152 12:89064858-89064880 TGTTTCAGGCTGAGGGAAGAGGG + Intergenic
1100011621 12:89960783-89960805 TGTTTAATGAATAAGGAATTAGG + Intergenic
1100473500 12:94914960-94914982 TGTTTAAGGAAGGGGGAAAGGGG - Intronic
1102306182 12:111806428-111806450 TGTTTAAGGAAGAGGCAAATGGG + Intronic
1102485346 12:113251694-113251716 TGGTACAGGAATAGGGAAAAGGG + Intronic
1102936434 12:116901092-116901114 TGTTTTAGGAAGAGGGAAGTGGG + Intergenic
1103040378 12:117690261-117690283 TGTTGAAAGAATGGGGAAAAAGG + Intronic
1106469535 13:30042187-30042209 TGATTAAGGGAAAGGCAAGATGG - Intergenic
1106923952 13:34593355-34593377 TGTTTAAGGAATTGTGGACACGG - Intergenic
1108078358 13:46706095-46706117 TGTTAAAGAAATAAGGAAAAGGG + Intronic
1108215998 13:48185329-48185351 TGTTTAAGACATAAGGAAAAAGG - Intergenic
1108767494 13:53650404-53650426 TGGATAAGGAAGAGGAAAGAAGG - Intergenic
1109445026 13:62425767-62425789 TGTTTAAGGCATAGGATATATGG - Intergenic
1109756669 13:66770206-66770228 AGCTTAAAGAATAGGGAGGAGGG + Intronic
1110091776 13:71459397-71459419 TGTTTCAGGAAGAGAGAAAATGG + Intronic
1110237244 13:73229755-73229777 TGTATAAGTAATAGGGAACATGG + Intergenic
1110959270 13:81600074-81600096 TGTTGAAGTCATAGGGAAGATGG + Intergenic
1111213844 13:85117413-85117435 TGATGCAGGAATAGGGATGATGG + Intergenic
1113409933 13:110076281-110076303 TGTATAAGGTATAAGGAAGGGGG + Intergenic
1113412369 13:110101507-110101529 TTTTCAGGAAATAGGGAAGAAGG + Intergenic
1113542523 13:111120183-111120205 GGTTTCAGGCCTAGGGAAGAAGG + Intronic
1115261438 14:31458161-31458183 TGTTTAAGGAATACGTTACATGG - Intergenic
1115277757 14:31626585-31626607 TGTTTAGAGAATATGTAAGATGG + Intronic
1115405136 14:33006420-33006442 TGTGGAAAGAATATGGAAGAGGG - Intronic
1117003939 14:51399190-51399212 TGTTTAAGGAAGGCAGAAGAGGG - Intergenic
1117387863 14:55234285-55234307 TGTTTTAGGCATTGGGAATAGGG + Intergenic
1119273334 14:73329503-73329525 TGTTTAAGGGCAAGAGAAGATGG - Intronic
1119343069 14:73897303-73897325 CTTTAAAGGAACAGGGAAGAAGG + Intronic
1120418446 14:84250707-84250729 TGTTTAAGAGATAGGAAAAAAGG - Intergenic
1121070182 14:91012206-91012228 TTATTGAGGAATAGGGAATAAGG - Intronic
1121569260 14:94935014-94935036 AGTTTCTGGAAAAGGGAAGAAGG - Intergenic
1122194859 14:100077273-100077295 TGTTTAAGAAATAGAACAGATGG + Intronic
1122330895 14:100911783-100911805 TGTTTAAGGTAGAGGGAGGCAGG + Intergenic
1122642982 14:103172110-103172132 TCTTTCAGGAAATGGGAAGAGGG + Intergenic
1123223487 14:106878310-106878332 TTTTAAAGTAAAAGGGAAGATGG + Intergenic
1124997706 15:34739917-34739939 TTTTTAAGGAATGAGGAAAAGGG - Intergenic
1125142178 15:36421570-36421592 TGTTTAGAGAATAGAGAAGCTGG - Intergenic
1125901728 15:43354250-43354272 GTTTTAAGGAACAGGGGAGAGGG + Exonic
1126574003 15:50180549-50180571 TGTTCAAGGAAAAGAGAAGAGGG + Intronic
1128717896 15:69922060-69922082 AGTTTCTGGAATATGGAAGAGGG - Intergenic
1128763104 15:70232384-70232406 TTTTCAAGGAAAAGGGAAGCAGG - Intergenic
1129082841 15:73055703-73055725 TGTTTAGAGAATGGGGATGAAGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129989870 15:79952440-79952462 GGTTTCAGAAATTGGGAAGAGGG + Intergenic
