ID: 966001088

View in Genome Browser
Species Human (GRCh38)
Location 3:174949251-174949273
Sequence CTTTCTCACAACACCCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966001084_966001088 -4 Left 966001084 3:174949232-174949254 CCATAGCCCTTCAAATGGGCTTT 0: 1
1: 0
2: 0
3: 12
4: 148
Right 966001088 3:174949251-174949273 CTTTCTCACAACACCCAGTAGGG 0: 1
1: 0
2: 2
3: 11
4: 182
966001083_966001088 -3 Left 966001083 3:174949231-174949253 CCCATAGCCCTTCAAATGGGCTT 0: 1
1: 0
2: 3
3: 12
4: 102
Right 966001088 3:174949251-174949273 CTTTCTCACAACACCCAGTAGGG 0: 1
1: 0
2: 2
3: 11
4: 182
966001085_966001088 -10 Left 966001085 3:174949238-174949260 CCCTTCAAATGGGCTTTCTCACA 0: 1
1: 0
2: 2
3: 9
4: 220
Right 966001088 3:174949251-174949273 CTTTCTCACAACACCCAGTAGGG 0: 1
1: 0
2: 2
3: 11
4: 182
966001080_966001088 9 Left 966001080 3:174949219-174949241 CCATAGCTCTTACCCATAGCCCT 0: 1
1: 0
2: 0
3: 9
4: 166
Right 966001088 3:174949251-174949273 CTTTCTCACAACACCCAGTAGGG 0: 1
1: 0
2: 2
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966001088 Original CRISPR CTTTCTCACAACACCCAGTA GGG Intronic
906104461 1:43283631-43283653 CATGCTCACAAAACCCAGTAAGG + Intronic
907677204 1:56529359-56529381 TGTTCACAGAACACCCAGTAAGG + Intronic
908846853 1:68333653-68333675 CCTTCTTACACCACACAGTAGGG - Intergenic
909406465 1:75295830-75295852 CTTTCCCAAAACACCAAGGAGGG - Intronic
910244424 1:85123366-85123388 CTTTCTTACAAGGCCCAGCATGG + Intronic
914405524 1:147367700-147367722 CTATCTCACACCAGCCAGCAAGG - Intergenic
915004744 1:152625585-152625607 CTCATTCACAACACCCAGTGTGG - Intergenic
916097223 1:161362154-161362176 CCTTCTCAAAACCCACAGTATGG - Intronic
916797459 1:168179950-168179972 ATCTCTCACAACACCCCCTATGG - Intronic
920740291 1:208575471-208575493 CTCCCTCACAGCACCCAGAAGGG - Intergenic
921351204 1:214237458-214237480 CTATCTCACAACAGTCAGAATGG + Intergenic
921929833 1:220746215-220746237 CTTTCTCAGAGCAGCCAGAATGG + Intergenic
1062971308 10:1651421-1651443 CTCTCTCACATCACCCACTGCGG - Intronic
1064682072 10:17820151-17820173 CTTTGTAACAACATCCAGTCTGG + Intronic
1064853601 10:19738971-19738993 CTATCTCACAACAGTCAGAATGG - Intronic
1065005188 10:21373220-21373242 CTTCCTGCCAACACCCAGCAAGG + Intergenic
1065263306 10:23948862-23948884 CTTAGTCACTACACCCAGTAGGG + Intronic
1065378963 10:25069676-25069698 CTTTGTGACAACACAGAGTAGGG - Intergenic
1065904534 10:30238585-30238607 CTCTCTCCCATCACCCAGGATGG + Intergenic
1067267809 10:44761656-44761678 ATTTCTCTCAACAGCCAGTGAGG + Intergenic
1067431021 10:46245971-46245993 CATTCTCACAACACCCAGGAAGG - Intergenic
1067442386 10:46316257-46316279 CATTCTCACAACACCCAGGAAGG + Intronic
1068144401 10:53048724-53048746 CTCTCTCTCAACAGGCAGTATGG - Intergenic
1068801981 10:61151889-61151911 CTTTCTCACACCACATAATAGGG + Intergenic
1073295420 10:102435678-102435700 CTTTCTCAGAAGAGCCAGCATGG + Intergenic
1075406431 10:122198799-122198821 CTTTCACTCAACACCTACTAAGG - Intronic
