ID: 966031481

View in Genome Browser
Species Human (GRCh38)
Location 3:175353546-175353568
Sequence GTGATTTACTCAAGATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 753
Summary {0: 1, 1: 4, 2: 24, 3: 136, 4: 588}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966031481 Original CRISPR GTGATTTACTCAAGATCACA AGG Intronic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901112829 1:6812207-6812229 GTGATTTCCACAAGAAAACACGG - Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902525313 1:17053661-17053683 TTGAATTGCTCAAGGTCACATGG - Intronic
902557630 1:17256335-17256357 GTGATTTAGTCAAGCTCAGCTGG + Intronic
902781707 1:18709184-18709206 GAGATTTTCTGAAAATCACACGG + Intronic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904405923 1:30287856-30287878 GTGATTTGTCCAAGGTCACAGGG + Intergenic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905043442 1:34978154-34978176 GTAATTTGCCCAAGGTCACATGG - Intergenic
905357224 1:37393166-37393188 GTAATTAACCCAAGGTCACATGG - Intergenic
905405198 1:37727741-37727763 ATAATTTGCCCAAGATCACATGG + Intronic
905961031 1:42042238-42042260 TTAGTTTACTCAATATCACATGG - Intergenic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907557795 1:55359805-55359827 GTGAATTGCACAAGGTCACATGG + Intergenic
907860441 1:58347667-58347689 CTGATTTACTCTTTATCACAGGG + Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908573696 1:65437197-65437219 TTGATTTATTCAAGATTCCATGG + Intronic
908805654 1:67928701-67928723 GTTATTTGCCAAAGATCACATGG + Intergenic
908823368 1:68111402-68111424 GTGATTTGGCCAAGACCACAAGG - Intronic
909350580 1:74648406-74648428 GTGATTTATTCAAGATTCTATGG + Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
909597315 1:77421306-77421328 GAAGTTTACTCAAGGTCACATGG + Intronic
910110218 1:83674867-83674889 GTTATTTGTTCAAGGTCACATGG - Intergenic
912617760 1:111122836-111122858 GTAATTTAGTCAAAATTACACGG + Intronic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
914343871 1:146781788-146781810 GTGATGCACCCAAGGTCACATGG + Intergenic
914946954 1:152076101-152076123 GTAATTTACTCAAGGACACTTGG + Intergenic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915567349 1:156722943-156722965 GTTAATTACTCAAGACCAAAAGG + Exonic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
915985452 1:160459742-160459764 GTGATTTGTTCAAGGTCTCATGG + Intergenic
916334471 1:163654757-163654779 GTTAGTAACTCAAGATCACTTGG + Intergenic
916610967 1:166391115-166391137 CTGACTTTTTCAAGATCACATGG - Intergenic
918084848 1:181236900-181236922 GTGATTTGTGCAAGATCACATGG - Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
919083967 1:192898951-192898973 GTGAGTTGCTTATGATCACAAGG + Intergenic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
920930912 1:210387075-210387097 TTCATTTACCCAAGTTCACAGGG - Intronic
921119194 1:212122036-212122058 GTCATTTACTTGAGGTCACATGG + Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
921519107 1:216137485-216137507 TTTATTAACTCATGATCACAGGG + Intronic
921532107 1:216297122-216297144 GGCAATTACTCAAGAACACAGGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
922961444 1:229649875-229649897 ATGATTTGTTCAAGATCATAAGG + Intronic
923641560 1:235766605-235766627 GTAACTTACCTAAGATCACATGG - Intronic
1062791625 10:310110-310132 GTGGTTAACTCAAGTTTACATGG + Intronic
1063454312 10:6172554-6172576 GTGACTTATCCAAGACCACAGGG + Intronic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1064415898 10:15149778-15149800 GTAATTTGCTGAAGGTCACATGG + Intronic
1065172137 10:23041985-23042007 GTAATTCTCTCAAGGTCACACGG - Intergenic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066438742 10:35417381-35417403 ATGATTTGCTCAAAGTCACATGG - Intronic
1066456001 10:35572787-35572809 GTGAGTCGCTCAAGAACACAGGG - Intergenic
1066500600 10:35990438-35990460 GTGTTTTACTCAGGAATACAAGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1067520425 10:46997317-46997339 GTAATTTCAACAAGATCACAGGG - Intronic
1067565032 10:47330331-47330353 GTGATCTTCTCAATGTCACATGG + Intergenic
1067915144 10:50389502-50389524 GTGTTTTACTTAAGATCACAAGG + Intronic
1068086949 10:52385678-52385700 GCAATTTAGTCAAGTTCACATGG - Intergenic
1068530159 10:58176479-58176501 GTGGTTTGCTCAAGGTCACGTGG + Intergenic
1068605425 10:59000002-59000024 GTGATTTTCTTAGGGTCACACGG + Intergenic
1068605976 10:59005468-59005490 GTGATTTGCCCAAGGTTACAGGG + Intergenic
1068614122 10:59093215-59093237 GTGATTTACTCAGTGTCACATGG - Intergenic
1068767214 10:60777123-60777145 GTGATATACTCTATATCACAAGG + Intergenic
1069317402 10:67123768-67123790 CTGATTAATTCAAGATTACAAGG - Intronic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070743200 10:78916155-78916177 GTGAGTTACCCAAGGTCACAGGG + Intergenic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1070802117 10:79249935-79249957 GTGACTTACTCAAAGTCACCTGG - Intronic
1071142518 10:82527242-82527264 TTGATTTACTCAAGATTTGATGG - Intronic
1071324407 10:84497990-84498012 GTAATTTTCTCAAGGTTACAAGG + Intronic
1071920060 10:90339693-90339715 GTTATTTGCTCAAGAGTACATGG - Intergenic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1073044923 10:100631470-100631492 GTGACTTACCAAAGGTCACATGG + Intergenic
1073064715 10:100751184-100751206 GTGATTGTCTCAAGATCCCAAGG - Intronic