1130555535 15:84919994-84920016 GGTTGAAGGAATAGGGAATGAGG + Intronic
1130937917 15:88485734-88485756 AATTTAAGGAATTAGGAAGATGG - Intergenic
1131076613 15:89499277-89499299 TGCTTAAAGGATAGGGAAGCCGG + Intergenic
1131871859 15:96772023-96772045 TGTTTACTGAAAAGGGAAGAAGG + Intergenic
1131955917 15:97736200-97736222 TGTTTAAGGAACAGGGAATCTGG - Intergenic
1133376544 16:5292024-5292046 TGTTTAGGGCATAGGGAAGGAGG - Intergenic
1133545571 16:6802928-6802950 TATTTATTGAAGAGGGAAGATGG + Intronic
1136562679 16:31049680-31049702 TTTGTAAGGAAGAGGGCAGACGG + Intergenic
1137310779 16:47255582-47255604 TGCTTAAGTACTAGAGAAGAAGG + Intronic
1137494035 16:48955620-48955642 TGGTTAATGAATAGGGAAATGGG + Intergenic
1138231460 16:55340030-55340052 TGATCAAGGACTAGGCAAGATGG - Intergenic
1138709362 16:58952153-58952175 AGTTAAAGGGATAGGGAAAAAGG + Intergenic
1138799238 16:60006162-60006184 TGTTTTATGTTTAGGGAAGAAGG - Intergenic
1139500938 16:67364773-67364795 AGTTTAAGAAATAAGGAAGTGGG + Intronic
1140145544 16:72303536-72303558 TATTTAAGGAACAGCAAAGAGGG + Intergenic
1140306579 16:73808464-73808486 TGTTTCAGGTATACAGAAGATGG + Intergenic
1141265557 16:82493847-82493869 GGTTGCAGGAATGGGGAAGAGGG - Intergenic
1143999684 17:11041410-11041432 TGATTAAGGGAAAGGCAAGATGG - Intergenic
1144010066 17:11139167-11139189 TGATAAAGAAATAGAGAAGAGGG + Intergenic
1144194652 17:12878693-12878715 TGCTTCAGGAATAGTGAAGGAGG + Intronic
1144279606 17:13712330-13712352 GGTTTCAGGAAGAGGAAAGAAGG + Intergenic
1144472730 17:15559129-15559151 TGTTTAAGGAACTGAAAAGAAGG - Intronic
1144923750 17:18785566-18785588 TGTTTAAGGAACTGAAAAGAAGG + Intronic
1145160284 17:20569221-20569243 TGTTTAGGGAAGTGGGAAGGTGG - Intergenic
1146972429 17:37083657-37083679 TGCTTAGGGAGGAGGGAAGAAGG + Intergenic
1147011946 17:37456916-37456938 TGTTAAAGACACAGGGAAGAAGG - Intronic
1148096303 17:45054736-45054758 TGTGTCAGGAGTAGGGAAAAGGG - Intronic
1148946852 17:51270166-51270188 TTCTTAAAGAAAAGGGAAGAAGG - Intronic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1151924592 17:77185510-77185532 TGTTTCAGGAATTGGAAGGATGG + Intronic
1152506269 17:80750774-80750796 TTTTTAAACAAGAGGGAAGAGGG - Intronic
1153147316 18:2048008-2048030 TGTGTGAGCTATAGGGAAGAGGG - Intergenic
1155015203 18:21830859-21830881 TGTTTTTGGTAAAGGGAAGAGGG - Intronic
1155845965 18:30707164-30707186 TGAGTAAGGAATTGGGAAGTAGG + Intergenic
1155930033 18:31697386-31697408 TGTTAGAGGAAGGGGGAAGAGGG + Intergenic
1156366629 18:36433793-36433815 TGTTTTAGAAATAGGTTAGAAGG + Intronic
1157015955 18:43713052-43713074 TCTTCAAGGAAGAAGGAAGAAGG + Intergenic
1157188714 18:45562450-45562472 TGTTCAATGAATAGGAGAGAGGG + Intronic
1158104151 18:53865606-53865628 AGTGTAAGGAATAGGGCAGGAGG + Intergenic
1159034203 18:63261558-63261580 TGTTGAATGAATAGGAAAAAGGG + Intronic
1159689127 18:71463623-71463645 TGTTTAAGGAATTGATTAGAAGG + Intergenic
1159857678 18:73608287-73608309 TGCTAGAGGAATAGGGATGAGGG - Intergenic
