ID: 966030388

View in Genome Browser
Species Human (GRCh38)
Location 3:175339116-175339138
Sequence TCCTCAAGTCTGCTGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966030388_966030390 -4 Left 966030388 3:175339116-175339138 CCATTCTTCAGCAGACTTGAGGA 0: 1
1: 0
2: 0
3: 18
4: 173
Right 966030390 3:175339135-175339157 AGGAGGATAAAGTTAAATCTTGG 0: 1
1: 0
2: 2
3: 19
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966030388 Original CRISPR TCCTCAAGTCTGCTGAAGAA TGG (reversed) Intronic
902939929 1:19793704-19793726 TCCTCCAGACTGCTGAAGCGAGG - Intronic
903392319 1:22973055-22973077 TGCTCCAGGCTGGTGAAGAAAGG + Intergenic
905320675 1:37114608-37114630 TCCCCAAGTCTGCTGACCATGGG + Intergenic
906127179 1:43434066-43434088 TTCTCAAGTCTTCTTCAGAATGG - Intronic
907867103 1:58408971-58408993 ACCTCAAGTTTCCTGAAGACAGG - Intronic
909224048 1:72993625-72993647 TCCCTAAGTCAACTGAAGAATGG + Intergenic
909706503 1:78591284-78591306 TCTTGAAGTCTGCTGAGTAAAGG - Intergenic
911187924 1:94921939-94921961 TCCTGAATACTGCTGGAGAAGGG - Intronic
914827009 1:151144017-151144039 GCCTCAAGAGAGCTGAAGAAAGG + Intronic
914877662 1:151524410-151524432 TCCTCAAGTCTGCTCATCCATGG + Intronic
916790600 1:168121822-168121844 TCCTCAAGCCTGCTCTGGAAGGG - Intronic
920224642 1:204429763-204429785 TGCTCCAGTCTGCAGAAGACAGG - Intronic
920816713 1:209341247-209341269 TCCTCAAGCCAGCTGAAGGATGG + Intergenic
922438481 1:225629640-225629662 TCCTTAAGGATGCTTAAGAATGG + Intronic
922879067 1:228965838-228965860 TTCTCAAGTCTGCAGGACAAGGG + Intergenic
923869424 1:237974690-237974712 TCCTGAAGTCTGCAGAATGAAGG - Intergenic
1069850178 10:71398984-71399006 TCCTCACGTCTGCTTACCAAAGG + Intronic
1070803206 10:79255389-79255411 TGAGCAAGTCTGCTGAAGCATGG + Intronic
1072008675 10:91284844-91284866 TCTTCAAGGCTGCTGCAGAATGG + Intergenic
1073629685 10:105135930-105135952 TCCCCACTTCTTCTGAAGAAGGG + Intronic
1074998815 10:118779978-118780000 TCCACAAGACTGATGAAGAGAGG - Intergenic
1077723036 11:4646419-4646441 TCCCCATGTCTCCTTAAGAAGGG - Intronic
1077991027 11:7412716-7412738 ACATCAAGTCTGCTGACCAAGGG - Intronic
1078254346 11:9644715-9644737 TCCTCAAGTCATCAGCAGAAGGG - Intergenic
1079308039 11:19341839-19341861 TCCTCAAGTCTTCTCAAGATTGG + Intergenic
1079953361 11:26832185-26832207 TGCTCAAGTAGGCTGAAGAGAGG - Intergenic
1080751600 11:35155637-35155659 TACTCAAGTGTGCAGAAGACTGG - Intronic
1084230143 11:67746235-67746257 TCCTCAATGCTGCTGGAGAGAGG - Intergenic
1084466639 11:69327166-69327188 TACTCAAGTTTGCTGAGGATTGG + Intronic
1085144345 11:74179724-74179746 TCCTGAAGTCTGCTGCTTAATGG + Intronic
1088350651 11:108883835-108883857 TCCTGAAGTTTACTGAAGAAGGG - Intronic
1089669170 11:120040541-120040563 TCCTCAAGTCAGCTGAGGGCTGG - Intergenic