1073581338 10:104668388-104668410 GTGAATTAATTAAGACCACAGGG + Intronic
1073648836 10:105337189-105337211 GTGATTTACTCAAGTCTGCATGG + Intergenic
1074299812 10:112223543-112223565 GTGATTTGCTTAAGGTCACAAGG - Intergenic
1074368938 10:112883214-112883236 TTGTTTTACTCCAGATCAGAGGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1074993260 10:118731302-118731324 GTGACTTCCTCAAGAACTCAAGG + Intronic
1075756824 10:124818840-124818862 GTGACTTCCTCCAAATCACAGGG - Intronic
1076201771 10:128564621-128564643 TTGAGTTAGCCAAGATCACACGG - Intergenic
1078180614 11:9006844-9006866 GTGATTTACTCAAAGTCATTTGG - Intergenic
1078325388 11:10376382-10376404 GTGATTAACCCAAGGGCACATGG + Intronic
1078477278 11:11641701-11641723 GTGATTTGCCTAAAATCACATGG - Intergenic
1078561104 11:12373517-12373539 GAGATTTACCCAAGATCACCTGG + Intergenic
1078748089 11:14134490-14134512 GTGGTTTGGTGAAGATCACATGG - Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079149664 11:17886083-17886105 GAGATTTACCCAAAGTCACATGG - Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079937955 11:26641316-26641338 GTGACTTGCTAAAAATCACACGG + Intronic
1080177007 11:29376681-29376703 GTGATTTAATCTTGGTCACATGG + Intergenic
1080648301 11:34203197-34203219 GTGATTTTCTCCAAGTCACACGG - Intronic
1080694338 11:34588245-34588267 GTAATTTGCCCAAGGTCACATGG - Intergenic
1082199235 11:49343217-49343239 CTGATTGTCTCAAGGTCACATGG - Intergenic
1082262389 11:50086808-50086830 GTGATTTGCGCAAGCTCACTTGG - Intergenic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1084682576 11:70675422-70675444 GTGATTTGCACCAGAACACAGGG + Intronic
1085346967 11:75774498-75774520 GTGTTATACCCAAGGTCACATGG - Intronic
1085393960 11:76196904-76196926 GTGATGTGCCCAAGGTCACATGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085438738 11:76537450-76537472 TTGATGAACTCAAGACCACAGGG + Intronic
1085463635 11:76709982-76710004 GGGATTTACTCAAAGTCACGAGG + Intergenic
1085781438 11:79412516-79412538 GTGACTTATCCAAGGTCACATGG - Intronic
1085803781 11:79615869-79615891 GTAACTTACCCAAGAACACATGG - Intergenic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1085828873 11:79878088-79878110 GTAATTTACCCAAGGTCAGAAGG - Intergenic
1086656585 11:89364896-89364918 CTGATTGTCTCAAGGTCACATGG + Intronic
1086668639 11:89518764-89518786 GTGAATTACTCCACGTCACATGG - Intergenic
1087140346 11:94759649-94759671 GTGAATTACCTGAGATCACATGG - Intronic
1087925432 11:103913237-103913259 GTGTTTTACTTAAAATTACATGG - Intronic
1088119826 11:106355155-106355177 GTGATTTGCTCAAAATGGCATGG - Intergenic
1088247891 11:107837140-107837162 GTGACTTAGTGAAGAACACAGGG + Intronic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089270609 11:117299376-117299398 GTGATCTGCTCAAGGTGACAGGG - Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090499678 11:127249158-127249180 GTGATTTGCACAAGCTCACATGG - Intergenic
1090888314 11:130899005-130899027 GTTATCTAGTCAAAATCACAGGG - Intronic
1091481320 12:834616-834638 GTGAATTGCTCAAGATCGTATGG - Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091641824 12:2242951-2242973 GTGACTTACCCACGATCATAGGG + Intronic
1091930232 12:4390042-4390064 GTGATTTGCCCAAGGTTACACGG + Intergenic
1092317804 12:7438422-7438444 GTGGTATACTCAAGACAACAGGG + Intronic
1093212303 12:16322685-16322707 TAGTTTTGCTCAAGATCACACGG + Intergenic
1094109890 12:26851026-26851048 GTAATTTCCTCTAGATTACATGG - Intergenic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1094719303 12:33046852-33046874 GTAATTTATTTAAGGTCACATGG - Intergenic
1095456470 12:42391050-42391072 TTGATTTGCCCAAGGTCACATGG + Intronic
1095993157 12:48052773-48052795 GGGATTTATGCAAGGTCACATGG - Intronic
1096530291 12:52238360-52238382 GTGATTTGTTCCAGGTCACACGG + Intronic
1096944069 12:55384275-55384297 GTGATCTATTCAAGATTACTCGG + Intergenic
1097337868 12:58404755-58404777 GTGATTTGCCTAAGGTCACATGG + Intergenic
1098860588 12:75705689-75705711 GTGATTTACCCAAGGTCATATGG - Intergenic
1098964702 12:76774660-76774682 GTAATTTGCCCAAGATCATATGG - Intronic
1099132875 12:78858526-78858548 GTAATTTTTTGAAGATCACATGG - Intergenic
1099155214 12:79166855-79166877 ATGATTTACTCAAAATAACATGG - Intronic
1099979878 12:89586200-89586222 GTAACTTACTCTAGGTCACATGG - Intergenic
1100609601 12:96180327-96180349 GTGTTTTTCCCAAAATCACACGG + Intergenic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100773997 12:97954702-97954724 AGGATATGCTCAAGATCACATGG - Intergenic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101312920 12:103600005-103600027 GTAATTTGCCCAAGATTACATGG - Intronic
1101474101 12:105027535-105027557 GTCATTTACCCAAGGTCACCAGG - Intronic
1101747845 12:107557793-107557815 CTAATTTGCCCAAGATCACAGGG + Intronic
1102161557 12:110773326-110773348 GTCATTTGCTCAAGGTCACATGG + Intergenic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102511619 12:113419424-113419446 GTGACTTACAAAAGGTCACAGGG + Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103187853 12:118976928-118976950 GAGATTTACCCAAGGTAACATGG + Intergenic
1103333395 12:120170710-120170732 GTGTGTTGCTCAAGGTCACACGG + Intronic
1104124708 12:125835376-125835398 ATGATTGACCCAAGGTCACATGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1105354612 13:19647625-19647647 GTGGTATACTCAAGACAACAGGG - Intronic
