ID: 965994478

View in Genome Browser
Species Human (GRCh38)
Location 3:174862938-174862960
Sequence CCAAGTACAGAGGAGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965994470_965994478 23 Left 965994470 3:174862892-174862914 CCTACTCTGAAGGCTACAAAACA 0: 1
1: 0
2: 2
3: 22
4: 188
Right 965994478 3:174862938-174862960 CCAAGTACAGAGGAGTTGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 175
965994469_965994478 24 Left 965994469 3:174862891-174862913 CCCTACTCTGAAGGCTACAAAAC 0: 1
1: 0
2: 2
3: 15
4: 189
Right 965994478 3:174862938-174862960 CCAAGTACAGAGGAGTTGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965994478 Original CRISPR CCAAGTACAGAGGAGTTGGC TGG Intronic
902601177 1:17540719-17540741 CCAAGTAGAGAGGTGGTGGCTGG + Intronic
905298579 1:36970692-36970714 CTATGTACAGTGGAGTGGGCTGG - Intronic
907855109 1:58295674-58295696 CCCAGTACAGAGGACATGCCTGG + Intronic
908146172 1:61247090-61247112 CCAAGTACATGGCAGATGGCTGG - Intronic
908774276 1:67625421-67625443 CCAAGTGCAGAGGAGTGGGGTGG + Intergenic
908891949 1:68858757-68858779 CCAAGTACATGGGAGCTGGGTGG - Intergenic
909531076 1:76682281-76682303 GCAAGAAGAGAGGAGTTGCCTGG - Intergenic
911156461 1:94642169-94642191 CCACCTGCAGAGGCGTTGGCTGG - Intergenic
916368450 1:164061253-164061275 CCAAGGACACTGGAGCTGGCAGG + Intergenic
917702707 1:177597284-177597306 GCAAGAACAGGGGAGTAGGCAGG + Intergenic
920340447 1:205272249-205272271 GCAAGTACAGAGAAGGGGGCAGG - Exonic
920661092 1:207915150-207915172 AAAAGTACAGAGGAGTAGGTTGG + Intergenic
920963183 1:210681855-210681877 CCAGGCACAGTGGAGCTGGCCGG - Exonic
921814702 1:219550229-219550251 CCAAGTTATGAGGAGATGGCTGG - Intergenic
922424257 1:225478891-225478913 CCAAAAAGAGAGGAGATGGCAGG + Intergenic
922697406 1:227737703-227737725 CCAAGGTCTGAGGAGTTGGAGGG + Intronic
923082325 1:230670026-230670048 AAAAATACAGAGGAGTTTGCTGG + Intronic
923082827 1:230675526-230675548 GCAAGTACAAAGGAATTGGTTGG + Intronic
923431674 1:233928076-233928098 CCAAGAACAGGGAAGTTGGAAGG - Intronic
1065225067 10:23535197-23535219 CCCAACTCAGAGGAGTTGGCCGG + Intergenic
1071879437 10:89879313-89879335 CCTTGTACACAGGAGTTGGTGGG - Intergenic
1072453659 10:95558862-95558884 CTAAGAACAGTGGAGTTGTCAGG + Intronic
1074107465 10:110399059-110399081 CCAATAAGAGAGGAGGTGGCAGG - Intergenic
1075467914 10:122665181-122665203 CCAAGGACAGAGGACTTGCCAGG + Intergenic
1075903703 10:126063303-126063325 CCAAGTACAGAGGACATCGCTGG + Intronic
1076296401 10:129388633-129388655 CCAAGTAACTAGGAGTGGGCTGG - Intergenic
1077103599 11:832727-832749 CCAAGGACGGAGGAGCTGGGCGG - Intergenic
1077216433 11:1397092-1397114 CCCTGCACAGAGGAGGTGGCAGG - Intronic
1080224911 11:29949809-29949831 CCAAGGACACTTGAGTTGGCAGG + Intergenic
1083285823 11:61658184-61658206 CCAAGGCCAGAGGAGATGGCAGG + Intergenic
1083624619 11:64065880-64065902 CCCAGTGCAGAGTGGTTGGCAGG + Intronic
