ID: 966026745

View in Genome Browser
Species Human (GRCh38)
Location 3:175293151-175293173
Sequence CAAGATAATTAGTTGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966026745_966026750 30 Left 966026745 3:175293151-175293173 CCTAACTCCAACTAATTATCTTG 0: 1
1: 0
2: 0
3: 19
4: 181
Right 966026750 3:175293204-175293226 CTTTGCAGAAGCAGAGCTACAGG 0: 1
1: 0
2: 1
3: 16
4: 171
966026745_966026749 7 Left 966026745 3:175293151-175293173 CCTAACTCCAACTAATTATCTTG 0: 1
1: 0
2: 0
3: 19
4: 181
Right 966026749 3:175293181-175293203 ACTTATTTATGTAAGTAGACAGG 0: 1
1: 0
2: 0
3: 28
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966026745 Original CRISPR CAAGATAATTAGTTGGAGTT AGG (reversed) Intronic
908032068 1:60011598-60011620 AAAGATACTTAGTTGAGGTTTGG - Intronic
910744445 1:90558234-90558256 AAAGATAAGGAGTTGGAGCTTGG - Intergenic
911882414 1:103257377-103257399 CAAGATAAATAATTCTAGTTTGG + Intergenic
912786379 1:112607785-112607807 GAAGATAATTAGTTTCATTTTGG + Intronic
912938948 1:114028113-114028135 CAACAGAACAAGTTGGAGTTAGG + Intergenic
912939052 1:114029030-114029052 CAACAAAACAAGTTGGAGTTAGG + Intergenic
913012051 1:114693030-114693052 CAAGATAATTAGTTGAATCCGGG + Intronic
914041302 1:144052778-144052800 CCAGATAATTAGTTGTTGTGGGG + Intergenic
920488173 1:206391049-206391071 CCAGATAATTAGTTGTTGTGGGG + Intronic
921415153 1:214877452-214877474 AAAGACAATTACTTGGTGTTTGG + Intergenic
923645357 1:235815008-235815030 CTAGAGAATGAGTTGCAGTTTGG - Intronic
923893121 1:238237482-238237504 CAAGAGAATCAGTTGAACTTGGG + Intergenic
924532072 1:244901986-244902008 CCAGATAATTCTTTGGTGTTGGG + Intergenic
924822489 1:247506768-247506790 TAAGATACTTCGTTGGAATTTGG - Intergenic
1066131913 10:32402859-32402881 GAAAATAAGTTGTTGGAGTTTGG + Intergenic
1067454223 10:46404689-46404711 CAAGATAATAAATTTGTGTTAGG - Intergenic
1067632980 10:47979943-47979965 CAAGATAATAAATTTGTGTTAGG + Intergenic
1070987963 10:80704576-80704598 CAAGTTAATTAGTTTGATTGTGG + Intergenic
1071809199 10:89160269-89160291 CAAGAAAATTTGATGGAATTTGG - Intergenic
1072603903 10:96961129-96961151 CAAGATAATGTGGTGAAGTTAGG + Intronic
1074367473 10:112870805-112870827 CAAGATAATCACTTGAACTTGGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078863337 11:15273997-15274019 CAAGCTAATAAGTTGTAGTCAGG + Intergenic
1079278135 11:19060841-19060863 CAAGATAAGTGATTGGAGTCAGG - Intergenic
1083464092 11:62833756-62833778 CAAGACCATGAGTTGGAGGTGGG + Intronic
1084379404 11:68801535-68801557 CAAGATAATTGTTTGAACTTGGG + Intronic
1084547721 11:69822675-69822697 CAACATAATTAGAGTGAGTTTGG - Intergenic
1085959695 11:81446396-81446418 CATGATAATTTGTTGGAATGTGG + Intergenic
1086525632 11:87722811-87722833 CAAGAGAATTAGTTAGGGTAAGG + Intergenic
1087660895 11:100986669-100986691 GATGATAAGTACTTGGAGTTGGG + Intronic
1092917698 12:13203220-13203242 CAAGATAATAACTAGGGGTTTGG - Intronic
1097737218 12:63195266-63195288 CAGGATAATTCGTTGAACTTGGG + Intergenic