1106254471 13:28010236-28010258 TTCATTTACTTAATATCACATGG + Intronic
1106295581 13:28410830-28410852 ATGCTTTGCTCAAGTTCACAGGG + Intronic
1106997813 13:35508104-35508126 GTAATTTGCTTAAGATCACAGGG + Intronic
1107624234 13:42266870-42266892 ATGATTTATTCTGGATCACATGG - Intergenic
1107631975 13:42351567-42351589 CAGATTTACCCAAGATCACAAGG + Intergenic
1107815553 13:44241557-44241579 CTGATTTACCCAAAACCACAAGG - Intergenic
1108005371 13:45941047-45941069 GTGATTTGCTCAAGGTCAAACGG - Intergenic
1110051701 13:70910266-70910288 GTGATTTGTTCAAGATCATGTGG - Intergenic
1111146552 13:84189284-84189306 GTGATTAAATGAGGATCACATGG - Intergenic
1111234203 13:85387710-85387732 GTGATTTAAAAAAGTTCACATGG - Intergenic
1111613510 13:90636142-90636164 GTGATTTACTAAAAATTCCATGG - Intergenic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1112686192 13:101830587-101830609 GTGACTTACTTAGGATCAAAGGG - Intronic
1112817302 13:103287882-103287904 GTGGTTTTCTCAAAACCACAAGG - Intergenic
1112897381 13:104316526-104316548 ATGATTTGCTCGAGGTCACATGG + Intergenic
1112994646 13:105558518-105558540 GTGATTTACCCAGTATTACATGG - Intergenic
1113236413 13:108279998-108280020 GGGTATTACTCAACATCACACGG - Intronic
1113316153 13:109181661-109181683 GTGATTTGCCAAAGATCATATGG + Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1114789046 14:25635326-25635348 CTGATTCATCCAAGATCACATGG + Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115373979 14:32652499-32652521 GTGATTTTATAAAGATCAGAAGG - Intronic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1115756476 14:36531340-36531362 GTAAATTGCTGAAGATCACATGG + Intergenic
1116799000 14:49423205-49423227 ATAACTTACTCAAGGTCACATGG - Intergenic
1117012846 14:51488443-51488465 GGGATTTATTCAAGGTCACATGG + Intergenic
1117387049 14:55225962-55225984 GTTACACACTCAAGATCACATGG - Intergenic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1118408170 14:65448034-65448056 ATGATTTATTCAGTATCACAGGG + Intronic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1118649692 14:67877329-67877351 GTGATTTGCCCAAGATCATATGG + Intronic
1118867751 14:69716852-69716874 CTGATTTGATCAAGACCACATGG + Intergenic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119732361 14:76958895-76958917 GTGATTTGCCCAAGGCCACACGG - Intergenic
1119931884 14:78555596-78555618 ATGATTTGTTCAAGATCACAAGG - Intronic
1119961611 14:78864303-78864325 AAGATTTACCCAAGATTACATGG - Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120698059 14:87666432-87666454 GTGATGAACCCAAGGTCACAAGG + Intergenic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1120845976 14:89125590-89125612 TTAATTTGCCCAAGATCACATGG + Intronic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121042029 14:90757550-90757572 ATGATTTGCCCAAGGTCACATGG + Intronic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121654766 14:95587292-95587314 GTGATTCACACAGGTTCACAGGG - Intergenic
1121691139 14:95877598-95877620 ATGACTTAATCAAGGTCACAAGG + Intergenic
1121858597 14:97294251-97294273 CTTATTTGCTCAAGGTCACAGGG - Intergenic
1122016413 14:98800575-98800597 GTGACTTGTTCAAGATCTCAAGG - Intergenic
1122024849 14:98868192-98868214 GTGACTTTCTCAAGATCATGTGG - Intergenic
1122261330 14:100524758-100524780 CGGATTTGCTCAAGGTCACAGGG - Intronic
1123506922 15:20951645-20951667 GTGATTGACTCAACATCACACGG - Intergenic
1123564151 15:21525397-21525419 GTGATTGACTCAACATCACACGG - Intergenic
1123600405 15:21962681-21962703 GTGATTGACTCAACATCACACGG - Intergenic
1125173485 15:36793422-36793444 GTGACTTGCTTAAGATAACACGG - Intronic
1125468181 15:39975909-39975931 GTAATTTTCCCAAGTTCACACGG + Intronic
1126582718 15:50255959-50255981 GGGACTAACTCAAGTTCACATGG + Intronic
1126737831 15:51750154-51750176 GTGACTTATTCAAGGTCATAGGG - Intronic
1126807850 15:52370654-52370676 GTGATTTTCTCATAGTCACAGGG + Intronic
1126988117 15:54338750-54338772 GACATTTTCTCAAGGTCACAAGG + Intronic
1127682800 15:61314082-61314104 GTGATTTGCTCAAGGTCAAGTGG - Intergenic
1127689271 15:61378456-61378478 GTGATTTGCTCAAGCTCATATGG + Intergenic
1127785681 15:62352823-62352845 GTAATTTGCCCAAGATCACATGG - Intergenic
1127964125 15:63911342-63911364 GTAATTTCCTCAAGGTCACACGG + Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128356371 15:66930354-66930376 GTGATTTCATGAAGGTCACAGGG - Intergenic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1130858339 15:87862199-87862221 GAGATTCACTCAAGAGGACAAGG + Intronic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1131340647 15:91597555-91597577 ATGTTTTACTTAAGATCCCAGGG + Intergenic
1131828203 15:96336606-96336628 GTGTTTTCCTGAAGATAACAGGG + Intronic
1202972510 15_KI270727v1_random:252493-252515 GTGATTGACTCAACATCACACGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134217846 16:12330212-12330234 GTCGTTTACTCAAGGCCACAAGG - Intronic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134377733 16:13693652-13693674 CTGATTGACTCAAGATCTGAAGG + Intergenic
1134541404 16:15069634-15069656 GTCATTTTCCCAAGATCACATGG - Intronic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134837364 16:17372745-17372767 GTAATTTGCTCAAGTTCAAACGG - Intronic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135166528 16:20144013-20144035 GTGATTTGCCCAAGGTCACGTGG + Intergenic