1083672633 11:64307513-64307535 CAAAGGACAGGGGAGTGGGCTGG - Intronic
1087221078 11:95547008-95547030 GCAATGACAGTGGAGTTGGCTGG - Intergenic
1089631571 11:119787584-119787606 ACAAGGACAAAGGAGCTGGCAGG - Intergenic
1090207568 11:124894317-124894339 CCAACTACAGTCCAGTTGGCTGG + Exonic
1090485427 11:127108314-127108336 GCAAGAACTGAGGAGTTGCCCGG - Intergenic
1092262098 12:6958327-6958349 CCAAATACAGAGGAGGAGCCCGG + Intronic
1095557409 12:43523626-43523648 CCAAGTGCACAGGAGCTGGGTGG + Intronic
1096677615 12:53233972-53233994 CCAAGTACAGATGTGCTGGAAGG - Intergenic
1100012444 12:89969777-89969799 CAAAGTAGAGATGATTTGGCGGG + Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101933934 12:109040528-109040550 CCAAGAGCAGCTGAGTTGGCTGG + Intronic
1104141414 12:125989856-125989878 CCAATTCCAGAGGAATTAGCTGG + Intergenic
1105289209 13:19036757-19036779 CCAAGAATATAGGAGATGGCCGG - Intergenic
1107865944 13:44703439-44703461 CCAAGTCCACAGGATTTGCCTGG + Intergenic
1110405410 13:75145003-75145025 CCTAGGACTGAGGAGTTGTCTGG - Intergenic
1112735865 13:102415983-102416005 ACAAGTTCAGATGAGTTTGCTGG - Intergenic
1114327108 14:21600585-21600607 CCACTTATAGAGGAGATGGCTGG - Intergenic
1115010277 14:28537493-28537515 CCACATACATATGAGTTGGCTGG - Intergenic
1115901408 14:38153092-38153114 CCAAGTAGAGAAGAGATGGGAGG - Intergenic
1119416832 14:74476627-74476649 CCCAGTCGAGAGGAGCTGGCCGG + Intronic
1119487321 14:74998703-74998725 CCAAGTGCAGTGGATTTGCCAGG - Intergenic
1119729668 14:76943016-76943038 GGAAGTACAGAGCAGTTGGAAGG - Intergenic
1120721875 14:87898206-87898228 GCATGTACAGAGGAGCTGGAAGG - Intronic
1120780673 14:88482855-88482877 GCAAAGACAGAGGAGTGGGCGGG + Intronic
1121557314 14:94848192-94848214 TCTAGTTCAGAGGAGTGGGCAGG + Intergenic
1121676059 14:95753956-95753978 TCAAGTTCAGAAGAGTTGGCTGG + Intergenic
1122060909 14:99136170-99136192 CCAAGTCCAGAGGGGCCGGCTGG + Intergenic
1124637375 15:31373726-31373748 CCATCTGCAGAGGAGTTTGCTGG - Exonic
1124662157 15:31558574-31558596 CCAAGTCCACAGGAAGTGGCGGG + Intronic
1125883677 15:43213221-43213243 CCAAGCAGAGAGGAGGAGGCTGG - Intronic
1126016521 15:44356597-44356619 CCAGGTACAGATGGGTTTGCCGG + Intronic
1126061042 15:44782858-44782880 GCAAGTGGAGAGGAGTTTGCTGG - Intergenic
1126385064 15:48085801-48085823 CCAAATGCAAAGGAATTGGCAGG + Intergenic
1127273737 15:57424095-57424117 CTAAGGGCAGAGGAGTGGGCAGG - Intronic
1128070322 15:64791751-64791773 CTAATTACAGAGAAGTTGACAGG + Intergenic
1128766414 15:70253680-70253702 CCAAGCACTCAGGAGTTAGCCGG + Intergenic
1129410010 15:75345318-75345340 CAAAGTACAGAGCAGTGGCCAGG + Intergenic
1133211561 16:4266045-4266067 CCAAGAGCAGAGGAGTTGGTGGG - Intronic
1133899354 16:9958932-9958954 ATAAATACAGAGGAGTTGGTAGG + Intronic
1137711304 16:50568717-50568739 CCATGTACAGAGGTGCTGACTGG - Intronic
1139009299 16:62612733-62612755 AATAGTACAGAGGAATTGGCAGG - Intergenic
1139297748 16:65917968-65917990 CCAAGTAAAGAGGAGGAGGCAGG + Intergenic