1097792869 12:63833324-63833346 CAAGATGATCTGTTGGAGTTTGG - Intergenic
1098165584 12:67694215-67694237 CAAGAGAATGATTTGGAGTTCGG + Intergenic
1098931830 12:76425864-76425886 CAAGATAATTAGTGGGTCTTGGG - Intronic
1100000930 12:89834386-89834408 CAAGATTATTACTTGATGTTTGG - Intergenic
1100839412 12:98597036-98597058 CAAAAAAAGTAGTAGGAGTTGGG + Intronic
1101090802 12:101283011-101283033 TAAGATAATTAGTTCCATTTGGG + Intronic
1102559090 12:113749410-113749432 CCAGATAATTATTTGGGGTGGGG - Intergenic
1105628177 13:22134308-22134330 AAAGATACTTAGTTGGATTTGGG + Intergenic
1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG + Exonic
1107294685 13:38896391-38896413 CCAGATAATCAGTGGGGGTTAGG - Intergenic
1114920170 14:27316364-27316386 GAATTTAATTAGCTGGAGTTGGG - Intergenic
1115081757 14:29461686-29461708 CAAGTTAATTGGCTGGTGTTTGG + Intergenic
1115388115 14:32821491-32821513 CAAGTTAATTAGTTTGAATGAGG + Exonic
1116221107 14:42088463-42088485 CAATATAAAAAGTTAGAGTTAGG + Intergenic
1116425380 14:44784246-44784268 CAAGATAATAAGTTCAATTTGGG - Intergenic
1117017108 14:51529058-51529080 CAAGATGAATAGTTGGTCTTGGG + Intronic
1119443918 14:74648053-74648075 CTGGATATTTAGTTTGAGTTGGG + Intergenic
1119938517 14:78615784-78615806 CAAAACAATTAGTTGGATGTGGG + Intronic
1120245394 14:81999757-81999779 CAAAATAATTAGTTGCAGCTCGG - Intergenic
1123778098 15:23600489-23600511 CAAGATATTGAGTTAGTGTTTGG + Intronic
1125320342 15:38480434-38480456 CTAGTTAATTAGATGGAGGTAGG + Intronic
1127447347 15:59078081-59078103 CAAGCTAATTAGTCAGAGCTGGG - Intronic
1127737551 15:61858307-61858329 ATAGATAGATAGTTGGAGTTTGG - Intronic
1130505786 15:84540069-84540091 CAAGATAATTACTTGAACCTGGG + Intergenic
1134019763 16:10913405-10913427 CAAGAGAATCACTTGGACTTGGG - Intronic
1134611394 16:15611511-15611533 CTAGATAACTATTTAGAGTTTGG + Intronic
1139153040 16:64407614-64407636 AAATATAATTAGTTGTAGTGTGG + Intergenic
1140291694 16:73665304-73665326 CAGGATAATTACTTGGACCTGGG - Intergenic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1143040417 17:4031463-4031485 CAAGATAATTGGATGGAGAAAGG + Intronic
1144064323 17:11611099-11611121 CACGATAATAAATTGGAGTGAGG - Intronic
1147466054 17:40611797-40611819 CTAGTTAGTTAGTTAGAGTTAGG - Intergenic
1149374001 17:56025424-56025446 CAACATTGTTAGTGGGAGTTTGG + Intergenic
1149787725 17:59450304-59450326 AAAAATAATTAGTTGGGCTTGGG - Intergenic
1151066301 17:71154061-71154083 CAAGTCTATTAGATGGAGTTTGG - Intergenic
1154482093 18:14840444-14840466 CAGGATAATTACTTGGTCTTTGG + Intronic
1156511250 18:37638573-37638595 CAAGATACTTTCTTGGAGCTTGG + Intergenic
1157385856 18:47259789-47259811 CATGCAAATTAGTTGGAATTGGG + Intergenic
1157983373 18:52408875-52408897 CAAAATGATTTGTGGGAGTTTGG + Intronic
1158325340 18:56307833-56307855 CAAAATAATTAATTTGAGTCTGG + Intergenic
1159709317 18:71734908-71734930 TAAGACAATTGTTTGGAGTTTGG - Intronic
1161462384 19:4405959-4405981 CAAGGTAATTATTTGGAAATGGG + Exonic