1135359392 16:21799214-21799236 GTCATTTTCCCAAGATCACATGG - Intergenic
1135436859 16:22434191-22434213 GTCATTTTCCCAAGATCACATGG - Intronic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136263401 16:29097730-29097752 GTCATTTTCCCAAGATCACATGG + Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137466466 16:48714307-48714329 GTAATTTATTCAAGAACACAGGG + Intergenic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1138440695 16:57033350-57033372 GTGATTTGCCCAAGGCCACATGG + Intronic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1138728546 16:59168042-59168064 GTTATTTATCCAAGACCACATGG - Intergenic
1139865740 16:70060874-70060896 TTGATTTATTCAAGATTGCAGGG - Intergenic
1139990122 16:70933547-70933569 GTGATGCACCCAAGGTCACATGG - Intronic
1140028411 16:71312920-71312942 GTGATTCACCCAAGGTCACAGGG + Intergenic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1141884294 16:86881138-86881160 GTGAATTCCTGAAGGTCACACGG + Intergenic
1143100577 17:4502595-4502617 GTGATGTCTTCAAGGTCACACGG - Intronic
1143410556 17:6705889-6705911 GTGATTTGCTCATGGACACACGG - Intronic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1144326240 17:14184110-14184132 ATAATTTGCTCACGATCACACGG + Intronic
1144475117 17:15580982-15581004 ATAATTTGCTCAAGATCACACGG + Intronic
1144861351 17:18304954-18304976 GTGATTTGCTCCAGGACACATGG + Intronic
1145803448 17:27707435-27707457 GTGAAATACTCAAGAGCACAAGG - Intergenic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146251577 17:31349891-31349913 ATGATTTGCTCAAGATGATACGG - Intronic
1146266989 17:31459285-31459307 GTGCTTTGCCCAAGACCACATGG - Intronic
1146309088 17:31753248-31753270 GTAACTTATTCAAGTTCACATGG - Intergenic
1146413535 17:32610534-32610556 ATGAGTCACTCAAGATCACATGG - Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1146994090 17:37302788-37302810 ATGAGTTTATCAAGATCACAGGG - Intronic
1148383427 17:47217552-47217574 ATGATTTGGCCAAGATCACATGG + Intronic
1148546456 17:48522788-48522810 GTGACTTACCCAAGGACACAAGG + Intergenic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1150142872 17:62744704-62744726 GTGATTTTCCCAAGCTCACATGG - Intronic
1150690517 17:67362767-67362789 GTGTTTTACTCAAGGTAATATGG - Intronic
1150937123 17:69648757-69648779 GTTTCTTACTCAAGATCATATGG + Intergenic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1153645343 18:7191067-7191089 CTGGTTTATTCAAGTTCACACGG - Intergenic
1154947182 18:21173565-21173587 GTAATTTGCTCAAGATCATGAGG + Intergenic
1155319147 18:24601793-24601815 GTGACTCACTCAGGATCACGTGG + Intergenic
1155344310 18:24843452-24843474 GTGATTTACTCCACTTCTCAGGG + Intergenic
1156006523 18:32449116-32449138 ATAATTTGCTCAAGGTCACATGG - Intronic
1156458734 18:37309284-37309306 GTGACTTCCTCAACAACACATGG - Intronic
1156551365 18:38022274-38022296 GTGATTTGTTCAAGAACATAAGG + Intergenic
1156662880 18:39368377-39368399 GTGATTTTCTCAACATTATAAGG + Intergenic
1156671604 18:39476759-39476781 GTGATTTGCTCAAGTTTGCAAGG + Intergenic
1156976123 18:43223421-43223443 GTAATTTATTCAAAATCTCACGG - Intergenic
1157100320 18:44723461-44723483 GTGATTTGTTCAAGATCACATGG + Intronic
1158142703 18:54272196-54272218 CTGATTTACTGAAGAACAAAGGG + Intronic
1158215975 18:55101273-55101295 ATGATTTACCCAAGACTACAAGG - Intergenic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1158890987 18:61871495-61871517 GTAATTTACTTAGGATCACAGGG + Intronic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1161867481 19:6844129-6844151 GTGAATTACTTAATGTCACATGG + Intronic
1162556208 19:11387560-11387582 GTAACTTACTCAAGGTCCCATGG - Intronic
1162897772 19:13775708-13775730 ACAATTTGCTCAAGATCACAGGG - Intronic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1166092301 19:40517838-40517860 ATGATTTGCCCAAGGTCACATGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1167257751 19:48441638-48441660 ATGATTTGCTCAAGAGCTCAGGG + Intronic
1167891173 19:52540730-52540752 ATGCTTTTCTCAAGAACACATGG - Intronic
925634865 2:5933339-5933361 GTGATTTGCCCAACACCACAGGG - Intergenic
926789254 2:16553660-16553682 ATGATCTATTCCAGATCACAAGG + Intronic
926855565 2:17252203-17252225 CTCCTTCACTCAAGATCACAGGG + Intergenic
926931603 2:18046728-18046750 GTGATTCACTCAAGGTCACTTGG + Intronic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
927742473 2:25584010-25584032 GTGATTTTCTCCAGATCACGTGG - Intronic
927760658 2:25750617-25750639 GTCATTTACTTAATATCACACGG - Intronic
927942724 2:27115407-27115429 TTAATTTACCCAAGGTCACAGGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
928577069 2:32666254-32666276 GTCATTTGTTCATGATCACAGGG - Intronic
929841973 2:45476182-45476204 GACATTTACCCAAGATCTCATGG - Intronic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930031660 2:47061641-47061663 CTGATTTACCCATGATCACCAGG - Intronic
930152852 2:48076192-48076214 GTGATTTTCCAAAGATCACATGG - Intergenic
931185038 2:59941660-59941682 GTGATTAGCCCAAGGTCACATGG + Intergenic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932476860 2:72011722-72011744 GTAACTTACCCAAGTTCACATGG - Intergenic
932707303 2:74036588-74036610 GTAATTGCCTCAAGATCACAAGG - Intronic
933917998 2:87016121-87016143 GTAATATACTCAAGCTGACATGG + Intronic
934004997 2:87753793-87753815 GTAATATACTCAAGCTGACATGG - Intronic