1075741495 10:124698951-124698973 CTCACTCACACCACCCAGTGGGG + Intronic
1079024284 11:16933789-16933811 CTTTCTCCCTATACCCAGGAAGG - Intronic
1079360215 11:19764578-19764600 CATTCTCACAACAACCTATAAGG - Intronic
1082798141 11:57393472-57393494 ATTTCTCACACTACCCAGTGAGG - Intronic
1082998153 11:59268835-59268857 TTTTGTCACAACAGCCAGAATGG - Intergenic
1084466649 11:69327231-69327253 CTTTCTGATAAAACCCAGTGTGG - Intronic
1084736962 11:71111596-71111618 CTCTCTCAAAACACACAGAAGGG + Intronic
1087368444 11:97250686-97250708 CTTTCTCACAAGCCCCAGAAGGG - Intergenic
1088384878 11:109242539-109242561 CTTTTTCACCACACACTGTATGG - Intergenic
1092942448 12:13422888-13422910 CCTTCTCAATACACACAGTAGGG - Intergenic
1093822419 12:23637748-23637770 CTTTCTCACCACACTAAGGATGG - Intronic
1095692598 12:45107307-45107329 CAATCTCACACCACCCAGAATGG - Intergenic
1095753869 12:45741225-45741247 CTGTCTCAAAACACCCAGGCTGG + Intronic
1099737012 12:86581245-86581267 CTGTCTCTCAACAACCACTAAGG - Intronic
1100167815 12:91938175-91938197 ATTTTTCATAATACCCAGTATGG + Intergenic
1100607994 12:96167549-96167571 GTTTCTCACAGGACCCAGTAGGG + Intergenic
1101300591 12:103476065-103476087 CTTTCTGAAAACACACAGCAAGG - Intronic
1101847912 12:108378059-108378081 CCTTCTCACACCAGCCAGAATGG + Intergenic
1103706419 12:122876407-122876429 CTCTCTCAGAACACACAGTCTGG + Intronic
1107050463 13:36042277-36042299 ATTTCTCACAATATACAGTATGG + Intronic
1109309695 13:60678076-60678098 CTATCTCACACCAGCCAGAAGGG - Intergenic
1109654645 13:65373630-65373652 ATTTCTCACAAGACTCAGAAGGG + Intergenic
1113272878 13:108694229-108694251 CCATCTCACACCACTCAGTATGG - Intronic
1114521383 14:23339901-23339923 CTCTCTCTCAACACCTAGGAGGG - Intergenic
1114706455 14:24731949-24731971 CTATCTCACACCACTCAGAATGG + Intergenic
1115822542 14:37226856-37226878 ATTTCTCACACTACCCAGAAAGG - Intronic
1119322831 14:73741747-73741769 CTTTCACCCAGCACCCAGAAGGG + Intronic
1125121394 15:36162740-36162762 CTTTCTTAAAACACCAGGTAGGG + Intergenic
1128471929 15:67961737-67961759 CTTTCTCCCATCCCCCAGCATGG - Intergenic
1128562717 15:68679113-68679135 CTGTATCCCAACACCCAGCACGG - Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1133211504 16:4265716-4265738 GATTCTCACAAAACCCAGTGGGG + Intronic
1146954953 17:36932061-36932083 CTCTGTCTGAACACCCAGTAAGG - Intergenic
1148011979 17:44489847-44489869 CTTTCTAAAAACATTCAGTATGG + Intronic
1149247937 17:54733445-54733467 CTATCTCACACCACTCAGAATGG + Intergenic
1153070826 18:1102409-1102431 CTATCTCACACCAGTCAGTATGG - Intergenic
1155463278 18:26107617-26107639 CTTTGTCACAACAGCCATTCTGG + Intergenic
1157070419 18:44400996-44401018 CTTTTCCACAAAACCCAGAAGGG - Intergenic
1162139763 19:8578749-8578771 CTTCCCCACACCACCCAGCAAGG + Intergenic
1164048248 19:21561492-21561514 CTTTCTCACACCAGTCAGAATGG + Intergenic
926222837 2:10947584-10947606 TGTTCTCACAACACCCTCTAGGG + Intergenic
929273038 2:39995124-39995146 GTTTCTCACAACAGCCTGTAAGG + Intergenic
930402061 2:50902723-50902745 CTTTTTCACATTACACAGTAAGG - Intronic