1161019847 19:2003885-2003907 TTTTTAAGGAATAGAACAGAAGG - Intronic
1161378291 19:3951086-3951108 TGCCTAAGGAGCAGGGAAGATGG - Intergenic
1161846916 19:6717017-6717039 TGTTGGAGGAACAGGGAGGATGG + Intronic
1162242873 19:9370741-9370763 TGTTTAAGGAATAATGACAAGGG + Intronic
1162428724 19:10613679-10613701 TCTTTAAGAAAAATGGAAGAGGG + Intronic
1162709137 19:12578830-12578852 AATTAAAGGAATGGGGAAGAAGG - Exonic
1162732296 19:12725732-12725754 TGCTTAAGAAATAGGAAAAAAGG - Intergenic
1163064907 19:14785604-14785626 TGTTTGGGGAATAGTGAGGAAGG - Intergenic
1163066872 19:14803461-14803483 TTTGCAAGGAAAAGGGAAGATGG + Intronic
1163137535 19:15323519-15323541 TGTGTAAAGAAAAGGGAAGAGGG - Intronic
1163216126 19:15879036-15879058 AGTTTGAGGAATAGAGAAGGGGG + Intronic
1164254709 19:23517375-23517397 TGGGTAAGGAAGAGGGATGAAGG + Intergenic
1166400518 19:42475861-42475883 TGATTAAGGGAAAGGCAAGATGG + Intergenic
1168361590 19:55745365-55745387 TGCATAAGGAACAGGTAAGAGGG - Intergenic
1168623451 19:57897532-57897554 TCTTTTGGGAAAAGGGAAGAGGG + Intronic
925887951 2:8409883-8409905 TCTTTAAGGAATAGTTTAGAAGG + Intergenic
925988310 2:9233808-9233830 TGTTTAAAGAAGAGGGGAGTGGG + Intronic
926524903 2:13967982-13968004 TGTTTAAACAATAGAGATGAAGG - Intergenic
926551119 2:14301955-14301977 TTTTTAAGGAGTTGGGGAGATGG - Intergenic
926858703 2:17285005-17285027 TGTTAATGGAATGGGGAATAGGG + Intergenic
927029957 2:19110750-19110772 GGTTTATTGAAGAGGGAAGATGG - Intergenic
928256049 2:29723431-29723453 TGTGTAAGAAATAGGGCAAAGGG - Intronic
928667218 2:33561526-33561548 TGTTTAGGGAATAAGGAAGAAGG + Intronic
928729665 2:34216498-34216520 TGTTTAAAGAATAGAAAATAGGG + Intergenic
929809180 2:45174470-45174492 AGTTTAAGGATTAGGAGAGATGG + Intergenic
931459762 2:62440529-62440551 TGTTTAACCCTTAGGGAAGAAGG + Intergenic
932135018 2:69220989-69221011 CATTTAAGGAATAGAGGAGATGG + Intronic
932516043 2:72350562-72350584 TGTTTTAGGAAAAGAGAAAAGGG - Intronic
933499942 2:83098293-83098315 TGTGAAAGGCATGGGGAAGAAGG - Intergenic
933768549 2:85728362-85728384 TGTGTAAAGAAAAGGGAAAATGG - Intergenic
934105641 2:88692137-88692159 TCTTTAAGGAGCAGGGAAGAGGG - Intronic
934220853 2:90081389-90081411 TGTTTAGGGAAGAGGGAATTGGG - Intergenic
934969167 2:98749181-98749203 TGTACAAGGAATGGGGAAGTTGG - Intergenic
936055189 2:109257303-109257325 GGCTTAAGGAAGAGGGAAGGAGG + Intronic
936951553 2:117982794-117982816 TGTTAAAGGGAAAGGGAAGATGG + Intronic
937499697 2:122464581-122464603 TGTTTATGAAAGAGTGAAGAGGG - Intergenic
938579770 2:132635521-132635543 TGTGAGAGGAATAGGGAGGAAGG + Intronic
938889594 2:135690813-135690835 TGTTAAAGGAGAAGGGAAGAGGG + Intronic
940251385 2:151680486-151680508 TTTCTAAGGAAAAGGTAAGAGGG - Intronic
940499856 2:154480656-154480678 TAATTAAGGAAAAGGCAAGATGG - Intergenic
941206112 2:162575272-162575294 TGATTGAGGAATAAGGCAGAAGG - Intronic
943279385 2:185911804-185911826 TTTTTAAGGAATAAGGAAAAGGG - Intergenic
943814587 2:192236626-192236648 GGTTTCAGGTATAGGGAAAAAGG - Intergenic
945107773 2:206332227-206332249 TGTTTATGCATTAGGGAAGTGGG + Intergenic