935767954 2:106387824-106387846 GTAATATACTCAAGCTGACATGG - Intergenic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936373041 2:111919055-111919077 GTGACTTACACAAGGTCACCTGG + Intronic
936508441 2:113126779-113126801 ATGATTTGTTCAAGGTCACACGG + Intronic
936842587 2:116790794-116790816 GTGATTTACTGAAAGTCCCATGG + Intergenic
938212865 2:129483229-129483251 GTGATTTACTCAAAAGCACTTGG - Intergenic
938580347 2:132640004-132640026 GTGATTTGCCCAAGATCTCCTGG - Intronic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939091014 2:137780263-137780285 TTGATCTACTCAAGGTCAGAAGG - Intergenic
940976059 2:159945782-159945804 GTGATGTACTCAACATCAAAAGG + Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
942999808 2:182312369-182312391 TTGCCTAACTCAAGATCACAAGG + Intronic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
944016266 2:195043062-195043084 GTGAGTTGCTCAAAGTCACATGG - Intergenic
944328906 2:198441675-198441697 CTGATTAACTAAAGATCATAAGG + Intronic
945304050 2:208241807-208241829 ATGATTTACTCAAGACCACATGG - Intronic
945503459 2:210607673-210607695 GTGATGTGCTCAAAATCACACGG - Intronic
945603789 2:211901211-211901233 GTGACTTATTCAAGGTTACAGGG - Intronic
945922213 2:215766595-215766617 GTGATCTGCTCAAGATCTCTTGG - Intergenic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946003554 2:216503799-216503821 GTGATTTTCCCAAGATGATAGGG + Intronic
946236287 2:218326465-218326487 GTTATTTGTTCAAGGTCACATGG - Intronic
946565407 2:220959017-220959039 GTGATTTACCCAAAGTCACATGG - Intergenic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
946778759 2:223171454-223171476 GTGAGTTTCTCAAGATCTGAGGG - Intronic
946919414 2:224562908-224562930 TTAATTTTCTCAAGGTCACATGG - Intronic
947079822 2:226383594-226383616 GTAACTCACTCAAGATCTCATGG - Intergenic
948524447 2:238561960-238561982 TTGATTTGCTGGAGATCACATGG - Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168891431 20:1297373-1297395 ATGATCTGCTCAAGGTCACACGG - Intronic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168991628 20:2101513-2101535 ATGATTTGCACAAGATCACTGGG + Intergenic
1169295187 20:4389894-4389916 GTGAATTCAACAAGATCACAAGG + Intergenic
1170486422 20:16821090-16821112 GGGATTTGTTCAAGGTCACATGG + Intergenic
1170585361 20:17730265-17730287 GTGGATTGCTCAAGATCACATGG + Intronic
1170734260 20:19000312-19000334 ATGATTCACTCAAAGTCACATGG - Intergenic
1170825797 20:19794101-19794123 ATAATATACCCAAGATCACAAGG + Intergenic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1171027252 20:21641815-21641837 GTGATTTACACAGACTCACAAGG + Intergenic
1171432589 20:25092760-25092782 ATATTTTTCTCAAGATCACATGG + Intergenic
1172114601 20:32566223-32566245 GTGATTTGCCTAAGATCACATGG + Intronic
1172254469 20:33505121-33505143 GTGATTTACTCACTGTCACACGG + Intronic
1172282665 20:33719290-33719312 ATGACTTCCTCCAGATCACACGG + Intronic
1172412206 20:34733481-34733503 ATAATTTACCCAAGGTCACATGG - Intronic
1172451055 20:35023220-35023242 CTGATTTACTGAAGACCACCCGG - Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172810668 20:37645608-37645630 GTGAGTTACTCAAGGTCGCATGG - Intergenic
1172854545 20:37991954-37991976 ATCATTTGCTCAAGGTCACATGG + Intronic
1172855791 20:38001315-38001337 TTAACTTACTCAAGGTCACATGG + Intronic
1173155630 20:40606237-40606259 GTAATTGACACAAGGTCACAGGG + Intergenic
1173161477 20:40655897-40655919 GTGATTTGCCCAAGACCCCATGG + Intergenic
1173217757 20:41102244-41102266 GTGATATACAGAAGAACACAGGG - Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1174324065 20:49765012-49765034 GTAATTTGCTCAGGATCACATGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174458215 20:50664586-50664608 GTGATTTGCCCAATGTCACACGG - Intronic
1174496918 20:50952095-50952117 TTTATATTCTCAAGATCACATGG - Intronic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1176913138 21:14592481-14592503 GTGGCTCACTCAAGTTCACATGG - Exonic
1177406144 21:20670992-20671014 GTGAATTATCCAAGATCACAGGG - Intergenic
1178105119 21:29309725-29309747 GTAATTTACAGAAGATCACATGG + Intronic
1178235053 21:30832230-30832252 GAGAATTACTGAAGGTCACATGG + Intergenic
1178365053 21:31983263-31983285 GTGATCTACTCAGGGTCACCTGG + Intronic
1178716138 21:34966169-34966191 TTAATTTGCCCAAGATCACAAGG + Intronic
1178883860 21:36469516-36469538 GTATCTTACTCAAAATCACACGG + Intronic
1178949791 21:36976814-36976836 ATAATTTGCTTAAGATCACATGG - Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179710655 21:43211268-43211290 GTGACTTATCCAAGGTCACAGGG - Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181915469 22:26276308-26276330 GGAATTTGCTCAAGGTCACATGG + Intronic
1182044759 22:27265549-27265571 GTGAGTCAGTCAGGATCACATGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182894105 22:33844643-33844665 GTGATATACCCAAGTTCGCACGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183003152 22:34878374-34878396 GTCATTTGCCCAAGGTCACATGG - Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183547989 22:38465573-38465595 TTTATTTCCTCAAGACCACAGGG - Intergenic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183741639 22:39671859-39671881 ATGACTTACTCAAGATCATAAGG + Intronic
1183882906 22:40850708-40850730 CTGATTTCCCCAAGATCACTTGG - Intronic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