1139335543 16:66228397-66228419 AGAAGAACAGAGGAGCTGGCTGG - Intergenic
1139445209 16:66993803-66993825 ACAAGAACAGAGGCGTAGGCCGG + Intronic
1140470002 16:75208572-75208594 CTGAGGACAGAGGGGTTGGCGGG + Intergenic
1141506817 16:84483405-84483427 CCATGTTCTGAGGACTTGGCCGG + Intronic
1142389831 16:89792034-89792056 CTGAGTGCAGAGGAGTTGGTTGG - Exonic
1143001856 17:3799607-3799629 CCCAGTACAGAGGAGGTGACTGG - Intronic
1143650990 17:8264280-8264302 CCAGGTCCACAGGGGTTGGCAGG - Exonic
1143775881 17:9198485-9198507 CCAAGTATAGCAGAGGTGGCTGG - Intronic
1143888973 17:10087867-10087889 CCAAGAGCAGAGGAGTCAGCAGG + Intronic
1146365259 17:32219653-32219675 CCAAGTCCAGACGTGTTGGTTGG + Intronic
1147438467 17:40432151-40432173 CCAAGAAGAGAGGAGTAGGAGGG + Intergenic
1148615628 17:48997998-48998020 CCGGGAAGAGAGGAGTTGGCGGG - Intronic
1151589842 17:75035957-75035979 CCAAGCACAGAGTAGTGGGGTGG - Intronic
1153540647 18:6150656-6150678 ACTAGTACAGGGGAGTTGGAGGG - Intronic
1156288241 18:35721275-35721297 CCATGGACATATGAGTTGGCAGG + Intergenic
1162579659 19:11521090-11521112 CCAAAAACAGTGGAATTGGCCGG - Intronic
1163441590 19:17324774-17324796 CCGGGTTCAGAGGAGTGGGCCGG - Exonic
1164071086 19:21768820-21768842 CCCAGTACAGATAAGTTGCCAGG - Intergenic
1164884271 19:31764246-31764268 CCAAATGCAGAGGTGTTGGAAGG + Intergenic
926712312 2:15891273-15891295 CCATGTGCAGAGGAGGGGGCAGG + Intergenic
928202370 2:29256459-29256481 TCAAGTTCAGAGGAGTTGAGTGG + Intronic
929337917 2:40773446-40773468 CCAAGTACAGAATAGATGGGAGG + Intergenic
929594633 2:43168557-43168579 CCAAGTGCAGAGGGGATGGAGGG + Intergenic
930106309 2:47642668-47642690 CAAAGAAGAGAGGAGTCGGCTGG - Intergenic
932510567 2:72284012-72284034 CCAAGTACAGATGGGTTCACTGG + Intronic
935720488 2:105974838-105974860 TCAGGTACAGAGGAGGTGGGAGG - Intergenic
935728498 2:106045165-106045187 GGAAGTACAGTGGAGATGGCGGG - Intergenic
936165880 2:110119077-110119099 GCAAGTACAGAACAGTTGCCCGG + Intergenic
937719413 2:125076315-125076337 CCAAGTAAAGAGGAGGTGAGAGG - Intergenic
941702161 2:168614978-168615000 CCAGCTCCAGAGGAGGTGGCAGG - Intronic
942222817 2:173788030-173788052 CCAATTACGGGGGAGTTGGCAGG + Intergenic
943386306 2:187207735-187207757 CCATGGACACACGAGTTGGCAGG + Intergenic
943446593 2:187994621-187994643 CCAAGTGCATAGGAGCTGGGTGG + Intergenic
944842395 2:203636865-203636887 CCAAGTGCCTAGGAGGTGGCTGG + Intergenic
946874048 2:224110559-224110581 CCAAGTGCATAGGAGCTGGTGGG + Intergenic
946970768 2:225088523-225088545 CCAAGTATAGAAGCGTTGGTGGG - Intergenic
948127155 2:235572596-235572618 CCAGGTGCAGAGAAGTGGGCAGG - Intronic
948287182 2:236795042-236795064 CCAAGTATGGAGGAGATGGGTGG - Intergenic
948589454 2:239039815-239039837 CCCAGGGCAGAGGAGTTGGGAGG + Intergenic
948690936 2:239704751-239704773 TCAAGTTTAGAGGGGTTGGCAGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1173850709 20:46216173-46216195 CCTGGGACAGAGGGGTTGGCTGG + Intronic