1090264416 11:125345006-125345028 TCCTCCAGTCTGCTGAGGTCAGG - Intronic
1091670538 12:2449170-2449192 TCCTTAAGTCAGCTGAAGACAGG + Intronic
1092318561 12:7446172-7446194 TCCACAAATGTGCAGAAGAAAGG + Intronic
1092485506 12:8899320-8899342 TGCTTAGGTCTGATGAAGAATGG + Intergenic
1094170096 12:27482029-27482051 GCCTAAAGTCAGCAGAAGAAAGG - Intronic
1094301655 12:28970849-28970871 TGCTCAGGTTTGATGAAGAATGG - Intergenic
1095905726 12:47376226-47376248 TCATCAAGGCTGCAGAAAAAAGG + Intergenic
1096311283 12:50523183-50523205 TGCTCAAGTCTGCTAAAAAATGG + Intronic
1096944866 12:55392730-55392752 TCCTCAAGCCGGCTGCAGCAGGG - Intergenic
1099078688 12:78146498-78146520 TCCACAGGACTGCTGAAGTAAGG + Intronic
1099825262 12:87768565-87768587 TCCTCAAGTCTCATGATCAATGG + Intergenic
1099916524 12:88901828-88901850 TCCTGTAGACTGATGAAGAAAGG - Intergenic
1100205757 12:92347434-92347456 CCCTCAAGTTTTCTGAAAAATGG + Intergenic
1102440734 12:112962324-112962346 TCCTAAAGGCTGCTGATGGATGG + Intronic
1104117608 12:125764664-125764686 TCCTCAGGTGTGCAGAAGGATGG - Intergenic
1104480832 12:129106656-129106678 TCCTCCAATCTGCCCAAGAAGGG - Intronic
1107352628 13:39531821-39531843 GCCACAAGTAAGCTGAAGAAAGG + Intronic
1111653845 13:91128557-91128579 TGCTCAAGTCTGCTGATGACTGG + Intergenic
1113216647 13:108048658-108048680 TCCTCAGGGCTGCTGTAGCACGG + Intergenic
1115447153 14:33504179-33504201 TCCTCATGTATGATGAAGCATGG - Intronic
1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG + Intergenic
1117488166 14:56219819-56219841 GCCTCAAGTCCGCTGTGGAATGG - Intronic
1123564036 15:21523535-21523557 TCCTCAAATTTCCAGAAGAATGG - Intergenic
1127049018 15:55060664-55060686 TCCTGAAGAATGCTGAATAAAGG + Intergenic
1127613031 15:60655708-60655730 TACTCATACCTGCTGAAGAAGGG + Intronic
1130208779 15:81903525-81903547 TCCCCAAATCTGGGGAAGAAAGG - Intergenic
1132026098 15:98405589-98405611 TCCCCAAGTCTGATGAAAACTGG + Intergenic
1133649694 16:7800045-7800067 ACAACATGTCTGCTGAAGAAGGG - Intergenic
1134097895 16:11431157-11431179 TCCTCAAGGCATCTGAGGAATGG - Exonic
1137601221 16:49757702-49757724 TCATCAATTCTGGTGAAGAAAGG + Intronic
1138232626 16:55350188-55350210 TCCTCATCTTGGCTGAAGAAAGG + Intergenic
1140862626 16:79031427-79031449 TCTTCAAGTGGGCTGAAGAAAGG + Intronic
1141306874 16:82873056-82873078 TCTGCATGGCTGCTGAAGAATGG + Intronic
1141442790 16:84040333-84040355 TCCTCAAGTCTGCTGAGTGAAGG + Intronic
1146690063 17:34867227-34867249 ACTTCAAGTCTGCCCAAGAAAGG - Intergenic
1153053624 18:924605-924627 TGCTTAAGTCTGCTCAAAAAGGG - Intergenic
1155726518 18:29091996-29092018 CCCTCAGGTCTGCTCAAGACAGG - Intergenic
1156187510 18:34680336-34680358 CCCTCTATTCTGCTGAAAAATGG - Intronic
1157316497 18:46594205-46594227 TTCTCAAGTCTCCTCCAGAAAGG - Intronic
1157347911 18:46856786-46856808 TACTCCAGTCTTCTCAAGAAAGG - Intronic