949919031 3:8987052-8987074 GAGATTTGCTCAGGGTCACACGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950191114 3:10976801-10976823 GGGATTTGTTCAAGGTCACATGG - Intergenic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
951273315 3:20654467-20654489 GTGATTTACCAAAGATTACAAGG + Intergenic
951358744 3:21700595-21700617 GTGAGTTACTGAATATCACAAGG - Intronic
952323757 3:32301854-32301876 GTGATTTACCCAATGTCACATGG - Intronic
952470196 3:33639956-33639978 ATGATGTGCCCAAGATCACATGG - Intronic
952519185 3:34138247-34138269 GTGACTTATTCAAGCTCATAAGG + Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953750012 3:45601718-45601740 GTGACTTGCTCAAGACCATATGG + Intronic
953838719 3:46370570-46370592 ATGATTTGTACAAGATCACAGGG - Intergenic
954042177 3:47896995-47897017 GTGGTTTGCCCATGATCACATGG + Intronic
954169171 3:48786492-48786514 GTACTTTACTCAAGATAACTTGG + Intronic
954664027 3:52241221-52241243 GTGATTTGATCAATGTCACATGG + Intergenic
954790397 3:53128910-53128932 GTGATTTCCTCACTGTCACACGG + Intronic
954920996 3:54190858-54190880 GTCTTTTATCCAAGATCACATGG - Intronic
955491657 3:59489084-59489106 GAGATTTACTAAAGACCCCATGG - Intergenic
955751359 3:62188051-62188073 GTGTTTTACTCAACAACTCATGG - Intronic
956104925 3:65807873-65807895 GTAAATTATCCAAGATCACAGGG + Intronic
958055539 3:88405920-88405942 ATGATTTACTTAGAATCACAAGG - Intergenic
958517508 3:95137066-95137088 GTGTTTTTCTCAAGAATACAAGG - Intergenic
958664984 3:97126004-97126026 GAGACTTATTCAAGATCAAATGG + Intronic
958827436 3:99048709-99048731 GTGACTTAGTCAAGAGCACATGG + Intergenic
959500284 3:107099111-107099133 GTGTTTGACTAAAGATTACAGGG + Intergenic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960197306 3:114784998-114785020 GTCATTTGCTCTAGATCACCAGG + Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
960701289 3:120441883-120441905 GTAGTTTTCCCAAGATCACATGG + Intronic
960737902 3:120800741-120800763 GTAATTTGCCCAAGATCACATGG + Intergenic
960918325 3:122720317-122720339 GTGTTGTACTCAGGATCACTAGG - Exonic
960928412 3:122819314-122819336 GTGATTTTCTAAAGATTATATGG + Intronic
961071325 3:123930626-123930648 CTGACTTACCCAAGATCATATGG + Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961919423 3:130410437-130410459 ATAATTTCCTCAAGATCAAAAGG - Intronic
962209403 3:133464348-133464370 GTTATTTGCTCAAGATTATATGG - Intronic
962348945 3:134642847-134642869 GTCATGTGTTCAAGATCACATGG - Intronic
963900245 3:150726663-150726685 GTTACTTACTCAAGTTTACATGG - Intergenic
964478348 3:157117646-157117668 TTAATTTACTCAAAATGACATGG + Intergenic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
965060475 3:163778791-163778813 GTGATTTGCACATAATCACAGGG + Intergenic
965727677 3:171736343-171736365 GTCACTCATTCAAGATCACAAGG + Intronic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966338511 3:178898813-178898835 ATGAATTGCTCAAGATTACATGG - Intergenic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967101894 3:186222443-186222465 ATGATTTGCCCAAGGTCACATGG - Intronic
967489271 3:190070546-190070568 GTGCTGTAATCAAGAGCACACGG + Intronic
967827225 3:193886936-193886958 ATAATTTACCCAAGGTCACATGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
968125994 3:196160689-196160711 CTGATTTACTCCTGATCACTGGG - Intergenic
968348316 3:198030547-198030569 GAGATTTCCTCAAGATGAAATGG - Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
971748724 4:30618874-30618896 GGGATTTGCTCAAGGTTACATGG + Intergenic
972163980 4:36260170-36260192 GTAATTTGCTCAAAATCAAAAGG + Intergenic
972425624 4:38929900-38929922 GTGACTTATTCAAGGTTACAAGG - Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973819261 4:54648403-54648425 GTGACTTACTTGAGATCACCTGG - Intergenic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
974490972 4:62564195-62564217 TTGACTTACTTAAGATCACATGG - Intergenic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
975956431 4:79845724-79845746 ATAATTTACTCAAGATTTCAAGG + Intergenic
976221141 4:82757668-82757690 GTGATTTGACCAAGGTCACATGG - Intronic
976403180 4:84631226-84631248 ATAATTTACTGAGGATCACAGGG - Intronic
977491590 4:97720193-97720215 GAGAATTAATCAAGGTCACATGG - Intronic
978046014 4:104128643-104128665 GCCATGTACTCAAGAACACAGGG + Intergenic
978656561 4:111072514-111072536 CTGATTTTGTCAAGATCAGATGG - Intergenic
980002188 4:127502855-127502877 GTAATTTTCTAAAGATCCCAGGG - Intergenic
980895832 4:138859189-138859211 GTGATTTGCCCAAGATCAGACGG + Intergenic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981449688 4:144882023-144882045 GTAATTCACTTAAGATCAGAGGG + Intergenic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
983107685 4:163709753-163709775 GTGATTTTCTTACCATCACATGG - Intronic
984478927 4:180274217-180274239 ATGATTTGCTAAAGACCACAAGG + Intergenic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984868541 4:184306858-184306880 ATAATTTACCCAAGGTCACATGG - Intergenic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
985561653 5:590059-590081 GTGATTTTCACAAGATCTGATGG - Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
986511487 5:8511362-8511384 CTGATTTGCTGAAGATCAGATGG + Intergenic
987037687 5:14034743-14034765 GTAATTTGCTCAAGGTCTCAAGG + Intergenic
988033520 5:25796855-25796877 CTGATTTACTCAAGGTGACTTGG - Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
