ID: 966028421

View in Genome Browser
Species Human (GRCh38)
Location 3:175315108-175315130
Sequence GGAGCTATAATGTAGCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966028419_966028421 9 Left 966028419 3:175315076-175315098 CCAATGATGCATTCTTTGTTATT 0: 1
1: 0
2: 2
3: 34
4: 419
Right 966028421 3:175315108-175315130 GGAGCTATAATGTAGCTTGATGG 0: 1
1: 0
2: 1
3: 14
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966028421 Original CRISPR GGAGCTATAATGTAGCTTGA TGG Intronic
902452209 1:16503691-16503713 GGAGGTATAATGTCACTAGATGG - Intergenic
907014244 1:50996112-50996134 GGAGATAAAATTTAGCTTTACGG + Intergenic
913644852 1:120846072-120846094 GGAGGTATAATGTCACTTGATGG - Intergenic
914004304 1:143718954-143718976 GGAGGTATAATGTCACTTGATGG - Intergenic
914081874 1:144417495-144417517 GGAGGTATAATGTCACTTGATGG + Intergenic
914099229 1:144569338-144569360 GGAGGTATAATGTCACTTGATGG - Intergenic
914176782 1:145285999-145286021 GGAGGTATAATGTCACTTGATGG + Intergenic
914200154 1:145477211-145477233 GAAGGTATAATGTCACTTGAGGG - Intergenic
914299756 1:146368334-146368356 GGAGGTATAATGTCACTTGATGG + Intergenic
914479270 1:148050363-148050385 GAAGGTATAATGTCACTTGAGGG - Intergenic
914531509 1:148527490-148527512 GGAGGTATAATGTCACTTGATGG + Intergenic
914636882 1:149560234-149560256 GGAGGTATAATGTCACTTGATGG - Intergenic
915314468 1:155020212-155020234 AGAGCAAGAAAGTAGCTTGAAGG - Intronic
919048959 1:192488721-192488743 GGAGATATGATGCAACTTGAGGG - Intergenic
924046396 1:240036134-240036156 AGAGTTATAATATAACTTGAAGG + Intronic
1064625426 10:17256581-17256603 TTAGCGATTATGTAGCTTGATGG - Intergenic
1069183791 10:65396799-65396821 GGAGCTATAAGGGAGATTAATGG - Intergenic
1070439122 10:76425483-76425505 GGAGATAAAATCTACCTTGAAGG + Intronic
1073170940 10:101508011-101508033 GAAGCTATAAAGTTGCATGAGGG + Intronic
1074557856 10:114508358-114508380 GGAGCTAGAATGTATCTTAAAGG - Intronic
1076039935 10:127237593-127237615 GGAGCTAAAATATAACTAGAGGG - Intronic
1087764746 11:102138347-102138369 GGAGCTATACTGGGGCTGGAGGG + Intronic
1090411739 11:126513885-126513907 GGAGCTATAATATAACTTAGAGG + Intronic
1091827838 12:3527167-3527189 GGTGCTATAATATTACTTGAAGG - Intronic
1096085660 12:48863543-48863565 TGGGCTAGAATGCAGCTTGATGG - Intronic
1097685284 12:62685129-62685151 GCACCTATAATTTAGCTTAATGG - Intronic
1101089736 12:101272951-101272973 GGAGATAGAATGTAGAATGATGG + Intergenic
1106741594 13:32648944-32648966 GGGGCTATAATGTATCTTGTTGG + Intronic
1111545785 13:89734230-89734252 GGTGGTAAAATCTAGCTTGAAGG + Intergenic
1116992221 14:51288484-51288506 CGAGTTATAATGAAGCTTAAAGG - Intergenic
1118164330 14:63321274-63321296 GGAACTTCAATGTAGATTGAAGG - Intergenic