1164961130 19:32430960-32430982 TTTGAAAATTAGTTGGAGTTAGG + Intronic
1166588851 19:43976726-43976748 CAAGAACATTTGTTGGAGTTTGG + Intronic
1168558627 19:57364326-57364348 GAAGATCATGGGTTGGAGTTTGG + Exonic
1168700799 19:58438396-58438418 GAAGATAAAGAGTTGGATTTTGG - Intronic
925060909 2:889224-889246 TAAGGTAATTATTTGGGGTTTGG + Intergenic
925273782 2:2634770-2634792 TGAGTTAGTTAGTTGGAGTTGGG + Intergenic
926771605 2:16382011-16382033 CATGAGAACTAGTTGGATTTTGG + Intergenic
929643159 2:43601997-43602019 AAAAATAATTATTTAGAGTTGGG + Intergenic
930329624 2:49965357-49965379 CAAGATAATTGTTTGAACTTGGG - Intronic
932543551 2:72682976-72682998 ATAGCAAATTAGTTGGAGTTAGG - Intronic
933283935 2:80363935-80363957 CAAGAAAATTAGCTGTAATTGGG - Intronic
933541478 2:83648553-83648575 TAAAATAATTGTTTGGAGTTGGG + Intergenic
935035184 2:99364178-99364200 CAAGAGATTTATTTGAAGTTTGG + Intronic
935885154 2:107610347-107610369 CAAGTAAATTAGTTAGATTTTGG - Intergenic
939593503 2:144095875-144095897 CAAGTTATTTGGTTGGAGATTGG - Intronic
941280231 2:163540726-163540748 CAAAACAATTAGCTGGAGTGTGG + Intergenic
942381319 2:175394259-175394281 CAAGATACTTATTTGGTGGTGGG - Intergenic
943381892 2:187160108-187160130 CAACAGTGTTAGTTGGAGTTTGG - Intergenic
944985116 2:205167308-205167330 CCAGATAATTCTTTGGAGTGAGG - Intronic
948032728 2:234832705-234832727 CAAGCTCATTAGTGGCAGTTAGG - Intergenic
948497939 2:238366361-238366383 AAAGATAATTAGGAGGAGATAGG + Intronic
1169374544 20:5055903-5055925 CAGGATAATCAGTTGGATCTGGG + Intergenic
1170087445 20:12550276-12550298 CATGATAATTAAGTGGAGCTTGG + Intergenic
1170893961 20:20397836-20397858 CAAGAAAATTATTTGGGGTTAGG + Intronic
1173112225 20:40202839-40202861 CAAGATAATCACTTGAACTTGGG + Intergenic
1174075817 20:47935694-47935716 CAAGATAATTATTTGTTGTGTGG + Intergenic
1175566765 20:59985959-59985981 CCAGATGATTATTTGGAGTGGGG + Intronic
1176596412 21:8701980-8702002 CAAGATAATTGCTTGGACCTGGG - Intergenic
1176798511 21:13396175-13396197 CAGGATAATTACTTGGTCTTTGG - Intergenic
1180279325 22:10679429-10679451 CAAGATAATTGCTTGGACCTGGG - Intergenic
1182785147 22:32901464-32901486 CAAGATAAGGAATTGGACTTGGG - Intronic
1183298828 22:37048237-37048259 CAAGATAGATAGTTGGGGTGGGG - Intergenic
951726336 3:25765162-25765184 CAAGATAAAAAGTTGCAGCTGGG + Intronic
953487596 3:43316923-43316945 CAAGAAAATGAGTTGGAATGAGG - Intronic
953995471 3:47516114-47516136 CAAGATAATTACTTGAAGCCAGG + Intergenic
957158066 3:76571583-76571605 CAATATAATTCATAGGAGTTAGG + Intronic
957518234 3:81284156-81284178 AAAGATAATTAATTGGACTTTGG + Intergenic
959094510 3:101939200-101939222 AGAGACAATCAGTTGGAGTTTGG - Intergenic
963137826 3:141923813-141923835 TATGTTCATTAGTTGGAGTTTGG + Intronic
963569155 3:146970339-146970361 CGTGACAATTAGTTGGAGCTAGG + Intergenic
965441664 3:168722299-168722321 CAAGGTAAGTAGTTGGGGTTGGG + Intergenic
965860014 3:173137274-173137296 CAAGATAATGGGATGGGGTTGGG - Intronic