989532136 5:42520336-42520358 GGGATTTACACAAGATCACAAGG - Intronic
990445135 5:55887251-55887273 ATCATCTATTCAAGATCACAGGG + Intronic
991616920 5:68506471-68506493 CTGATTTACTTAAGAGTACATGG - Intergenic
993524942 5:88953760-88953782 GTGAGTTGCACAGGATCACAAGG - Intergenic
993869997 5:93241213-93241235 ATGAGTTACTGAAAATCACATGG - Intergenic
994690044 5:103006568-103006590 ATGATTTGCTCAAGGTCACGCGG - Intronic
994997347 5:107080540-107080562 GTAATTTGCCCAAGATTACAAGG - Intergenic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
996133931 5:119815816-119815838 GTGATTTTCACAAGGTCACATGG + Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
998534211 5:142914408-142914430 GTAATTTGCTCAAAGTCACATGG - Intronic
998779007 5:145635478-145635500 GTGATCTATTCAATATTACATGG + Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
998861621 5:146449455-146449477 GTGACTTACACAAGGTCACTGGG + Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
1000339796 5:160268341-160268363 GTGACTTACCCCAGACCACATGG - Intronic
1000667075 5:164011741-164011763 GTAATTTACACAAATTCACATGG + Intergenic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1002588698 5:180271724-180271746 TTCATTTTCTAAAGATCACATGG + Intronic
1003630384 6:7781280-7781302 GTGATGTGCTAAAGTTCACATGG + Intronic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1003978707 6:11369045-11369067 GTAATTTGCTCAATAGCACATGG + Intronic
1004087989 6:12470849-12470871 GGGATTTGCTCAGGATCACTCGG - Intergenic
1004342637 6:14820947-14820969 GTCATTTACTCAGGGTCACATGG - Intergenic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006738173 6:36289900-36289922 GTGATTTACCCAAAGTCACATGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007324631 6:41050532-41050554 GTGATTTGTATAAGATCACACGG - Intronic
1007965692 6:46001759-46001781 GTGTTTTGCTCAAGGTCCCATGG - Intronic
1008136237 6:47780402-47780424 ATGATTTGCTCAAGATCAGAGGG + Intergenic
1008503971 6:52211249-52211271 GTAATTTATTCAAACTCACAGGG - Intergenic
1010037330 6:71341069-71341091 GTGATTTACTCAGAGTCACGTGG + Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1011553685 6:88552346-88552368 GTGATTTTCTTAAGGTCCCAGGG - Intergenic
1011701609 6:89960308-89960330 GGGATTTACCCAAAGTCACAGGG + Intronic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1012529293 6:100214786-100214808 GTAATTTTCTCAAAATCACATGG - Intergenic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1014946616 6:127506066-127506088 GTTATTTGCTCAAGGTCATAGGG + Intronic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1016331897 6:142961485-142961507 ATAATTGACTCACGATCACAGGG - Intergenic
1017074203 6:150602085-150602107 GTGATTTAATTAAGATCGAATGG + Intronic
1017112269 6:150943327-150943349 GTGATATTATCAAGATCCCAAGG + Intronic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1018409022 6:163522385-163522407 GTGAGTTGCTCAAGATTACAGGG + Intronic
1018776359 6:167020598-167020620 TTAATTTACTTAAGATTACACGG + Intronic
1020154779 7:5713902-5713924 TTAAATTGCTCAAGATCACAGGG + Intronic
1020222913 7:6255159-6255181 GTAACTTACACAAAATCACAAGG + Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1021516417 7:21492828-21492850 GTATTTTATTCAAGAGCACATGG + Intronic
1021578715 7:22129577-22129599 GTGATATTCTGAAGATCACAGGG - Intronic
1021640104 7:22728233-22728255 GGAATTTACCCAAGATCACAAGG - Intronic
1021904643 7:25321406-25321428 AAGATTCACTCAAGGTCACATGG + Intergenic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022619786 7:31971391-31971413 ATAACTCACTCAAGATCACATGG - Intronic
1022734043 7:33059676-33059698 GTAATTTGCCCAAGGTCACATGG + Intronic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1022838532 7:34140112-34140134 GTAATTTACTCAATGTCACAGGG - Intronic
1023759536 7:43451128-43451150 GTTATCTCTTCAAGATCACATGG - Intronic
1024650727 7:51401044-51401066 GTGATTTGCCCAAGCTCACCTGG - Intergenic
1025054848 7:55756630-55756652 GTGATTTGCCCAAGCTCACCTGG - Intergenic
1025132921 7:56386850-56386872 GTGATTTGCCCAAGCTCACCTGG - Intergenic
1025909561 7:65817493-65817515 GTGATTTGCCCAAGCTCACCTGG + Intergenic
1025911074 7:65829216-65829238 GTGATTTGCCCAAGCTCACCTGG + Intergenic
1025978636 7:66389634-66389656 GTGATTTGCCCAAGCTCACCTGG - Intronic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027863670 7:83618256-83618278 GTAATTAACCCAAAATCACACGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1029141921 7:98417449-98417471 GTGACTTACTCCAAGTCACAGGG - Intergenic
1029214196 7:98933783-98933805 GTGATGTTCTCAACAGCACATGG - Intronic
1030677138 7:112395662-112395684 GTGAATTTCACAAGATCAGATGG + Intergenic
1030796090 7:113789831-113789853 GTGAGTTTGTCAAGATCACATGG - Intergenic
1031399480 7:121314453-121314475 GTGATTTACACAAGTTCCAAGGG - Intergenic
1031846247 7:126808654-126808676 GTTTTTTACTCAAGAGCCCAAGG - Intronic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1031958820 7:127970337-127970359 ATGACTTACACAAGGTCACATGG - Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1033202952 7:139390147-139390169 GTGAATTTCTCAGGATCAAATGG + Intronic
1033521610 7:142166627-142166649 GTGATTTCCTCTAGATTACATGG + Intronic
1033662888 7:143414870-143414892 GTGATTTGCCCAAGATCACTTGG - Intergenic