1123504249 15:20923167-20923189 GCAGCTTTGATGCAGCTTGAAGG - Intergenic
1123561494 15:21496864-21496886 GCAGCTTTGATGCAGCTTGAAGG - Intergenic
1123597738 15:21934144-21934166 GCAGCTTTGATGCAGCTTGAAGG - Intergenic
1130362512 15:83204450-83204472 GGAACTATTATGTAGATAGAGGG + Intronic
1131758425 15:95592512-95592534 AGAGCTAGAATGTAATTTGAAGG + Intergenic
1202969839 15_KI270727v1_random:223988-224010 GCAGCTTTGATGCAGCTTGAAGG - Intergenic
1133213614 16:4277005-4277027 AGAGCTATACTGAAGCCTGAGGG - Intergenic
1133839879 16:9398128-9398150 GGAGCTATTTTGTTCCTTGATGG + Intergenic
1146524241 17:33552460-33552482 GGAGGTAGCATGTAGCATGATGG + Intronic
1147230279 17:39012527-39012549 GGAGATAAAAAGTAGCCTGAGGG - Intergenic
1148898526 17:50856090-50856112 GTAGTTAAAATGTAGCTTGGTGG - Intergenic
1156133775 18:34010180-34010202 GGAGATATAGTGTAGAATGATGG - Intronic
1156560161 18:38115770-38115792 GGAGCTACAATTTTGCTTTAGGG + Intergenic
1158195518 18:54881091-54881113 GGAGTGATAATGTAGCTTTGGGG + Intronic
1159867278 18:73721046-73721068 GGATCTAGACTGTAGCTTGCAGG - Intergenic
1160363626 18:78305908-78305930 GGGGCTAAAATGGAACTTGAAGG + Intergenic
1166428997 19:42707547-42707569 GGAGCAAGAATGTAGATTCAAGG - Intronic
928310036 2:30202016-30202038 GAAGCTATAAAGTCTCTTGAGGG - Intergenic
929674562 2:43912942-43912964 AGAGGTATAATTTAGATTGAGGG + Intronic
931098516 2:58969385-58969407 AGAGCTCTAATGAAGCTTCAAGG - Intergenic
931980023 2:67684935-67684957 GGAGCTATAATGCTCCTTAATGG - Intergenic
945196226 2:207239687-207239709 GGAGATATCATGTAGCTATAGGG + Intergenic
945252615 2:207777249-207777271 GGTTCTATAATCTAGCTTAAGGG - Intergenic
948201416 2:236132247-236132269 GAAGATATAATGTAGTTTGTAGG - Intergenic
1172007248 20:31825956-31825978 GGATGTATAATCTAGCTTGAAGG + Intronic
1172546158 20:35763268-35763290 GGGGCAATGATGTAGCTTGTAGG - Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1180680644 22:17624198-17624220 CGAGCTTTCATGTAGCATGAAGG + Intronic
951948340 3:28168295-28168317 GGAGCAATAATGTTCCTTCAGGG + Intergenic
952649488 3:35708115-35708137 GGAGCCATGGTGTAGCTTGGTGG - Intronic
956841466 3:73143883-73143905 CAAGCTAAAATGTTGCTTGAGGG + Intergenic
958459283 3:94374105-94374127 GAAGCTGTAATTTAGCTTTAGGG + Intergenic
966028421 3:175315108-175315130 GGAGCTATAATGTAGCTTGATGG + Intronic
966225438 3:177592568-177592590 GCAGCTGTAATTTAGCCTGATGG - Intergenic
968007177 3:195251072-195251094 TGTGCTTTCATGTAGCTTGAGGG - Intronic
970782363 4:19753482-19753504 GGAGATCTAATGTAGCTTGATGG - Intergenic
973934647 4:55831209-55831231 GCAGCTATAATGTGGGTTCAAGG + Intergenic
975324466 4:73043705-73043727 GGAGCTTTATTGTAGATTCATGG - Intergenic