1158178575 18:54685997-54686019 TCCTCAAATCTCCTGAATATTGG - Intergenic
1158875813 18:61733495-61733517 ACTTCAATTCTGCTGAAAAAGGG - Intergenic
1166227927 19:41408559-41408581 TCCTCAGGTCAGATGAGGAATGG - Intronic
1168635951 19:57997110-57997132 TCCTCAAGTCTGACCAAGCATGG + Intronic
925618895 2:5770933-5770955 TGCTCTTGTCTCCTGAAGAATGG - Intergenic
927047748 2:19297050-19297072 TCATCAAGGCTGATCAAGAATGG + Intergenic
928079823 2:28300942-28300964 TACTCAGTTCAGCTGAAGAATGG - Intronic
928657055 2:33463498-33463520 TTCTCCAGGATGCTGAAGAAAGG + Intronic
932450507 2:71807711-71807733 TCATCAATTCTTCTCAAGAAAGG - Intergenic
933875770 2:86620458-86620480 CCATCAAGTCACCTGAAGAAAGG + Exonic
935028017 2:99296134-99296156 TCCTCAAACCTGAAGAAGAAGGG - Intronic
935301051 2:101694285-101694307 TCCTCAAGCGTGCTGAGGAAAGG + Intergenic
937043335 2:118837335-118837357 TCCTCAACTCTGATGAGGAGTGG - Intergenic
939259350 2:139787231-139787253 TACTCAACTCTGCTGATGTAGGG - Intergenic
940329016 2:152454743-152454765 TCCTCTTGTATGCTGATGAAAGG - Intronic
942276939 2:174329849-174329871 TCCTCAAATCTGCCTATGAAAGG + Intergenic
943052125 2:182926877-182926899 TCCTCCAGTCTACTGAAAATTGG - Exonic
943694529 2:190910576-190910598 ATTTAAAGTCTGCTGAAGAAAGG + Intronic
945368181 2:208982647-208982669 TCCTAAAATCTGGTGAAAAATGG + Intergenic
946075431 2:217069944-217069966 TCCTCGCATCTGCTGAAGGAGGG - Intergenic
947227811 2:227857199-227857221 TCCTTAATTCAGCTGAAGATGGG + Intergenic
948869809 2:240792238-240792260 TCCCCGATTCTGCTGGAGAAAGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170515816 20:17129332-17129354 TCATCATGTCTGCAGAGGAAAGG - Intergenic
1173919972 20:46736975-46736997 GCCTCAAATATGCAGAAGAAAGG - Intergenic
1174344425 20:49919473-49919495 GCCACAAGTCAGCTGAAGCATGG - Intergenic
1177862896 21:26475465-26475487 TCCTTAAGTCTGAGGAAGAAAGG - Intronic
1178754773 21:35338068-35338090 TCCTCAAGGCTGTGAAAGAAGGG - Intronic
1185358051 22:50386865-50386887 ACCTCTATTCTGTTGAAGAAAGG + Intronic
949754595 3:7394220-7394242 AACTGAAGTCTGCTGAATAATGG - Intronic
951844269 3:27068900-27068922 TCCTCAAGTACTGTGAAGAATGG - Intergenic
953125778 3:40090514-40090536 TCATCATTTCTGCTGAAGGATGG + Intronic
955408682 3:58642143-58642165 TCCTCAAAGCTGCAGAGGAACGG + Intronic
956631595 3:71322134-71322156 CCCTAAAGTCTGCTAAACAACGG - Intronic
957046711 3:75381263-75381285 TCCTCAATGCTGCTGGAGACAGG - Intergenic
960855466 3:122098023-122098045 GCACCAAGTCTGCTGTAGAAAGG + Intronic
961658627 3:128456873-128456895 TCCTCTTGTCTGCTGGGGAAGGG - Intergenic
961878776 3:130045331-130045353 TCCTCAATGCTGCTGGAGAGAGG - Intergenic
962622624 3:137195049-137195071 TGCTCAAGTCTCCTGAATCATGG - Intergenic
962880861 3:139575158-139575180 TCCTTAAGTCTGCTGAATTCAGG + Intronic