945384684 2:209182756-209182778 TGTTCAAGGAACAGGAAAAATGG + Intergenic
946125092 2:217555708-217555730 TGTTTTATGAAAAGGAAAGATGG + Intronic
946458098 2:219845464-219845486 TGTCTATAGAATGGGGAAGATGG + Intergenic
946702910 2:222430613-222430635 TGTTTAAGAAATAGGGAGGCTGG - Intronic
946954511 2:224914192-224914214 TATTTAAGAAATAGTAAAGATGG - Intronic
1168732020 20:92689-92711 TGTCTAAAAAAGAGGGAAGATGG - Intronic
1170369008 20:15627888-15627910 TGATTAAGGGAAAGGCAAGATGG + Intronic
1170530376 20:17285327-17285349 TGTGTAAGGAATACAGCAGAAGG + Intronic
1170816931 20:19721530-19721552 TGTTGAAGAAATAGAGAGGAGGG + Exonic
1171108342 20:22457450-22457472 TGTTAAAGCAAAAGGGAGGAAGG + Intergenic
1172723662 20:37019004-37019026 TGTGTAAGGAATTAAGAAGAAGG - Intronic
1172888282 20:38246285-38246307 TGTTTGAGGGACAGGAAAGAAGG - Intronic
1173177103 20:40772709-40772731 TGTTTAGGAAATAATGAAGATGG - Intergenic
1173912876 20:46683382-46683404 TGGTAAAAGAAAAGGGAAGATGG - Intronic
1174545061 20:51318896-51318918 TGCCTAAGGTATAAGGAAGAAGG + Intergenic
1174750882 20:53110395-53110417 TGCTAAAGGGATAGAGAAGAAGG - Intronic
1175373525 20:58509122-58509144 TGTTCCAGGCAGAGGGAAGAGGG + Intronic
1176938989 21:14900879-14900901 TTTTTAAGTCATAAGGAAGAAGG - Intergenic
1177492830 21:21849658-21849680 TTTTTGAAGAATAGAGAAGATGG - Intergenic
1177853996 21:26381645-26381667 TTTATAAGGAATAGGGTAAAAGG + Intergenic
1178279651 21:31270504-31270526 TGTTTAGGGACTAGGTAGGAGGG + Intronic
1178722842 21:35025525-35025547 TGTTTAATTCTTAGGGAAGAAGG - Intronic
1179451722 21:41472808-41472830 TGTTTAAGGAAAAGGGGAGGGGG + Intronic
1180867771 22:19129237-19129259 TGTTTAGGGGAGAGGGAGGAAGG - Intergenic
1181901921 22:26163204-26163226 TGTGTCAGGAGGAGGGAAGAAGG - Intergenic
950000492 3:9652451-9652473 TGGCTAAAGAATGGGGAAGAGGG + Intronic
950041545 3:9922871-9922893 TGTTTAAGAAATAGTAAGGAGGG + Intronic
950552397 3:13674756-13674778 TGTTTACAGAATAGTGAGGAGGG + Intergenic
951694811 3:25434960-25434982 GGTTTAAGAGAAAGGGAAGAAGG - Intronic
951979391 3:28548823-28548845 TTTTTAAGGAATAAAGAATAGGG - Intergenic
952159315 3:30677928-30677950 ATTTTAAGGTATAAGGAAGAGGG + Intronic
952692122 3:36221423-36221445 AGTTCAAAGGATAGGGAAGATGG + Intergenic
954075389 3:48174906-48174928 TGGTTAAGGTATAGTTAAGATGG + Intronic
955154491 3:56403151-56403173 TCTATAAGGAATACAGAAGAAGG - Intronic
955271138 3:57500505-57500527 TAGTTAAAGAATAGGGAACAGGG - Intronic
956024835 3:64972149-64972171 TGTTGAAAGAGTAGGGAAAATGG - Intergenic
956706276 3:72001881-72001903 TGGTAAAGGAATAGGCAACATGG + Intergenic
956868450 3:73392220-73392242 TGTTCAAGGAAGAGAGAAGTGGG + Intronic
957382681 3:79453328-79453350 TATGTAAGGAAAATGGAAGAAGG - Intronic
957434696 3:80159575-80159597 TCTTTCTGGAATACGGAAGATGG + Intergenic
958733254 3:97980456-97980478 TGTTGTAGGAATAAGGAATAAGG - Intergenic
958805859 3:98809332-98809354 GTTTTAAGGAATAAAGAAGATGG - Intronic
958963305 3:100531643-100531665 GGGTTAAGGAAGAGAGAAGATGG + Intronic
960357188 3:116668034-116668056 AGGGTAAGGAATAAGGAAGAGGG - Intronic
