ID: 966015842

View in Genome Browser
Species Human (GRCh38)
Location 3:175136079-175136101
Sequence TACTCCTTAGGGTGTAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966015842 Original CRISPR TACTCCTTAGGGTGTAGAGA GGG Intronic
902126657 1:14219263-14219285 TACTTTTGAGGGTGTAGGGAAGG + Intergenic
904001795 1:27342994-27343016 TGCTCCTGAGGGTGTCAAGAGGG + Intronic
904271672 1:29354306-29354328 TACTCCATAGGCTTTAGAGCGGG - Intergenic
904301585 1:29557795-29557817 CACTCCTTAGGGCCCAGAGAGGG + Intergenic
905504120 1:38463371-38463393 TACTTGATAGGGTCTAGAGAAGG + Intergenic
907550225 1:55298813-55298835 TTCTAGTTAGGGTGTAGAGAGGG + Intergenic
909192825 1:72575564-72575586 TAGTCCTTAGGGTTTGGAGAAGG - Intergenic
909227784 1:73046794-73046816 TATTCCTGAGGGAGAAGAGAAGG + Intergenic
910017963 1:82550684-82550706 TGCTACTTAGGATGCAGAGATGG + Intergenic
915953284 1:160204548-160204570 GACCCCTTAGGCTATAGAGATGG + Intergenic
918211750 1:182357528-182357550 TTCTCCTTATGGTCTATAGATGG - Intergenic
920699843 1:208209533-208209555 TAGTGCCTAGGGTGCAGAGAGGG - Intronic
921051883 1:211516760-211516782 TACTCCTTGGGGTTCAGAGGGGG - Intergenic
923666206 1:236000826-236000848 TACTCAATAGAGTGGAGAGAGGG + Intronic
923796584 1:237163032-237163054 TACTCTTTATGGACTAGAGACGG + Intronic
924362367 1:243255037-243255059 TACCCCTTACCGTGGAGAGAGGG + Exonic
1064117116 10:12587651-12587673 GACTCCTTAGGATGTGCAGATGG + Intronic
1064186990 10:13170546-13170568 TACTGCTTAGTGAGTAGAGTGGG - Intronic
1067947817 10:50701466-50701488 TCCTCCTCAGGGTACAGAGAAGG + Intergenic
1070183818 10:74040280-74040302 TACTGTTTAGGTAGTAGAGATGG - Intronic
1070336600 10:75461332-75461354 TTTTCCTTTGGGTATAGAGAGGG + Intronic
1070883134 10:79866459-79866481 TCCTCCTCAGGGTACAGAGAAGG + Intergenic
1071649703 10:87382774-87382796 TCCTCCTCAGGGTACAGAGAAGG + Intergenic
1080549272 11:33357052-33357074 TACTCCTTACAGGGTAGGGAAGG + Intergenic
1087166291 11:95007084-95007106 TTCTCCTTCAGGTGCAGAGAAGG + Intergenic
1097260267 12:57715922-57715944 TACTCCTCAGGCTGTAGGGAAGG - Exonic
1101243710 12:102864195-102864217 TTTTACATAGGGTGTAGAGAGGG + Intronic
1101541068 12:105665901-105665923 TACTCCATGGGTTGTAGAAATGG - Intergenic
1107650525 13:42540545-42540567 TACTCCTAAGGGTGATGTGAAGG + Intergenic
1108605446 13:52032982-52033004 TATTCCTGAGGATGTAGTGAAGG + Exonic
1110418516 13:75278542-75278564 TACTCCTTAGGCTATAGTGGGGG + Intergenic
1116562188 14:46394493-46394515 TACTTTTTATGTTGTAGAGATGG - Intergenic
1117133351 14:52707467-52707489 CACTCCTTCGGGTGTAGAAATGG + Intronic
1117737096 14:58778641-58778663 TACTTCTGAGGAAGTAGAGATGG - Intergenic
1120101169 14:80447240-80447262 TACTCCTTTTGGTGTAAGGAAGG - Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1122793956 14:104196475-104196497 GACACCTTAGGGTGGGGAGAGGG + Intergenic
1136265521 16:29115315-29115337 CACTCCTTCGGGTCTAGGGAGGG - Intergenic