966030388 3:175339116-175339138 TCCTCAAGTCTGCTGAAGAATGG - Intronic
967100678 3:186212906-186212928 TCCTCAGGTTTGCAGATGAAGGG + Intronic
968592774 4:1467133-1467155 TGTTCAAGCCTGCTGAAGAGGGG - Intergenic
969502345 4:7560723-7560745 TCCTCAAGCCTGCTGGAGAGGGG + Intronic
969824340 4:9745156-9745178 TCCTCAATGCTGCTGGAGAGAGG + Intergenic
970354665 4:15239910-15239932 TCTTCAAGTCTTCAGATGAATGG + Intergenic
971072480 4:23110618-23110640 TCCCCAAGTGTGCCAAAGAAAGG - Intergenic
971327547 4:25656504-25656526 TCCCCAAGACGGCTGAAGGACGG - Intronic
973635365 4:52857360-52857382 TCCCTAATTCTGCGGAAGAAGGG - Intergenic
974561741 4:63532107-63532129 TCTTCATGTCTGCTGATGTATGG - Intergenic
974767606 4:66367720-66367742 TCCTCATTTCTCCTGAAGCATGG - Intergenic
974924937 4:68285915-68285937 TCCTCAGCTCTGCAGAAAAATGG - Intergenic
976014984 4:80542099-80542121 ACCTGAAGTCTGATGAACAAGGG - Intronic
980146278 4:128988227-128988249 TCTTCTAGTCTTCTGATGAAAGG - Intronic
983520293 4:168701475-168701497 TCCTCAGGTTTTCTGAAAAATGG + Intronic
985106356 4:186503905-186503927 TCATCCAGTCAGTTGAAGAAGGG - Intronic
985715968 5:1461769-1461791 TCCGCAGGTCTGCAGATGAAGGG - Exonic
988392012 5:30646432-30646454 TCCTCAAGTCATAGGAAGAAGGG + Intergenic
988724000 5:33907416-33907438 TCACCAAGCCTGCAGAAGAATGG + Intergenic
994447202 5:99891731-99891753 TCCTAAAGTACTCTGAAGAATGG - Intergenic
996999130 5:129738368-129738390 TCCACATGTCTGATGAACAAAGG + Exonic
998479967 5:142454616-142454638 TCTTCATCTCTGCAGAAGAATGG - Intergenic
1001195588 5:169670605-169670627 GGCTCAAGTCTGGTGAAGAATGG - Intronic
1002318037 5:178357041-178357063 GTCTAAAGTCTGCAGAAGAAAGG + Intronic
1002791523 6:440972-440994 TCCTCTAGGCAGCTGTAGAATGG - Intergenic
1002951228 6:1813442-1813464 TTCTCAAGTCAGGTGAAGATAGG - Intronic
1002976770 6:2086547-2086569 TCCCCGAGTCAGCTGCAGAACGG - Intronic
1005958626 6:30681452-30681474 TACTCATGTCTGCTGTTGAAAGG + Intronic
1007013496 6:38439967-38439989 TCCTGAAGACTGCAGAAGATGGG + Intronic
1007070453 6:39033859-39033881 TCCTCAAGGAAGGTGAAGAAAGG - Intergenic
1007813634 6:44504371-44504393 TCCTCAAGTCTAATTAAGGAAGG - Intergenic
1008198606 6:48557952-48557974 TCATGAAAGCTGCTGAAGAATGG - Intergenic
1008450484 6:51645011-51645033 TCCTCAAATTTGCATAAGAATGG + Intronic
1008556377 6:52676560-52676582 TTCTCTAGTCTACTAAAGAAAGG - Intronic
1009006608 6:57796482-57796504 TTCTCATGTCTTCGGAAGAAGGG + Intergenic
1009008781 6:57818931-57818953 TTCTCATGTCTTCGGAAGAAGGG + Intergenic
1011553373 6:88549742-88549764 TCCACATAACTGCTGAAGAATGG - Intergenic
1012341306 6:98128306-98128328 TTCTCAATTCTGCTCTAGAATGG + Intergenic
1012657119 6:101838189-101838211 TGCTTAAGTTTGATGAAGAATGG - Intronic
1014756352 6:125305408-125305430 TCCCCTTTTCTGCTGAAGAAGGG + Intergenic
1016100055 6:140088453-140088475 TCTTCAAGACTGCTGAATACTGG - Intergenic