960621861 3:119645060-119645082 TGTTTAAGCAATAGAGAGAAAGG - Intronic
961287595 3:125818920-125818942 TGTTTAGGGCATAGGGAAGGAGG - Intergenic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
961852274 3:129832773-129832795 TGCTTAAGGAAGAGTGATGAAGG - Exonic
961928763 3:130511461-130511483 TGTTTAGGGAAGTGGGAAGGTGG - Intergenic
962596532 3:136951686-136951708 TGTCTAAAGAACAGAGAAGATGG + Intronic
962936103 3:140082274-140082296 TATTCAAGGAATAGGAGAGAAGG - Intronic
965923321 3:173946029-173946051 TCTCTAAGGAAAAGGGCAGATGG - Intronic
965991599 3:174825659-174825681 TGTTTAAGGAATAGGGAAGAAGG - Intronic
966331747 3:178822382-178822404 TGTTATGGGAATAGAGAAGAGGG - Intronic
967089086 3:186119732-186119754 AGTTTAACTAATAGGGAGGAAGG - Intronic
968643673 4:1727957-1727979 TGTCTAAGGAATAGGAACTAAGG - Exonic
969743895 4:9054660-9054682 TGTTTAGGGCATAGGGACGGAGG - Intergenic
969803310 4:9586779-9586801 TGTTTAGGGCATAGGGAAGGAGG - Intergenic
970013603 4:11487822-11487844 TGGTCAGGGAATAGGAAAGAAGG - Intergenic
970694828 4:18664748-18664770 TGTTTATGGAAGGGGAAAGAGGG - Intergenic
972754617 4:42032649-42032671 AGATCAAGGAAGAGGGAAGAGGG + Intronic
973959576 4:56096409-56096431 TGTTTCAGGAATAGAGGATATGG + Intergenic
974570306 4:63637771-63637793 TGATTTAGGAGTAAGGAAGAAGG - Intergenic
974712757 4:65622391-65622413 TGTTCAAGGCATAGGCAACATGG + Intronic
974767856 4:66371314-66371336 TGTTTCAGGGAAAGGGAACATGG + Intergenic
974888841 4:67853725-67853747 TGGATAAGGAAGAGGGAAGAAGG + Intronic
975924123 4:79428301-79428323 TGTTTGAAGGAAAGGGAAGAAGG - Intergenic
976063935 4:81162156-81162178 TGTTTGAGGACTAGTTAAGACGG + Intronic
977174887 4:93807951-93807973 TGCTTAAGGAACAGAGATGAGGG - Intergenic
977922190 4:102658033-102658055 TGGTTGTTGAATAGGGAAGAAGG - Intronic
978191452 4:105917407-105917429 TGTTAAAAGAATACAGAAGAAGG - Intronic
978447811 4:108797362-108797384 TCTTTGAGGAATAATGAAGAGGG + Intergenic
978686311 4:111448491-111448513 ATTTAAAGGAATAGGGAGGATGG + Intergenic
979068072 4:116164968-116164990 TGTATAAGGTGTAAGGAAGAGGG + Intergenic
979360508 4:119758642-119758664 TTTTAATGGAATGGGGAAGATGG - Intergenic
979361922 4:119775089-119775111 TTTGGAAGGAAAAGGGAAGATGG + Intergenic
979699618 4:123653322-123653344 TGTTCCAGGAAAAGGAAAGAAGG - Intergenic
979955444 4:126948421-126948443 TATTTGAGGAAAAAGGAAGAAGG + Intergenic
980207706 4:129742763-129742785 TGTTCTAGGCATAGGGAAGAGGG + Intergenic
981168422 4:141591041-141591063 GTTTTAAGGAAAAGGTAAGAGGG - Intergenic
982102634 4:151983151-151983173 TTTTAAAGTAATAGGAAAGAGGG + Intergenic
982773393 4:159418857-159418879 TTTGTAAGGAATAGAGCAGAGGG - Intergenic
982883181 4:160745397-160745419 CGCTTAAGGAATATGGAACATGG - Intergenic
983749207 4:171243661-171243683 TGTTTAAGGAAAAGAGGAAATGG - Intergenic
983783732 4:171705724-171705746 TGATCAAGGAAGAGTGAAGAGGG + Intergenic
983909810 4:173225315-173225337 TGTTTAAGGAAATGGGAAAAGGG + Intronic
984165094 4:176296617-176296639 AGGGTGAGGAATAGGGAAGAAGG + Intergenic