931921620 2:67023256-67023278 CTGTCTCACACCAGCCAGAATGG + Intergenic
933536453 2:83581332-83581354 CTTTCTGACAGCATCCAATATGG - Intergenic
935844493 2:107150199-107150221 TTTTCTCACAGCATCCAGCACGG + Intergenic
936928468 2:117762081-117762103 CTTTCTTACATGACCCAGAAGGG + Intergenic
937383241 2:121401014-121401036 TTTTCTCATAACAGCCAGAAGGG + Intronic
937955419 2:127419385-127419407 AATTCTCACAACACCCTTTAAGG + Intronic
938675867 2:133633298-133633320 CTCTCTCACCAAACCCAGAACGG + Intergenic
939107354 2:137964473-137964495 CTTTCTCAGAAAACCAAATATGG + Exonic
939197178 2:138987658-138987680 CTTTCTCACACCAGTCAGAATGG - Intergenic
940806201 2:158189660-158189682 CTTTCTCAATAGACCCAGTTTGG + Intronic
945021355 2:205574999-205575021 CTTTCTCTCCTCATCCAGTAAGG - Intronic
947326973 2:228990309-228990331 CTATCTCACACCAGCCAGAATGG + Intronic
948468924 2:238165152-238165174 CTGTCTCCCCACACCCAGAAGGG + Intronic
1169001346 20:2169917-2169939 AATTCTCATAACACCCAGAAAGG - Intronic
1169387917 20:5166750-5166772 CTTTGTCACGAAACCCAGCAGGG - Intronic
1170631002 20:18065012-18065034 CTTTATCAAAACACACAATAAGG + Intergenic
1170936562 20:20815050-20815072 CTTTCTGACAAGAGCCTGTAGGG - Intergenic
1171316339 20:24199087-24199109 ATGTCTCACAACAGCCAGCAAGG + Intergenic
1174402263 20:50282438-50282460 CATTCTCACGACACCCTGAAGGG - Intergenic
1175872559 20:62215403-62215425 CTTTCTGAAAACACCCAGAATGG + Exonic
1175912897 20:62413180-62413202 CTCTCTAACAACACTCAGTGAGG - Intronic
1176269752 20:64230088-64230110 CTTTCTCACAAAACCTGGTGTGG - Intronic
1177351243 21:19944593-19944615 CTATCTCACAACAGTCAGAATGG - Intergenic
1177659683 21:24066549-24066571 CTTACTCAGAACTCCAAGTAGGG + Intergenic
1177732268 21:25042896-25042918 CTTTCTAAGGACACCCACTAGGG + Intergenic
1177850495 21:26341274-26341296 CTATCTCACACCACTCAGAATGG - Intergenic
1182755116 22:32673065-32673087 GTTTTTCTCAACACCCAGAAAGG - Intronic
1182868741 22:33627621-33627643 CATTGTCACATCACCCTGTATGG - Intronic
949874907 3:8620091-8620113 CTTTCATACCACACACAGTAGGG - Intronic
952506607 3:34012341-34012363 CTTTCTCACCACACAAAGCAAGG - Intergenic
952964297 3:38611555-38611577 CTTTCTGAAAAGACCCAGGAAGG + Intronic
954731809 3:52669991-52670013 CCTTCTCACAGCACACATTAGGG + Intronic
956466489 3:69525265-69525287 CTTTCTCAGAGCACACAGGATGG + Intronic
956586129 3:70866955-70866977 CTTTCTGAAAACATCCAGCAGGG + Intergenic
957644588 3:82904271-82904293 CATTCTCACAATACCCAGCTGGG + Intergenic
957981931 3:87521286-87521308 TTTTCTCACAACACACTGGAAGG - Intergenic
961644411 3:128384964-128384986 CATTCAAACAAAACCCAGTATGG - Intronic
963037422 3:141044505-141044527 CTTCCTCACACCAGCCAGAATGG + Intergenic
963430350 3:145193998-145194020 CTTGTTCTCTACACCCAGTAAGG - Intergenic
965049757 3:163630594-163630616 CTTTCTCACACCAGTCAGAATGG - Intergenic
966001088 3:174949251-174949273 CTTTCTCACAACACCCAGTAGGG + Intronic
966319587 3:178686313-178686335 CTTTATCACCAAACCTAGTATGG - Intronic
