ID: 966016442

View in Genome Browser
Species Human (GRCh38)
Location 3:175144678-175144700
Sequence AGGGCTGCCCAAAAATATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966016442 Original CRISPR AGGGCTGCCCAAAAATATGA AGG (reversed) Intronic
903098460 1:21003937-21003959 ATGGCAGCACAAAAAGATGAAGG + Intronic
904684843 1:32252402-32252424 AGGACTTCCCAAAAAAATTAAGG - Intronic
904963874 1:34356550-34356572 AGATCTGCCCAAAGATATTAGGG - Intergenic
905856213 1:41316474-41316496 AGAGCTGTCCAAGAATAAGATGG + Intergenic
906797594 1:48710407-48710429 GGGGCTGCCCAAAGAAATGCAGG + Intronic
913202146 1:116503690-116503712 AGGGCTGCCTAAGAACATGGGGG - Intergenic
913330088 1:117659884-117659906 AGTGCTTCCCAAAAATAAGCTGG + Intergenic
918598045 1:186316475-186316497 AGGTCTGCCATAAAATCTGAAGG + Intronic
921733665 1:218601716-218601738 TGGGCTGCCTAGAAATCTGATGG - Intergenic
922924142 1:229333486-229333508 AGGGTTGCACAAAAATGTGAAGG + Intronic
1065166022 10:22977939-22977961 AGTACTGCCCAAAAATGTCATGG - Intronic
1066028937 10:31397480-31397502 ATGCCTGTCCAAAAATAGGAAGG - Intronic
1078759965 11:14243918-14243940 AGAGCTGTCCAAAAACCTGACGG - Intronic
1080742361 11:35078471-35078493 GGGGCTGCCCAAGAAGAGGATGG - Intergenic
1085037853 11:73310451-73310473 ATGGGTGCCCAACAAGATGATGG + Exonic
1091662683 12:2396387-2396409 AGGCCTGCCCAAGAAGAAGAGGG + Intronic
1091738470 12:2942580-2942602 AGGGCAGCTTAAAAATGTGAAGG - Intergenic
1092115061 12:5994726-5994748 AGAGCTGCCGACAAATATCAAGG - Intronic
1093438144 12:19161526-19161548 TGGGATGCCCACAAATATGAGGG - Intronic
1095820266 12:46470875-46470897 AAGGCTGGCCAAAATTATAATGG + Intergenic
1096412218 12:51385488-51385510 AGGGCATCCCAAAAATCTTAGGG - Intronic
1100290307 12:93207465-93207487 AGGACTGCACCAAGATATGAGGG - Intergenic
1105432287 13:20347858-20347880 AGGGATGGCCAAGAAAATGAAGG + Intergenic
1106352625 13:28948418-28948440 AGGGCTGCTAAAAAATAGAATGG + Intronic
1107619855 13:42215891-42215913 AGGGCTGCCTAAAAACAGGATGG - Intronic
1114334054 14:21669549-21669571 AGGGCTGCCCAGAAATCTGAAGG + Intergenic
1114400545 14:22406252-22406274 TGGACTGCCCAACAATCTGAGGG + Intergenic
1118856226 14:69625465-69625487 AGGGCTGCACTGAAACATGAAGG - Intronic
1119027618 14:71166492-71166514 AGTGCTGCCCAAAAGAAGGAGGG - Intergenic
1120702887 14:87717209-87717231 AGGGGTGGCAAAAGATATGAGGG + Intergenic
1122796707 14:104209780-104209802 AGGGCTGCCCAAAAAGAGTGGGG - Intergenic
1123431498 15:20220900-20220922 AGAGATGCCCAATAATATGTGGG + Intergenic
1123797035 15:23782562-23782584 AGGACTCCCCAAAACTATCAAGG - Intergenic
1124255848 15:28141927-28141949 ATCCCTGCCTAAAAATATGAGGG + Intronic