1175975021 20:62706569-62706591 CCAAGTACAGAGGTTTGGGCGGG - Intergenic
1176310120 21:5145019-5145041 CCAAGGGCAGCGGAGTTGGAGGG - Intronic
1177198163 21:17924478-17924500 CCCAGGGAAGAGGAGTTGGCAGG - Intronic
1177655375 21:24010405-24010427 CCATGTTCATAGGTGTTGGCTGG - Intergenic
1179846936 21:44117017-44117039 CCAAGGGCAGCGGAGTTGGAGGG + Intronic
1180695923 22:17751613-17751635 CCAGGCAGAGAGGAGGTGGCAGG + Intronic
1180796571 22:18608694-18608716 CCAAGATCAGGGGATTTGGCAGG + Exonic
1181098172 22:20520465-20520487 CCTACTACAGAGCACTTGGCAGG - Intronic
1181225152 22:21386577-21386599 CCAAGATCAGGGGATTTGGCAGG - Exonic
1181253480 22:21548236-21548258 CCAAGATCAGGGGATTTGGCAGG + Exonic
1183169616 22:36177347-36177369 CCAGCTACAATGGAGTTGGCTGG - Intergenic
1184524382 22:45013135-45013157 CCCAGTACAGAGGAAGTGGGAGG + Intergenic
950463327 3:13138571-13138593 CCAAGTACAGCGAAGCTGCCGGG - Intergenic
950485159 3:13269038-13269060 GCAAGAACAGAGGTGTGGGCTGG + Intergenic
952697922 3:36291676-36291698 ACAAGTACAGAGAAGTGGGTAGG + Intergenic
953384592 3:42499460-42499482 CCAAGGACACGGGAGGTGGCGGG - Intronic
955821577 3:62901531-62901553 CAAAGTACAGAGAAGATGGTGGG - Intergenic
955956088 3:64291724-64291746 CCAGTGAAAGAGGAGTTGGCTGG - Intronic
956974764 3:74566669-74566691 CCAAGTAAAGATGAGTTTACTGG - Intergenic
958637997 3:96770118-96770140 CCAAGTACAGATGACTTTGCTGG + Intergenic
959295581 3:104530794-104530816 CCATGGACACTGGAGTTGGCAGG + Intergenic
961486037 3:127217151-127217173 GCAAGTACAGAGTAGATGGAGGG - Intergenic
962204435 3:133423511-133423533 CAAAGTACGGAAAAGTTGGCTGG - Intronic
965244630 3:166250662-166250684 CCAAGTACAGATGAGTTTGCAGG + Intergenic
965994478 3:174862938-174862960 CCAAGTACAGAGGAGTTGGCTGG + Intronic
967304021 3:188043358-188043380 CCAAGTACAGAGGATGTGGAAGG - Intergenic
971722015 4:30256564-30256586 CCAAGTGCATAGGAGCTGGAAGG - Intergenic
972329448 4:38051054-38051076 CCAACAACAGAGGAGTGGGCAGG - Intronic
977540436 4:98312438-98312460 CCAAATACAGAGGATTTGTTAGG - Intronic
981049048 4:140293092-140293114 ACACGTACAGTGGAGTTTGCTGG - Intronic
981734116 4:147931624-147931646 CCAAATACAGAGGTATTGCCTGG - Intronic
982629866 4:157819126-157819148 CCAGGGACACTGGAGTTGGCCGG + Intergenic
983567063 4:169164495-169164517 CCAAGTACACAGCAGGTGGTGGG + Intronic
983866792 4:172776724-172776746 CCAAGCACAGTTGAGTTTGCAGG - Intronic
985491579 5:182787-182809 CCAAGTCAGCAGGAGTTGGCAGG + Exonic
986124949 5:4876045-4876067 CCAGGTACATATGAGGTGGCTGG - Intergenic
987153605 5:15065043-15065065 ACACATACAGAGGAGTTTGCAGG - Intergenic
987257261 5:16168808-16168830 TCAAGAACAGAGGATTTGCCAGG - Intronic
988635942 5:32985051-32985073 GCAAGTCAAGATGAGTTGGCAGG - Intergenic
991488155 5:67159474-67159496 CCAAGTGAAGGGGAGTTGGGGGG - Intronic
995500750 5:112804314-112804336 CCAGGTACATATTAGTTGGCTGG - Intronic
995545458 5:113225677-113225699 CCAGGAACAGAGGAGGTGCCTGG - Intronic