968768233 4:2486166-2486188 GCTCCTCACATCACCCAGTAAGG - Intronic
971610889 4:28725034-28725056 CCATCTCACAACAGCCAGAATGG - Intergenic
972642412 4:40937599-40937621 CTTTAGCACAAAACTCAGTAAGG + Intronic
972704187 4:41525390-41525412 CTTTTTAACAACAATCAGTAAGG - Intronic
973589485 4:52426262-52426284 ATATCTCACAAGACCCAGCATGG - Intergenic
973810458 4:54564959-54564981 CTTTCTCACCACATCAAGCAGGG + Intergenic
974715275 4:65661515-65661537 CCTTCTTAGGACACCCAGTATGG + Intronic
977025122 4:91809016-91809038 CCATCTCACAACAGTCAGTATGG + Intergenic
982356513 4:154474783-154474805 CATTTTCACAACACCCTGCATGG - Intronic
984076296 4:175184976-175184998 CCATCTCACAACAGCCAGAATGG - Intergenic
984480724 4:180297785-180297807 TTTTCTGACAACACAGAGTAAGG + Intergenic
990597311 5:57324463-57324485 CATTCTCACAACATCCTGTTGGG - Intergenic
990792733 5:59500056-59500078 CTATCTCACACCACTCAGAATGG + Intronic
991024103 5:62011312-62011334 CTCTCTCACAACTCCCTGTGGGG - Intergenic
994588532 5:101743198-101743220 CTATCTCACAACAGTCAGAATGG - Intergenic
995007589 5:107218970-107218992 CTTTCTCACGATAACCAGCATGG + Intergenic
995013070 5:107279273-107279295 CCATCTCACAACAGCCAGAATGG - Intergenic
995284576 5:110372382-110372404 CTTTTACACAACAGCAAGTATGG - Intronic
995541535 5:113190792-113190814 CTTGTTCCCCACACCCAGTAAGG - Intronic
996020429 5:118585500-118585522 CGTTTTCACAACACCCATGAGGG + Intergenic
996902555 5:128559368-128559390 CTATCTCACACCAGTCAGTATGG + Intronic
998358217 5:141559648-141559670 CTTTCCCAGCACACCCAGGATGG + Intronic
999139378 5:149347730-149347752 CTTCCTCACCACAACCTGTAAGG - Intronic
1000136433 5:158356873-158356895 CTCTGTCACAACACACAGGAGGG + Intergenic
1001095423 5:168772118-168772140 CCTTCTCACTGCACCCAGGAAGG - Intronic
1004622585 6:17344037-17344059 CTTTCCCAGAACACCCTGAAAGG - Intergenic
1005591320 6:27331353-27331375 CTTCCTGCCAACACCCACTAGGG - Intergenic
1006185054 6:32176794-32176816 CCTTCTCACAACATACAATATGG + Exonic
1007141238 6:39576640-39576662 CTGTCACACAGCACTCAGTATGG + Intronic
1008397590 6:51026640-51026662 CTTTATCCCAGAACCCAGTAAGG - Intergenic
1009029814 6:58043223-58043245 CTTCCTCCCAACAGCCAGTGAGG - Intergenic
1009205342 6:60794461-60794483 CTTCCTCCCAACAGCCAGTGAGG - Intergenic
1011661351 6:89596738-89596760 CCTTCTCCAAAGACCCAGTAGGG - Intronic
1012234492 6:96797555-96797577 CTACCTCACAACATCCTGTAAGG + Exonic
1012485701 6:99720407-99720429 CCTTCTCACACCACTCAGAATGG - Intergenic
1014058675 6:117045629-117045651 CTTTCTCACAAGATCCAGGTGGG - Intergenic
1015173000 6:130275442-130275464 ATTTGTCTCAACTCCCAGTAGGG + Intronic
1018217753 6:161546889-161546911 CCTTCTGACAACAGCCAGTGAGG + Intronic
1024083794 7:45877096-45877118 CCTTATCACAAGACCCAGTGAGG - Intergenic
1026850524 7:73720425-73720447 CTTGCTCCCATCATCCAGTAGGG + Intergenic
1027758491 7:82247546-82247568 CCTTCTCACAAGACCCACTGAGG + Intronic
1029959867 7:104679218-104679240 GTTTCTGTCAACAACCAGTAAGG - Intronic
1031735415 7:125353577-125353599 CTTTCTGACAGCACCCAGTGTGG - Intergenic