1017040157 6:150301796-150301818 CCCTCAGGTCTGCTAATGAAAGG - Intergenic
1018236907 6:161735404-161735426 TCCTCAAGTAAGCTAGAGAAAGG - Intronic
1018920009 6:168165912-168165934 AACTAAAGTCTGCTGAAGATTGG + Intergenic
1026453279 7:70548159-70548181 CCCGAAAGTCTGCTGAATAAGGG + Intronic
1030107973 7:106002652-106002674 CCCTGAAGTCTTCTGAAGAGAGG + Intronic
1030493170 7:110264764-110264786 TCCTTAGGTTTGATGAAGAATGG + Intergenic
1031446469 7:121860967-121860989 TCCTCAAGGCTGGAGAACAAAGG - Intergenic
1032570141 7:132987186-132987208 TTATCATGTCTGATGAAGAAAGG - Intronic
1038711907 8:29955051-29955073 GCCTCAAGGCTACTCAAGAAAGG + Intergenic
1038976170 8:32698646-32698668 TCCTGAACTCATCTGAAGAAGGG - Intronic
1042883960 8:73526565-73526587 TCCTCAAATTTACTGAAAAACGG + Intronic
1044646601 8:94449974-94449996 TAGTCCAGTCTGCTGAAGAAGGG - Intronic
1048276045 8:133066939-133066961 TCCTCAAATCTGATGGGGAAAGG + Intronic
1048955180 8:139530113-139530135 TCCTCAAGTCTTCTAAGGACAGG + Intergenic
1051007218 9:12360254-12360276 AACTCAAATCTGCTGAAAAAGGG - Intergenic
1051023979 9:12583341-12583363 TCCTTAAGTGTTGTGAAGAACGG - Intergenic
1052274475 9:26661838-26661860 TCCTGAAGTCTAATCAAGAATGG + Intergenic
1053303898 9:36970450-36970472 TCCTCAAGACTCCTGCAGCAAGG - Intronic
1053516747 9:38736889-38736911 TCCTCAAATGCGCTGATGAAAGG - Intergenic
1055648065 9:78379426-78379448 AACTCAACTCTGCTGAAGCAGGG + Intergenic
1055936865 9:81611945-81611967 TCCTCAAGCCAGCTGCTGAAAGG + Exonic
1057604901 9:96492203-96492225 TCCCCAAGTCTCCTGAAAAGTGG + Intronic
1058868946 9:109186087-109186109 TCCTGCACTCTGCTGAACAAGGG + Intronic
1059909121 9:119022793-119022815 TCCACAAGTCAGCTGAGGAGAGG + Intergenic
1060023571 9:120152351-120152373 TCCTCAAGCCTGCTGATGGCAGG + Intergenic
1060045199 9:120334766-120334788 TCCTCAAGGCTTCTGAAGTCTGG + Intergenic
1060784423 9:126439009-126439031 TCCTCAAGTCTGTTCAAACAAGG - Intronic
1185969494 X:4646557-4646579 TCCTCATGTCTGCATAGGAAAGG + Intergenic
1188944738 X:36285492-36285514 TTGTCAAGACAGCTGAAGAAAGG - Intronic
1192733202 X:73821877-73821899 TCATCAAATCTGCTCAAGAAGGG - Intergenic
1193584133 X:83299940-83299962 TCATCAACTCTGTTGAATAAGGG - Intergenic
1193963402 X:87952613-87952635 TCCTCAAGTAGGCTGATGACGGG - Intergenic
1194734741 X:97498622-97498644 ACCTCAAGTCTCCTGATGTAAGG - Intronic
1195007921 X:100705015-100705037 TCCTCAAGACTGTCTAAGAAAGG - Intronic
1197043667 X:121970444-121970466 ACCTTAGGTCTGCTGAAGCATGG - Intergenic
1197259537 X:124303374-124303396 TGCTCAAATCTGCTGTCGAATGG + Intronic
1197888279 X:131240490-131240512 TCCTAAAGGCTGATGGAGAATGG + Intergenic
1198649166 X:138842077-138842099 TCATCAGCCCTGCTGAAGAAAGG + Intronic
1200411878 Y:2869036-2869058 TTCTCAAGTGTGATGAGGAAAGG - Intronic