1125300337 15:38248201-38248223 AAGGATGCCAAAAAATATAAAGG + Intergenic
1126238658 15:46415835-46415857 AAGGCTGCCCTAAAATTTCATGG + Intergenic
1127565723 15:60186321-60186343 AGGGCTGCCAAATACTGTGAAGG - Intergenic
1127761353 15:62142578-62142600 TAGGCTGCCCCCAAATATGAAGG - Intergenic
1128537271 15:68500705-68500727 TGGGCTGCCCAAAAATCCAAAGG - Intergenic
1129305584 15:74658966-74658988 AAGGCTGACCAAAATTATGAAGG + Intronic
1130803539 15:87292775-87292797 AGGGTTGCCCAATAAAATGCAGG - Intergenic
1130814356 15:87415167-87415189 AGGGCTCCCCAAAGTTATGGGGG + Intergenic
1134116643 16:11553637-11553659 AGGGCGGTCCAAAAAGGTGATGG + Exonic
1135008405 16:18849600-18849622 AGGGCAGCTCAAAAATGTTACGG + Intronic
1136853151 16:33630329-33630351 AGAGATGCCCAATAATATGTGGG - Intergenic
1140186464 16:72777235-72777257 AAGCCAGCCCAGAAATATGAGGG - Intergenic
1203114744 16_KI270728v1_random:1478751-1478773 AGAGATGCCCAATAATATGTGGG - Intergenic
1142824053 17:2496606-2496628 AGGGATGCGCAAAAATAAGTAGG - Intronic
1143666972 17:8368381-8368403 AGGGCTGCCATAAAAAATTATGG + Intergenic
1145235944 17:21208536-21208558 AGTCCTGCCCAAAAAGAGGAGGG + Intronic
1147813556 17:43191653-43191675 AGGGCTACCAATAAATAAGACGG - Intronic
1150181697 17:63128716-63128738 AGGGCTACCGAAAAATATGAAGG - Intronic
1151577320 17:74959233-74959255 AGGGCTGTCCACAGCTATGAGGG - Intronic
1152478194 17:80532239-80532261 ATGGCTGCCCAGAAATATAAAGG - Intergenic
1155141015 18:23044476-23044498 ATGGTTGCACAAAAATATGAAGG + Intergenic
1159898738 18:74022063-74022085 ATGTCTGGCCAAAAATATGCAGG + Intergenic
1161056518 19:2193359-2193381 AGGGCTGCCCAAGACTTTGCAGG - Intronic
1161444726 19:4311751-4311773 AGGGCTGCCCAACCACATGTTGG - Intronic
1161545287 19:4876860-4876882 AGGGCTGCCGTGAACTATGATGG + Intergenic
1164836843 19:31360672-31360694 AGATCTGACCAAAAATGTGAAGG - Intergenic
925803189 2:7622587-7622609 ATGGCTGCTCATAATTATGAAGG - Intergenic
925810316 2:7693788-7693810 AAGGCTGCACATAAATATGAAGG - Intergenic
927102312 2:19797451-19797473 AGGGATGTGCAAAAATCTGAAGG + Intergenic
928026991 2:27748595-27748617 AGGGCTGCCTAAGTAGATGAAGG + Intergenic
930511984 2:52357720-52357742 AAAGATGCCCAAAAATGTGAAGG + Intergenic
932885458 2:75545473-75545495 AGGGCAGACCAAAGAGATGATGG + Intronic
935693893 2:105754029-105754051 AGGGCTGCTCAACACTCTGATGG - Intronic
940941082 2:159561364-159561386 AGGGCTGCATCAAAATATGGTGG - Intronic
942789840 2:179748136-179748158 ATGGATGGGCAAAAATATGAGGG + Intronic
945676571 2:212862013-212862035 ATGGCCACCCAAAAATATGTAGG + Intergenic
946118022 2:217480649-217480671 ATTGCTGCCCCAAAATTTGATGG + Intronic