1033413609 7:141142910-141142932 CTATCTCACACCACTCAGAATGG - Intronic
1034318516 7:150157444-150157466 CTTTCTCACATCTCCCAGTTGGG - Intergenic
1034774235 7:153809786-153809808 CTTTCTCACATCTCCCAGTTGGG + Intergenic
1035532787 8:367254-367276 CTATCTCACACCACTCAGAATGG - Intergenic
1036006615 8:4671977-4671999 CTTTCTCAGAACATCCAGCATGG + Intronic
1036540022 8:9697738-9697760 CTGTCTCACACCACTCAGAATGG + Intronic
1037743651 8:21626779-21626801 CTTTCTTAAAACACCCAGAAGGG - Intergenic
1037914355 8:22763606-22763628 CATCCTCACAACACCCTGTGAGG - Intronic
1039720313 8:40157348-40157370 GTTTCTCAGAACAGCCTGTATGG + Intergenic
1044708726 8:95034391-95034413 TTTTCTCAAATGACCCAGTAAGG + Intronic
1046921844 8:119739130-119739152 CTTTCCCACAAAAACCACTAGGG + Intronic
1047022713 8:120793168-120793190 CTTACTCTCCACACCCAGCAAGG - Intronic
1047410806 8:124623028-124623050 CTTTCTCACACCTTCCAGGAGGG + Intronic
1047514126 8:125538759-125538781 CATCCTCATAACACCCAATAAGG - Intergenic
1047945056 8:129868536-129868558 CTTTCTCACATCACCAATCATGG + Intronic
1047971880 8:130091628-130091650 TTTCCTCACAACAGCCAGAATGG - Intronic
1048553456 8:135454959-135454981 GGTTCTCGCAACACCCTGTAAGG - Intergenic
1050669599 9:7981190-7981212 CTATCTCACACCAGCCAGAATGG + Intergenic
1050866750 9:10510201-10510223 CTTTCCCATACCACTCAGTATGG + Intronic
1051801640 9:20940844-20940866 CTTTCTTACATAACACAGTATGG + Intronic
1053344264 9:37366432-37366454 CTTTCTCACAGGGCCCAGCATGG + Intergenic
1054968051 9:71052408-71052430 CTTTCTCAAAACAGCCATTCAGG - Intronic
1057342002 9:94211303-94211325 ATTTCTCACAACAACCCTTATGG - Intergenic
1059098619 9:111446679-111446701 GATTCTCACAACAACCAGTGAGG + Intronic
1060399563 9:123340391-123340413 CTTCCTCAGAACACCCCGTGGGG - Intergenic
1186134866 X:6508480-6508502 CTGTCTCACACCACTCAGAATGG + Intergenic
1186644836 X:11495483-11495505 CTTTCACACAGCACCTGGTAAGG + Intronic
1190132577 X:47763356-47763378 CTATCTCACACCAGCCAGAATGG - Intergenic
1190484263 X:50909401-50909423 CTTCCTCACAACAACCTGTGAGG + Intergenic
1190536535 X:51433755-51433777 CATTTTCAAAACACTCAGTATGG - Intergenic
1191818796 X:65279331-65279353 CCATCTCACAACACTCAGAATGG - Intergenic
1194179122 X:90691489-90691511 CCATCTCACATCACCCAGCATGG + Intergenic
1194354542 X:92866158-92866180 CTATCTCACAACAGTCAGAATGG + Intergenic
1194564081 X:95461313-95461335 GTTTCTCACAAGACACATTATGG - Intergenic
1195401609 X:104466967-104466989 CATCCTCACAACAACCTGTAAGG + Intergenic
1195843608 X:109202352-109202374 ATTTCTCACAACAGCTAGGATGG - Intergenic
1196417120 X:115483087-115483109 GATTCTCACCACACCGAGTATGG - Intergenic
1197642586 X:128983483-128983505 CTATCTCACACCAGCCAGAATGG + Intergenic
1198544710 X:137678982-137679004 CCATCTCACACCACCCAGAATGG + Intergenic
1199197929 X:145054144-145054166 CTATCTCACAACAGTCAGAATGG + Intergenic
1200525788 Y:4273656-4273678 CCATCTCACATCACCCAGCATGG + Intergenic
1201569669 Y:15400307-15400329 TTTTCTCCCAACAACCACTAAGG - Intergenic