1138903559 16:61303073-61303095 TACTTCTGAGGCTGTTGAGATGG + Intergenic
1140678455 16:77359085-77359107 TACTCCTTCGTGTGCACAGATGG - Intronic
1141273931 16:82567513-82567535 TACTCCCTAGGCTGTAAAGCTGG + Intergenic
1142315161 16:89339298-89339320 TACTCCTTTGGTTGTACTGAGGG - Intronic
1143933944 17:10462389-10462411 TGCTGCTTAGGGAGTAGAGAGGG + Intronic
1148228468 17:45916160-45916182 TGCTTCTCTGGGTGTAGAGACGG - Intronic
1149484026 17:57027964-57027986 TACTTATTAGGCTGTAGAAATGG - Intergenic
1150271926 17:63872404-63872426 TCCCCTTCAGGGTGTAGAGAAGG + Intronic
1151011929 17:70509340-70509362 CACTCGTTTGGGTGTAAAGAAGG - Intergenic
1153553676 18:6287605-6287627 TATTCCTTTTAGTGTAGAGAGGG - Intronic
1155583361 18:27337695-27337717 TACTGCTTTGCGTGTAGACAGGG - Intergenic
1157258025 18:46155598-46155620 TACTCATTTGGATGTGGAGAAGG - Intergenic
1157324225 18:46657403-46657425 TTCTCCATAGGGAGGAGAGAGGG - Intergenic
1158076199 18:53532640-53532662 TAATTCTTAGGGCCTAGAGAAGG - Exonic
928291401 2:30040590-30040612 TATTCCTTTGGGTGAAGAAATGG + Intergenic
928317336 2:30256310-30256332 GACTCCTTCAGGTGTAGAGCTGG + Intronic
932089407 2:68791653-68791675 CATTCCCTAGGGTGTACAGACGG - Intronic
937266970 2:120622915-120622937 TACCCCATAGTGTGAAGAGAGGG + Intergenic
942084624 2:172432503-172432525 TCCTGCTGAGGGTGGAGAGAGGG + Intronic
943085844 2:183310236-183310258 TACTCCTTAGGAGGAAGAAAAGG + Intergenic
947147707 2:227083622-227083644 TACTTTTTTGTGTGTAGAGATGG + Intronic
1173449049 20:43146365-43146387 CACTACATAGGGTCTAGAGATGG - Intronic
1174938601 20:54898768-54898790 TACTCCTTAGCCTGTGGAAAGGG + Intergenic
1175991267 20:62790707-62790729 TGCTCCTTAGGGTCTGTAGAGGG - Intergenic
1182772053 22:32802985-32803007 TACTCCTTAGTGTGTATGGAGGG + Intronic
1184144816 22:42603568-42603590 TACTTCTCAGGGTGCTGAGAGGG - Intronic
955414916 3:58683260-58683282 TACTCCCTAGGGTGTAAACTTGG - Intergenic
956436006 3:69235223-69235245 AACTCCTTAAATTGTAGAGATGG + Intronic
959657915 3:108830997-108831019 TCTTCTTTAGGGTGTAGAGTGGG + Intronic
962631587 3:137281553-137281575 AAACCCTTAGGGAGTAGAGACGG + Intergenic
963127782 3:141831217-141831239 CACTCCATTGTGTGTAGAGATGG + Intergenic
966015842 3:175136079-175136101 TACTCCTTAGGGTGTAGAGAGGG + Intronic
968930367 4:3575697-3575719 TCCTCCTGGGGGTGTTGAGAGGG - Intergenic
969988095 4:11232460-11232482 TTCTCTTTAGTGTGTAGTGAAGG - Intergenic
970719498 4:18969880-18969902 TATTCCTAAGGGTTTAGTGAGGG - Intergenic
972524341 4:39893513-39893535 TACGCATTAGGGTACAGAGAAGG + Intronic
972985230 4:44755219-44755241 CATTCCTAAGGGTGTGGAGATGG - Intergenic
976220534 4:82753601-82753623 GACTTCTTTGGGAGTAGAGAAGG - Intronic
979075978 4:116271120-116271142 TGCTCCTGAGGATGTGGAGAAGG - Intergenic
979516083 4:121611810-121611832 TACTCCTTATGTTGTACAGTTGG - Intergenic