996215812 5:120864078-120864100 CCAAGTTCAGAGAAGGTGGCTGG - Intergenic
997809693 5:136955091-136955113 CCATGAACAGAGGAGTTCTCTGG + Intergenic
998458193 5:142290046-142290068 CCAAGGACAGAGGAGCTAGAAGG - Intergenic
1000020859 5:157318331-157318353 CCAAATACAGAGGAGTGGGCAGG - Intronic
1004890909 6:20099507-20099529 AGAAGAACAGAGGAGTTAGCAGG - Intergenic
1005844727 6:29768506-29768528 ACAAAGACAGTGGAGTTGGCTGG + Intergenic
1005862673 6:29913442-29913464 ACAAAGACAGTGGAGTTGGCTGG + Intergenic
1005874160 6:29998644-29998666 ACAAAGACAGAGGAGTTGGGTGG + Intergenic
1006380465 6:33694406-33694428 CCCAGGACAGAGGAGTCGGGGGG - Intronic
1012416154 6:99016330-99016352 CCAAATACAGAGGAGTTATTTGG + Intergenic
1014997523 6:128168718-128168740 CCATGGACTGAGGAGGTGGCAGG - Intronic
1015374785 6:132497968-132497990 CCCAGTAGACTGGAGTTGGCAGG - Intronic
1016877715 6:148880547-148880569 CCAAGTACACAGGAGTTAGTTGG - Intronic
1017917223 6:158840830-158840852 CCAAGTACAGTTTAGTGGGCAGG + Intergenic
1018988789 6:168657892-168657914 CCTAATACAGAGGCGTTGGGAGG - Intronic
1021590079 7:22251484-22251506 CCAAGGACAAAGGAGCTGGCAGG + Intronic
1028906645 7:96161735-96161757 CCAAGTCAAGAGGAGATGGAAGG + Intronic
1030808389 7:113945226-113945248 CCAAGTACATGGGAGCTGGGTGG + Intronic
1030870922 7:114755457-114755479 CAAAGTACAGAGCACTTGACAGG - Intergenic
1033769368 7:144531719-144531741 CCAATTAAAGTAGAGTTGGCAGG - Intronic
1035064404 7:156094723-156094745 CCAAGGCCATAGGACTTGGCTGG + Intergenic
1036621780 8:10428895-10428917 CCAAAGACAGAGGAGATGTCAGG - Intergenic
1037887110 8:22600990-22601012 ACAAGTTCAGAGGTGTCGGCAGG + Exonic
1041458120 8:58082049-58082071 CCCTGTACAGAAGAGTTGGGAGG - Intronic
1041954189 8:63539207-63539229 CCCAGTACAGTGGTGTTGGGAGG + Intergenic
1043489735 8:80736999-80737021 CCAAGTAGAGAGGAAATGGGAGG + Intronic
1044382049 8:91545434-91545456 CCAAGTTCAGTGGTATTGGCAGG - Intergenic
1047451591 8:124969856-124969878 TCAAGAACTCAGGAGTTGGCTGG + Intergenic
1049166211 8:141128067-141128089 GCCAGGACAGTGGAGTTGGCCGG - Intronic
1049309725 8:141927452-141927474 CCAGGTACACAGCAGTTTGCAGG - Intergenic
1053049229 9:34945029-34945051 ACAAAGACAGTGGAGTTGGCTGG - Intergenic
1054952176 9:70865030-70865052 CTAAGTACAGGGGGGTTGGGGGG + Intronic
1055644157 9:78346965-78346987 CCAAGGACAGAGGAGAGGGAGGG + Intergenic
1057485832 9:95483452-95483474 CCAAGAATAGAGCAGTTGGGAGG - Intronic
1061080560 9:128367313-128367335 CCAAGGCCAGAGGAGGTGGGAGG + Intergenic
1062054413 9:134463537-134463559 CCAGGGACAGAGGAGTGGCCCGG - Intergenic
1062322814 9:135998618-135998640 CCAAGCACAGAGGGGCTGGCAGG - Intergenic
1190302303 X:49064044-49064066 ACAGGTACAGAGGAGTAGCCAGG + Intronic
1194549091 X:95273994-95274016 CCACGTACACAAGAGTTGGCAGG + Intergenic
1196098625 X:111825792-111825814 CCAAGTAGGGAGGAGATGGCTGG + Intronic
1196820453 X:119696425-119696447 CCAAGAACAGGGGAGATGGAAGG + Intergenic