966026745 3:175293151-175293173 CAAGATAATTAGTTGGAGTTAGG - Intronic
966906173 3:184527363-184527385 CAAGATAATTACTTGAACTCAGG + Intronic
970078638 4:12254225-12254247 CAAGAAAATTAGGTGGAAATAGG + Intergenic
971926859 4:33022538-33022560 CAGGAGAATCACTTGGAGTTAGG - Intergenic
972981230 4:44704539-44704561 CAAAATAATTATTTCTAGTTTGG - Intronic
973586091 4:52392968-52392990 TAAGATGATTAGTTTGATTTGGG - Intergenic
973768887 4:54188610-54188632 CACGATAATTACTTGAACTTGGG + Intronic
974235570 4:59177237-59177259 AAAAATACTTTGTTGGAGTTAGG + Intergenic
978541432 4:109820336-109820358 GAAGATAATGAGTTGGGTTTTGG + Intronic
978774797 4:112494964-112494986 CAAGATAATTATATAAAGTTTGG - Intergenic
983111450 4:163755144-163755166 CAAGATAATTATTTGCTGTGAGG - Intronic
983337724 4:166418159-166418181 AAATATTATTAGTTAGAGTTTGG - Intergenic
984247625 4:177294800-177294822 CCTGATAATTAGTTGAAGTGGGG + Intergenic
986340016 5:6780891-6780913 CCAGATAATTATTTAGTGTTGGG + Intergenic
986781704 5:11072557-11072579 CAAGAAAATTAGTTGAAATTCGG - Intronic
988615212 5:32768629-32768651 GAAGATCATTAGGTAGAGTTAGG - Intronic
989246164 5:39257380-39257402 CAAGATACTTATTTTGACTTAGG + Intronic
992183441 5:74220731-74220753 AAAGATAATTAGGAAGAGTTGGG - Intergenic
992472742 5:77074670-77074692 GGAATTAATTAGTTGGAGTTAGG + Exonic
992717609 5:79526477-79526499 CATGCTAACTATTTGGAGTTAGG - Intergenic
994195871 5:96922366-96922388 TAATATATTGAGTTGGAGTTGGG + Intronic
994335119 5:98555767-98555789 GAAGATAATTAGATGAAGCTAGG + Intergenic
995864243 5:116674252-116674274 GATGATAATTAGTTGAAATTAGG + Intergenic
997192377 5:131949098-131949120 AAAGATGAATGGTTGGAGTTAGG + Intronic
998524766 5:142832253-142832275 CAATATAACTACTTGGAGATAGG + Intronic
999920432 5:156312804-156312826 TAAGAAAATTAGTTGGAATTAGG + Intronic
1000112315 5:158120714-158120736 CAAGAAATTTTGATGGAGTTAGG + Intergenic
1002887411 6:1310027-1310049 CAAGAGAGTGAGTTGGAGGTGGG - Intergenic
1004057416 6:12154053-12154075 CAAGAGAATCAGTTGAAGCTGGG + Intronic
1005690037 6:28295870-28295892 CAAAATAATTATCTGTAGTTTGG + Intronic
1007868512 6:45004642-45004664 CAAGATTTTGAGTTGGAATTTGG - Intronic
1009838352 6:69034287-69034309 TAAGGTAAGTATTTGGAGTTAGG - Intronic
1012017628 6:93871831-93871853 CAAGTTAGTTATTTGTAGTTAGG - Intergenic
1015759152 6:136639093-136639115 CAATATAATTAGTCTGAGGTGGG + Intronic
1016474804 6:144415647-144415669 CAAGATTTTTATTTGGAGTTTGG + Intronic
1017879569 6:158550561-158550583 CAAGATAATTGCTTGAACTTGGG + Intronic
1018449180 6:163890780-163890802 TAATATAATTAGTAAGAGTTGGG + Intergenic
1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG + Intronic
1020802502 7:12748747-12748769 CAAGAGAATTGGTTGAACTTGGG + Intergenic
1021222186 7:17986833-17986855 CATGATAACCAGTTGGAGATCGG - Intergenic
1021658483 7:22895204-22895226 CAAAATAAGGAGTTGGGGTTGGG - Intergenic
1022772981 7:33494275-33494297 CCAGATAATTTGTTGTTGTTGGG - Intronic
1023090475 7:36613457-36613479 CAAGATAATTTTCTTGAGTTGGG - Intronic