978322400 4:107512344-107512366 GGGGCTTTAATGGAGCCTGAGGG + Intergenic
978616048 4:110597051-110597073 GAAGCTCTAATGTGACTTGATGG + Intergenic
982451988 4:155563729-155563751 GGAGTTAGAATGTATTTTGAAGG + Intergenic
984009164 4:174349627-174349649 GGAGCAAGAATGGATCTTGAAGG - Intergenic
986346443 5:6839727-6839749 AGAACTATGATGTCGCTTGAAGG + Intergenic
993876340 5:93311495-93311517 GTAGCTATAAAGTAGCTATATGG - Intergenic
996224314 5:120971615-120971637 GGATCTATAATTTACCTTCAAGG + Intergenic
996656961 5:125951604-125951626 GAACCTATTATGTAGCCTGAAGG - Intergenic
998593855 5:143507044-143507066 GGAGATATAATGTCATTTGAAGG + Intergenic
1006396711 6:33792053-33792075 CCACCTATAATGTAGTTTGAAGG - Intergenic
1007054317 6:38867308-38867330 GTGGCTATAAAGTAGCATGAGGG - Intronic
1007066801 6:38998821-38998843 AGAGCTATAATATTCCTTGAGGG - Intronic
1007805164 6:44438272-44438294 GGAACTTGAATGTAACTTGATGG + Intronic
1008222312 6:48870117-48870139 GAAGCTATAATGTACATAGAAGG + Intergenic
1008567128 6:52780334-52780356 GGACCTATTTTGTAGCTGGATGG - Intergenic
1010734185 6:79424638-79424660 GGAGATCTAATCTAGCTTTAGGG - Intergenic
1012905454 6:105059655-105059677 TGAGCTATAATGTAACTCTATGG - Intronic
1016462603 6:144292998-144293020 GCAACTATTGTGTAGCTTGACGG + Intronic
1018737929 6:166702770-166702792 GGACCTAGAAGGTATCTTGAAGG - Intronic
1023275182 7:38511098-38511120 AGAGCTATCATGAAGGTTGAGGG + Intronic
1031463241 7:122077837-122077859 GCAGCCAAAATGTTGCTTGATGG - Exonic
1033317312 7:140308217-140308239 GGAGCTGAAATGTAGGTTGAAGG + Intronic
1035332564 7:158105836-158105858 GGAGCTGCAATGGAGCTGGATGG - Intronic
1038428370 8:27479989-27480011 TGAGCTAGCAAGTAGCTTGAGGG - Intergenic
1042128653 8:65564687-65564709 TGAACTTTAAAGTAGCTTGATGG + Intergenic
1042376429 8:68057539-68057561 TGAGCTATACTGTTGCTTGTAGG + Intronic
1046013299 8:108575863-108575885 GGAGCTATAAGGGATCTTAAGGG + Intergenic
1047132486 8:122036751-122036773 GGAGCTATAATTTGGTTTGATGG - Intergenic
1047366224 8:124214168-124214190 GGAGATATGATGAAGCATGATGG - Intergenic
1049233952 8:141499712-141499734 GAAGCTATAATTTCACTTGAAGG + Intergenic
1051144451 9:14011388-14011410 AGAGCTATAATGTTGCTTTAGGG - Intergenic
1052315820 9:27115818-27115840 GAAGCTGTAATGTAGGATGAAGG + Intronic
1055405269 9:75967503-75967525 GCAGCTATGATGTACCTTAAGGG + Intronic
1185963118 X:4567669-4567691 TGCTATATAATGTAGCTTGAGGG + Intergenic
1187145213 X:16630767-16630789 GGAGCTTTAAATTAGGTTGATGG + Intronic
1191013596 X:55786912-55786934 GGACCTTTAATGCAGCTTGGAGG + Intergenic
1195270112 X:103220753-103220775 GGAGCTATGATGTGGCATGGGGG - Intergenic
1199067484 X:143437203-143437225 AGAGCTATAATGAAGCCAGAGGG + Intergenic