ID: 966008462

View in Genome Browser
Species Human (GRCh38)
Location 3:175047023-175047045
Sequence CTGTGTCCTCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5195
Summary {0: 7, 1: 285, 2: 807, 3: 1675, 4: 2421}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966008462 Original CRISPR CTGTGTCCTCAGATGGTGGA AGG Intronic
Too many off-targets to display for this crispr