948311943 2:236993976-236993998 AGGGCTGCTCTCAACTATGATGG + Intergenic
1172641444 20:36442720-36442742 AGGCCTGTCCAAAAATCTGCAGG - Exonic
1173064565 20:39698173-39698195 AGGGCTGCTCAAACAAATGCAGG + Intergenic
1173698837 20:45048416-45048438 TGGGCTGCCCTAAAAAAGGAAGG + Intronic
1175038997 20:56027792-56027814 AGGGCTACCCAAAATGATGTAGG - Intergenic
1175154913 20:56964217-56964239 AAGGCTGACCAAAAACAGGAAGG - Intergenic
1177138649 21:17333715-17333737 ATGGCTGCACCACAATATGAAGG + Intergenic
1177168581 21:17630088-17630110 AAGGCTACCCAAAAATATATTGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182938117 22:34246017-34246039 AGTTCTGCCCAAAGATGTGATGG - Intergenic
1185263844 22:49887015-49887037 GGGGCAGCCCAAAAATCTGACGG - Exonic
953365947 3:42345068-42345090 AGAGATGCCTAAAAATCTGAAGG - Intergenic
957030279 3:75232806-75232828 AGTGCTGCAGAAAAAAATGAAGG + Intergenic
957807864 3:85174108-85174130 AGAGCTGCCCAACAATGAGATGG - Intronic
959840866 3:110972626-110972648 ATGGCTGTGGAAAAATATGATGG + Intergenic
963818281 3:149858118-149858140 AGGGCTGCATCAAAACATGATGG - Intronic
963941122 3:151097165-151097187 AGAGCTGCCCATAAATAAGGGGG - Intronic
966016442 3:175144678-175144700 AGGGCTGCCCAAAAATATGAAGG - Intronic
966104065 3:176313827-176313849 AGGGCTGCCATAAAAAATGAAGG + Intergenic
966344496 3:178963694-178963716 AGCGATGCCCCAAAATATGGTGG + Intergenic
967131962 3:186478739-186478761 AGGGCTGAACAAAAATGTGGAGG - Intergenic
969598253 4:8160974-8160996 AGGCCTGCTAAAAAATAAGAGGG - Intergenic
970939782 4:21618369-21618391 AGGTATGTCAAAAAATATGAAGG + Intronic
973937358 4:55861228-55861250 AGGGCTGCAGAGAAAGATGAAGG - Intronic
974374988 4:61064555-61064577 AGGGCTGCCCAATTACAAGATGG + Intergenic
974580534 4:63794782-63794804 AGGACAGCACCAAAATATGAAGG - Intergenic
975817396 4:78233080-78233102 AGGGCTGCTTAAAAGTATAATGG + Intronic
976364623 4:84219382-84219404 TGGCCTGACCAAAAACATGAAGG - Intergenic
979649268 4:123111321-123111343 AGGGGTGTCCAAAAATATATGGG - Intronic
983279754 4:165665479-165665501 AGGGCTGCTCACACATATGAAGG - Intergenic
985472527 5:54478-54500 GGGGCTGCCTATGAATATGAGGG - Intergenic
987748587 5:22009331-22009353 AGAGCTGCCCTATTATATGAGGG + Intronic
988897926 5:35698413-35698435 AGGGCTGCCCAGAGCTAGGAGGG + Intronic
989666230 5:43857556-43857578 AAGGCAGCCCACAAATCTGAGGG + Intergenic
991048748 5:62249907-62249929 AGAGATGCCCAATAATATGTGGG + Intergenic
991768767 5:70019129-70019151 AGAGCTGCCCTATTATATGAGGG + Intergenic
991848005 5:70894206-70894228 AGAGCTGCCCTATTATATGAGGG + Intergenic
994847615 5:105010184-105010206 ATGACTTCCTAAAAATATGAAGG + Intergenic
