ID: 966007751

View in Genome Browser
Species Human (GRCh38)
Location 3:175037204-175037226
Sequence TCATGTCAATGTTGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966007751 Original CRISPR TCATGTCAATGTTGTCCTGG AGG (reversed) Intronic