1023578835 7:41659541-41659563 CCAGAAAATTATTTGGAGTCTGG + Intergenic
1024937753 7:54728790-54728812 CAAGATAATTTGGTGAAGTGAGG - Intergenic
1026411788 7:70130626-70130648 CAATATAATGAGATGGAGGTGGG + Intronic
1027917587 7:84345823-84345845 AAATATCATTAGCTGGAGTTTGG - Intronic
1028965167 7:96793989-96794011 GAAGATAATGAGTTTGATTTGGG + Intergenic
1030009848 7:105155071-105155093 CAAGAGAATCACTTGGACTTGGG - Intronic
1030018310 7:105246376-105246398 CAAGATAATGAGTTTGGTTTAGG + Intronic
1031571978 7:123370253-123370275 CTAGATGAATGGTTGGAGTTGGG - Intergenic
1031583060 7:123500901-123500923 CAATATCATTTTTTGGAGTTTGG + Intronic
1036403079 8:8427757-8427779 CTAGAGAATTAGTTGGAGCTAGG - Intergenic
1036474552 8:9081302-9081324 CAAGATAATTAATGGGAGAAAGG + Intronic
1039863238 8:41477633-41477655 AAAGAGAATTAGCTGAAGTTTGG + Intergenic
1041542491 8:59002065-59002087 CAGGATAATTACTTGAATTTGGG - Intronic
1042286871 8:67123191-67123213 CAAGAATAATAGTTGGAGTCCGG - Intronic
1042487496 8:69362686-69362708 CAAGATATGTAGGAGGAGTTCGG - Intergenic
1043315020 8:78909706-78909728 AAAGATAAATAATTGGAGTGAGG + Intergenic
1043875065 8:85476561-85476583 AAAGATAATTAGTTTGGGGTAGG - Intronic
1043984395 8:86676557-86676579 GAAGATAATTAGTTGCAGTAAGG + Intronic
1045127831 8:99113328-99113350 CAAGAGAATTACTTGAAGCTAGG - Intronic
1045708643 8:104957585-104957607 TAAGAAAATTAGATTGAGTTAGG + Intronic
1045870790 8:106924639-106924661 CAGGAGAATAAGTTGGAGATAGG - Intergenic
1047124222 8:121942577-121942599 CAAGTTATATAGTTTGAGTTTGG + Intergenic
1047542591 8:125784952-125784974 CAAGAAAATGACTTGGAGTTTGG + Intergenic
1047635900 8:126762003-126762025 CATGATAATAAGTTGTACTTTGG - Intergenic
1048301009 8:133251297-133251319 CCAGATGAGAAGTTGGAGTTGGG + Intronic
1049701749 8:144017854-144017876 CAAGAAAATGAGTTGTATTTTGG + Intronic
1050670141 9:7987355-7987377 TGAGATAATCAGTTGGTGTTTGG + Intergenic
1052638935 9:31139074-31139096 AAAGATAATTGGTTTGAGTTAGG + Intergenic
1052913301 9:33903851-33903873 CCACATAACTAGTTGTAGTTGGG - Intronic
1053195230 9:36112400-36112422 CAAGACCATCAGTTTGAGTTTGG + Exonic
1055472608 9:76628239-76628261 CAAAATAAATACTTGGAGCTGGG - Intronic
1057509813 9:95668892-95668914 CAAGATAATTTGCTGAAGGTTGG + Intergenic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1194018299 X:88654531-88654553 CAAGATAATTTGTTGGCATTTGG - Intergenic
1196246026 X:113401581-113401603 CAAAATTATTAGTTGGTGTGTGG + Intergenic
1198964259 X:142210679-142210701 CAGGAGAATGAGGTGGAGTTTGG + Intergenic
1199190098 X:144961046-144961068 CAAGATCTTTAGCTGGAGTAGGG - Intergenic
1199507482 X:148580662-148580684 AAAGAAAATTATTTGAAGTTAGG + Intronic
1201515017 Y:14810434-14810456 CAAGATAATCACTTGAATTTGGG + Intronic
1201537482 Y:15066873-15066895 CAGGATAATTGCTTGAAGTTAGG + Intergenic
1202364174 Y:24144552-24144574 CAAGATAATTACTTGAACCTGGG - Intergenic
1202506606 Y:25525570-25525592 CAAGATAATTACTTGAACCTGGG + Intergenic