997169850 5:131706170-131706192 ATGGTTGCACAACAATATGAAGG + Intronic
999972981 5:156883461-156883483 TAGGCTGCCCCAAAATATGAAGG + Intergenic
1001798692 5:174524669-174524691 GGGGATGGCCAAAAAAATGATGG - Intergenic
1002692203 5:181058357-181058379 AGAGCAGCCCAAAAATATGCAGG + Exonic
1008815768 6:55563835-55563857 AGAGGTGCCCTCAAATATGATGG + Intronic
1009562771 6:65270397-65270419 GGGGCTGCCCCAAACTGTGAGGG - Intronic
1012749528 6:103140325-103140347 AGGGATGGCCTAAAGTATGAAGG - Intergenic
1015182000 6:130370529-130370551 AGGGCTGTCCCAAAAAAGGAAGG - Intronic
1015584004 6:134757327-134757349 AGTGCTGGCCAAATAAATGATGG - Intergenic
1019994652 7:4716439-4716461 AGGGCTGCCGTAAGCTATGATGG + Intronic
1020705870 7:11543479-11543501 AGGACTGAACAAAAATAGGAGGG + Intronic
1021526034 7:21589201-21589223 AGGATTGCCCAAAAATCTGTAGG - Exonic
1023091063 7:36617792-36617814 AGGGCTTCCCAAAAATAGCTGGG - Intronic
1027650115 7:80856141-80856163 AGGGCTCACCATAAATATGCAGG + Intronic
1030329715 7:108258391-108258413 AGGGCTGGTCAGAAAAATGAAGG - Intronic
1031040210 7:116831314-116831336 AGTGCTCCCCAAAACTATCAAGG + Intronic
1031199174 7:118656993-118657015 AGAGCTAACCACAAATATGAAGG + Intergenic
1033553110 7:142465384-142465406 AGAGCTGCTCAGAAATCTGAGGG - Intergenic
1033557614 7:142502331-142502353 AGGGATGCTCAGAAATCTGAGGG - Intergenic
1040628603 8:49181461-49181483 AAGGCTCCTCAAAAATATCAAGG + Intergenic
1042058732 8:64794234-64794256 AGGGTTGGCCAAGAATTTGAGGG - Intronic
1043144779 8:76639441-76639463 AGGACTGTCCAAGAATTTGAAGG - Intergenic
1046662904 8:116967951-116967973 GGGGCTGCACAAACAGATGAGGG + Intronic
1046774111 8:118145855-118145877 GGGGCTGCCCAAAAAGATCGTGG + Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1048767162 8:137857520-137857542 AGAGCTGCCCAAAGATGTAATGG - Intergenic
1050231609 9:3531474-3531496 AGGGTTGAACAAAAATATTATGG - Intergenic
1051822819 9:21188399-21188421 ATGGCAGCCCAAAGATATGCAGG + Intergenic
1051824714 9:21207966-21207988 ATGGCAGCCCAAAGATATGCAGG + Intronic
1051826643 9:21229042-21229064 ATGGCAGCCCAAATATATGCAGG + Intronic
1052625751 9:30974758-30974780 AGGTCTGCCCATAAAGATGACGG + Intergenic
1054861535 9:69958648-69958670 AGGACAACCCCAAAATATGATGG - Intergenic
1057729583 9:97597045-97597067 AGTGCTTTCCAAAAACATGATGG + Intronic
1058112631 9:101047819-101047841 AGGGCTGCTCAAAGACAGGAGGG - Intronic
1186745253 X:12561069-12561091 AGAGCTGTCAAAAAAGATGAGGG - Intronic
1187570206 X:20493166-20493188 AGGGCTCCCCAAAGAAATGATGG + Intergenic
1192165113 X:68823299-68823321 AGGGCTGCCCAAAGAAGTGTTGG - Intergenic
1192946043 X:75966466-75966488 AGGCCTGTCCAAAAAGGTGAGGG + Intergenic