982439354 4:155416844-155416866 GACTTCTTAGGGTGTATAGCAGG + Intergenic
982646621 4:158031997-158032019 TATTCCTTTGGGTGTATACACGG - Intergenic
985154691 4:186973709-186973731 TATTCCTTTAGGAGTAGAGATGG - Intergenic
993973938 5:94453948-94453970 TGCTCCTAAGGATCTAGAGAGGG + Intronic
996061918 5:119041814-119041836 TACTCCTTAGGGTGAAAAATGGG + Intronic
996190813 5:120539119-120539141 TTCTCTTTATGGTGTAGAAATGG - Intronic
996613896 5:125416256-125416278 TACTCTTTATCGTCTAGAGAAGG + Intergenic
997678026 5:135729192-135729214 TGCTACTCAGGGTGTGGAGAGGG - Intergenic
999932254 5:156446389-156446411 TGGACCTTAGGGTGTGGAGAGGG + Intronic
1004239187 6:13903210-13903232 TACTGCTCAGGGTGTGGAGGGGG - Intergenic
1004637534 6:17483499-17483521 AACTCCTCAGGGTGCAGACAAGG + Intronic
1004943736 6:20588298-20588320 TACTCTTTGGGTTATAGAGAAGG - Intronic
1005955059 6:30657802-30657824 TTTTCCTTGGGGTGTAGGGAGGG - Intronic
1023274359 7:38502255-38502277 TAGTCTCTAGGCTGTAGAGAAGG - Intronic
1023352030 7:39330064-39330086 TAATCCTGAGGGTGGAGAGGAGG - Intronic
1027968591 7:85046451-85046473 TATTCCTGAGGGGCTAGAGAAGG - Intronic
1030208221 7:106971592-106971614 TACACCTAGGGGTGTAAAGAGGG - Intergenic
1030868019 7:114723345-114723367 TAGTCCTGAGGGTTCAGAGAAGG + Intergenic
1030920954 7:115386502-115386524 TACTCAGTAGGGTGTATAAAGGG + Intergenic
1032471419 7:132181898-132181920 TACTTCTTGGGGTATAGACATGG - Intronic
1038008257 8:23452410-23452432 AACTCCTTAGGGTGTAAAAGAGG + Intronic
1038400325 8:27279642-27279664 TGATCCTCAGGGTGTAGACAGGG + Intergenic
1039977254 8:42377521-42377543 TAATCCTTTGGGGGTAGGGAGGG + Intergenic
1047883919 8:129227130-129227152 TTCTTCTCAGGGTGTAGGGATGG - Intergenic
1049246237 8:141564048-141564070 TACTCCTTGGGGAGTAGGGAAGG + Intergenic
1056558914 9:87712514-87712536 TTCTCCTCAGGGTAGAGAGAAGG + Intergenic
1056575197 9:87851233-87851255 TCCTCCTCAGGGTACAGAGAAGG - Intergenic
1058672714 9:107374093-107374115 TTGTCCTTAGAGTGCAGAGATGG - Intergenic
1061591069 9:131597916-131597938 AACTCCTGAGGGTGTGGAGATGG - Intronic
1191154821 X:57262151-57262173 GACTCCTAAAGGTGAAGAGAAGG + Intergenic
1192047257 X:67688888-67688910 TACTCCTTAAGGAATAGACAAGG - Intronic
1192288897 X:69770520-69770542 TTCACCTGAGGGTGTACAGATGG - Intronic
1193251268 X:79293195-79293217 TATTCCTGAGGGAGAAGAGAAGG + Intergenic
1193964110 X:87962517-87962539 TACTCCTGAGGGAGAAGAGAAGG + Intergenic
1194816311 X:98446245-98446267 TTCTCATTAGGCTGTAGAAAGGG + Intergenic
1194816490 X:98447876-98447898 TTCTCCTTAGGCTATAGAAAGGG + Intergenic
1196192402 X:112808662-112808684 TACTCCTTTCTGTGTGGAGATGG - Intronic
1198265031 X:135001112-135001134 TTCTTCTTAGGGTACAGAGAGGG + Intergenic
1198922173 X:141741618-141741640 GACTACTTAGGGTGTTGGGATGG - Intergenic
1200223409 X:154403325-154403347 CACTCCTAAGGCCGTAGAGAAGG - Exonic
1200801744 Y:7393381-7393403 CATTCTTTAGGGGGTAGAGAAGG - Intergenic