984752328 4:183289816-183289838 TGTTGAAGGAACAAGGAAGCTGG + Intronic
986764232 5:10909470-10909492 TGTTAAAGAAATGGGAAAGAGGG + Intergenic
987700202 5:21388114-21388136 TGTTTCAGGAACAGGGAAATGGG + Intergenic
987909090 5:24118191-24118213 TGGTTAAGGAATGGGGAAAGAGG - Intronic
988620789 5:32821524-32821546 AATTTAAGTAACAGGGAAGAGGG + Intergenic
988834339 5:35016566-35016588 TGTTAAGGGAAAGGGGAAGAGGG - Intronic
989551544 5:42741303-42741325 TGTTTAAGGGAGAGAGAAAAGGG - Intergenic
990006799 5:50953760-50953782 TGCTTGAGGAATGGGGAAAATGG - Intergenic
991860792 5:71011314-71011336 TGTTTAGGAAATTGGGAAGAAGG - Exonic
992615536 5:78543052-78543074 TGTTAAAGGAATAGGCAGCATGG + Intronic
992743150 5:79793958-79793980 TGGGTAAGAGATAGGGAAGAGGG + Intronic
993557861 5:89364244-89364266 TATATAAGGAATGGGGACGAAGG + Intergenic
994321269 5:98397956-98397978 TGTATTAGGAATTTGGAAGAGGG + Intergenic
994810460 5:104511532-104511554 TGTGAAAGGAATGGGGAAAAAGG + Intergenic
995119305 5:108519085-108519107 TTGATAAGGAAAAGGGAAGATGG - Intergenic
995356447 5:111242855-111242877 TGTTTACAAAATATGGAAGAGGG - Intronic
995604361 5:113835453-113835475 TATTTCAGGAAAAAGGAAGAGGG + Intergenic
996269500 5:121585578-121585600 TCTTTCAAGAAAAGGGAAGAAGG - Intergenic
996873135 5:128214218-128214240 AATTTAAGAAATGGGGAAGAAGG + Intergenic
997711884 5:136011998-136012020 TCTCTAAGGAATAGGGGAGAGGG + Intergenic
998816304 5:146017564-146017586 GGCTTAAGGAGTAGGGATGAAGG - Intronic
998842649 5:146272367-146272389 TGTTTGAGGAATAGGGAACCTGG - Intronic
998888252 5:146717848-146717870 TGGCTAAGGAAAAGGGAGGACGG - Intronic
1000876247 5:166641896-166641918 TGTTTAAGAAATATAGAAAAGGG - Intergenic
1000986518 5:167866608-167866630 TGTTTAGAGCATAGGGAAGGAGG + Intronic
1005262579 6:24077732-24077754 TGATTACAGAACAGGGAAGAGGG - Intergenic
1006903754 6:37519458-37519480 AATTCCAGGAATAGGGAAGAAGG + Intergenic
1007019755 6:38507696-38507718 CGTTTCAGGAAAAGAGAAGAGGG - Intronic
1007297291 6:40834536-40834558 TGTTGAGGAAATGGGGAAGAAGG + Intergenic
1009588326 6:65635399-65635421 TGTTGAAGGGAAAGGCAAGATGG - Intronic
1009809397 6:68640627-68640649 TGGTTGAGGAAAAGGAAAGAGGG - Intronic
1010058804 6:71598019-71598041 TCCTTCAGGAATAAGGAAGATGG + Intergenic
1010407562 6:75522282-75522304 TATTATAGGAAAAGGGAAGATGG - Intergenic
1011896256 6:92229713-92229735 TGTTTAAGGACAAGAGCAGATGG - Intergenic
1012993658 6:105951259-105951281 TCTTTAAGAAATAAGGAATAAGG + Intergenic
1014469015 6:121792026-121792048 TTTTTAAAGCATAGAGAAGAAGG - Intergenic
1015685319 6:135852422-135852444 GGTTTGTGGAACAGGGAAGAAGG + Intronic
1015909948 6:138160850-138160872 TGTTTAGGAAATTGGGAGGATGG - Intergenic
1016675261 6:146757965-146757987 TGTTTAAGTCACAGGGAAGTGGG + Intronic
1016870867 6:148815181-148815203 TCTTTAAAGAAAAGGAAAGAGGG + Intronic
1018139734 6:160818591-160818613 TGTTTAAGAAAGAAGGAAAAGGG - Intergenic
1019972829 7:4555638-4555660 TGTATAAGGTGTAAGGAAGAGGG + Intergenic
1020343540 7:7138531-7138553 TGTTTGAGGAATAGCACAGAAGG + Intergenic
1020464235 7:8458490-8458512 TTCTTAAGGAATAAGGATGAGGG - Intronic
1022203456 7:28139931-28139953 TATTTGGGGAACAGGGAAGAAGG + Intronic
1022301271 7:29104765-29104787 TTTATAAGGAATAGGGAAGTGGG + Intronic
1022335301 7:29416114-29416136 TGTTTAAGGAAAATGGCAGAGGG - Intronic
1023771486 7:43560595-43560617 TATTTTGGGAATAAGGAAGATGG - Intronic
1023771645 7:43561987-43562009 TGATTAAGGGAAAGGGAAAAGGG - Exonic
1027445058 7:78264167-78264189 TTTGTAAGGATTAGGTAAGATGG - Intronic
1027867624 7:83667503-83667525 TATTTAAAGAATAGGGCAAATGG - Intergenic
1028484246 7:91340846-91340868 CTTTTAAGGATTTGGGAAGAGGG + Intergenic
1028652324 7:93163604-93163626 TGTTTCAGAAAAAGTGAAGAAGG + Intergenic
1028804875 7:95013378-95013400 TATTTAAGGAATATGAATGAAGG - Intronic
1029069438 7:97883231-97883253 TGTCTAGGGCATAGGGAAGGAGG + Intergenic
1029191613 7:98776078-98776100 TGTTTGATGAAGGGGGAAGAGGG + Intergenic
1031098009 7:117443915-117443937 TGTTTAAGGAAAAGAGAAAGAGG - Intergenic
1031282716 7:119824202-119824224 ATTTTAAGGAATGAGGAAGAGGG + Intergenic
1031539939 7:122982722-122982744 TGTTGAAGGAATGGGGGAAATGG - Intergenic
1031632226 7:124057636-124057658 TGTTTCAGGGACAGGGAAGGTGG - Intergenic
1031850217 7:126854173-126854195 TGTTTAGGGAACAGGGACAAAGG - Intronic
1031926904 7:127647644-127647666 TGACTAAGGAATGGGAAAGAAGG + Intergenic
1032725548 7:134587225-134587247 TTTTAAAGGAATAGGGTACACGG - Intergenic
1033823925 7:145166168-145166190 TGTCTCAGGAGCAGGGAAGACGG - Intergenic
1036251682 8:7167894-7167916 TGTTTAGGGCATAGGGAAGGAGG + Intergenic
1036365807 8:8119566-8119588 TGTTTAGGGCATAGGGAAGGAGG - Intergenic
1036885136 8:12546543-12546565 TGTTTAGGTCATAGGGAAGGAGG + Intergenic
1037043270 8:14264270-14264292 TGTTTAAGGAAAGGAGAAGGAGG + Intronic
1037208508 8:16355547-16355569 TGTGAAAGGAAAGGGGAAGAAGG + Intronic
1037280389 8:17234870-17234892 GGTTAAAAGAATAGAGAAGAGGG + Intronic
1037460987 8:19109435-19109457 TGTGGAAGGAATATGGAGGATGG - Intergenic
1038783167 8:30586132-30586154 TGTTAAAGGAAAAGGGAGGAAGG - Intronic
1039033351 8:33332891-33332913 TGTGGATGGAATAGGGAAGAGGG - Intergenic
1039272650 8:35899741-35899763 TGTTTTGGGAATAGAGAGGAAGG + Intergenic
1039919032 8:41880362-41880384 TGTTAATGGAACACGGAAGAGGG + Intronic
1040802307 8:51356755-51356777 CTTTTAAGGAAAAGGGAAAAGGG - Intronic
1041301355 8:56415193-56415215 TCTTAAAAGAATAGGAAAGAAGG - Intergenic
1041601075 8:59717902-59717924 TTGGCAAGGAATAGGGAAGATGG - Intergenic
1043184261 8:77125729-77125751 TGTTTCAGGGAATGGGAAGAAGG - Intergenic
1043309871 8:78844738-78844760 TATTTAATGAATGGGCAAGAAGG + Intergenic
1044070549 8:87755099-87755121 GGCTTAAGGAATTGGGTAGAGGG - Intergenic
1044937126 8:97303877-97303899 TGTATAAAGAATAGGGAGGGAGG + Intergenic
1045457613 8:102397238-102397260 TATATAAGTGATAGGGAAGAAGG - Intronic
1045733374 8:105267220-105267242 TGTGGAAAGAAGAGGGAAGAGGG - Intronic
1045834781 8:106507111-106507133 TATTCAAGGAATAGTGAAAAAGG + Intronic
1046222223 8:111231348-111231370 TGTTTAAGAAAGAGGGATGTTGG + Intergenic
1046334578 8:112768373-112768395 TGTTTAAGCAATAGGGAAAAAGG - Intronic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047271049 8:123359098-123359120 TGTATAATGAAAAGGGAAAAGGG + Intronic
1048142103 8:131804604-131804626 TGTTTTAGGGATAGAGAAGAGGG - Intergenic
1048556645 8:135484323-135484345 TGTTTAACTCTTAGGGAAGAAGG - Intronic
1049012345 8:139895486-139895508 TGGAGAAGGAAAAGGGAAGATGG + Intronic
1050046330 9:1550220-1550242 TGGTTAAGGAAGTGGGAGGAAGG + Intergenic
1051621187 9:19050735-19050757 TGTTTAAAGACTGGGGAAGCGGG - Exonic
1051685526 9:19654514-19654536 TATCTAAGGGAGAGGGAAGATGG - Intronic
1052540527 9:29805531-29805553 TGTTTAAGGAATAATGACAAGGG + Intergenic
1053728262 9:41026263-41026285 TGCTAAAGGAAAAGGGAACATGG + Intergenic
1054700246 9:68405823-68405845 TGCTAAAGGAAAAGGGAACATGG - Intronic
1055651134 9:78408259-78408281 TGTTTAAATAAAAGGGTAGAGGG - Intergenic
1056009054 9:82306286-82306308 CTCTTAAGCAATAGGGAAGATGG + Intergenic
1056237508 9:84609836-84609858 TATTTATGGAAAAGGGAACATGG + Intergenic
1057093953 9:92287643-92287665 CGTTTAAGTAATAGGGTTGAAGG + Intronic
1058185327 9:101848128-101848150 TCCTTAAGGAATATGGAATAAGG - Intergenic
1058594846 9:106604684-106604706 GGTATAAGAAATAGGGAGGAGGG + Intergenic
1059178757 9:112192212-112192234 AGTTTTAGGAATACGGAAAAAGG + Intergenic
1059877680 9:118653750-118653772 TGTTTAGGGAGTAAGGAAAAAGG - Intergenic
1060153999 9:121306260-121306282 TATCTAAGGAATAGGAGAGAGGG - Intronic
1060342579 9:122790017-122790039 TGTTTAAGGGACAGTAAAGAGGG + Intergenic
1060906408 9:127310825-127310847 TGTTGACAGTATAGGGAAGATGG + Intronic
1061144924 9:128791953-128791975 TCTTCAAGGAACAGGGATGAGGG - Intronic
1061636568 9:131914088-131914110 TGTTCAAGGATGAGGGCAGAGGG + Intronic
1185796579 X:2970498-2970520 TGTGCAAGGAATATGGAAAATGG - Intergenic
1186036071 X:5424938-5424960 TATTTAAGGGAAAGGCAAGATGG - Intergenic
1186063833 X:5740158-5740180 TTAATAAGGAAAAGGGAAGATGG + Intergenic
1186491610 X:9977926-9977948 TGTTTAAGGGCAGGGGAAGAAGG + Intergenic
1186947967 X:14590491-14590513 TTTTTATGGCATAGGGAATAAGG + Intronic
1187343321 X:18440989-18441011 TGTTAGAGGAAGAGGGAAGAGGG + Intronic
1190006909 X:46749052-46749074 TGTTTAAGGAAGGAGGATGAAGG - Intronic
1190138188 X:47816349-47816371 TAATTAAGGAAAAGGCAAGAGGG - Intergenic
1190401589 X:50041307-50041329 TCTTTAAGAAATAGGGAGGGTGG + Intronic
1193407477 X:81120584-81120606 TGTTTTAGGAATAAGGAAGGCGG + Intronic
1194523795 X:94950902-94950924 TAATTAAGGAAAAGGCAAGATGG + Intergenic
1194941824 X:100019537-100019559 TGATTAGGGGAAAGGGAAGAAGG - Intergenic
1196189597 X:112780798-112780820 TGCTTAAGGAAAAGGGATGATGG - Intronic
1196631400 X:117944235-117944257 TGTGTAGGGAAAAGGGAAGATGG - Intronic
1196664152 X:118298691-118298713 TCTTTCAGGAAACGGGAAGAAGG - Intergenic
1199544764 X:148996165-148996187 TGTTTATGAAATTGGGAGGAAGG + Exonic
1200969180 Y:9131896-9131918 TGTTTTGGGAATGGGAAAGAAGG + Intergenic
1202141649 Y:21730602-21730624 TGTTTTGGGAATGGGAAAGAAGG - Intergenic
1202145216 Y:21773200-21773222 TGTTTTGGGAATGGGAAAGAAGG + Intergenic