1034563495 7:151896163-151896185 GTGACTCATTCAAGGTCACAGGG + Intergenic
1034762305 7:153684403-153684425 GTGATTCACCCAAGTTCTCATGG + Intergenic
1035277205 7:157754669-157754691 GTGTTTTACTGAAGTTCACGGGG + Intronic
1035968057 8:4216637-4216659 GTCATTTACGAAAGAACACAGGG - Intronic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1036770930 8:11577998-11578020 GTGAATTGCTCCAGGTCACAAGG + Intergenic
1037089378 8:14895250-14895272 GTAATGTACCCAAGATTACATGG - Intronic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037552462 8:19988052-19988074 ATGATTTGTTCAAGACCACATGG - Intergenic
1037617164 8:20529866-20529888 GTGATTTGTCCAAGATCTCAAGG - Intergenic
1037693024 8:21198698-21198720 ATGATGGGCTCAAGATCACAGGG - Intergenic
1037723393 8:21463869-21463891 GAGACTTACTCACTATCACAAGG + Intergenic
1038128277 8:24698910-24698932 GTGATGTGCTAAAGGTCACATGG + Intergenic
1039417300 8:37406821-37406843 GTGATTTTCCCAAGGTCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1041813643 8:61941252-61941274 GTGATTTTCTCAATATCTCAAGG + Intergenic
1042627559 8:70775623-70775645 GTGGTTTTCTCAAGAATACAAGG - Intronic
1042636127 8:70877460-70877482 GTGATTTACTCAAGATCACTTGG + Intergenic
1042923327 8:73941109-73941131 GAGACTTACTCACTATCACAAGG - Intronic
1044241258 8:89891511-89891533 GTAACTTAACCAAGATCACATGG + Intergenic
1044365399 8:91339428-91339450 GTAATTTATTTAACATCACAAGG - Intronic
1044705566 8:95005092-95005114 GTCATTTACTCAAGATTGGATGG - Intronic
1044800891 8:95954091-95954113 GTCATTTTCTGAAGATAACAGGG - Intergenic
1045009505 8:97945356-97945378 ACGATTTACCCAAGCTCACATGG + Intronic
1045431597 8:102120113-102120135 ATAATTTGCTCAAGGTCACATGG - Intronic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1045951126 8:107852761-107852783 GAAATTTACTCAGGATTACATGG - Intergenic
1047367635 8:124226847-124226869 ATAATTTGCCCAAGATCACATGG - Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048167456 8:132076266-132076288 GTGATTTATGGAAGACCACACGG + Intronic
1048241678 8:132748884-132748906 GTAATTTTCCCAAGCTCACAGGG - Intronic
1048334075 8:133490235-133490257 GTGGCTTACTCCAGGTCACATGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1051099432 9:13504252-13504274 GTGATAGACTTAAGATCTCAGGG + Intergenic
1051839928 9:21384226-21384248 ATGTTGTACTCAAGATAACAAGG - Intergenic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1054754688 9:68945735-68945757 GTAACTTTCTCAAGACCACATGG + Intronic
1054959817 9:70955585-70955607 GTGGTTTATTCAAGGTCACATGG + Intronic
1055014699 9:71603475-71603497 CTGATTTACTCATGATCACCAGG - Intergenic
1055288398 9:74755932-74755954 GTGATTTTCCCAAATTCACATGG - Intronic
1055602239 9:77931736-77931758 GTAATTTACCCAAGGCCACAGGG - Intronic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058644999 9:107123206-107123228 GTAAATTGCTCAAGAGCACACGG - Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1058931781 9:109727370-109727392 GTGATTTGCTCAAAGTCAGATGG - Intronic
1058931961 9:109729469-109729491 GTGATTTGCTCAAAGTCAGATGG - Intronic
1059251877 9:112893113-112893135 GAAATTTGCACAAGATCACAAGG + Intergenic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059368549 9:113806531-113806553 GTAATTTGCCCAAGGTCACAGGG + Intergenic
1059555642 9:115277451-115277473 GTTATGTACTCAAGAGCTCAAGG + Intronic
1059555846 9:115279370-115279392 GTGATATATTTAAAATCACATGG + Intronic
1059686569 9:116643026-116643048 ATAATTTACTTAAGATAACATGG - Intronic
1059963366 9:119589364-119589386 GGGATCTACTCAAGGTTACAGGG - Intergenic
1060153493 9:121303230-121303252 GTGATTTGTCCAAGCTCACATGG - Intronic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1060845618 9:126834899-126834921 ATGAACTACTCAAGTTCACAGGG - Exonic
1060880278 9:127113228-127113250 GTGATTTGCCCAGGAACACACGG + Intronic
1060903484 9:127282507-127282529 GTGATTTTCCCAAGGTCACATGG + Intronic
1060979567 9:127784823-127784845 GTCATTTGCCCAAGGTCACACGG - Intergenic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1062378850 9:136277132-136277154 GTGATTTGTTCAAGGTCACATGG - Intergenic
1186592942 X:10950569-10950591 GTGATTTGTCCAAGGTCACACGG - Intergenic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187185779 X:16983848-16983870 GTAATTTGACCAAGATCACATGG + Intronic
1187310802 X:18140137-18140159 GTGTTCTTCTCAAGCTCACATGG + Intergenic
1187580805 X:20605361-20605383 ATGATTTTCTCAAGAACTCAGGG + Intergenic
1187708026 X:22026577-22026599 GTGATTTGCGAAAGGTCACAGGG - Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188072712 X:25736770-25736792 GTGATTCACCCAAGGTCACAGGG - Intergenic
1188442788 X:30229770-30229792 GTAATATGCTCAAGTTCACAGGG + Intergenic
1188781167 X:34287272-34287294 TTGCTTTTCTTAAGATCACAGGG - Intergenic
1188801858 X:34542217-34542239 ATGATTTCCTCAACATGACAAGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189257498 X:39651925-39651947 GGGACTTATTCAAGTTCACAAGG + Intergenic
1189557267 X:42158028-42158050 CTGGTTTATTGAAGATCACAGGG + Intergenic
1189663852 X:43332178-43332200 GTGACTTTCTTAAGATCTCATGG - Intergenic
1189977426 X:46476643-46476665 GTGAGTAACTCAAGGTCCCATGG + Intronic
1190116726 X:47630170-47630192 GTGACTCACCCAAGGTCACACGG - Exonic
1190427366 X:50345809-50345831 GTGATGTGCTCAGGTTCACACGG - Intronic
1190969216 X:55332675-55332697 GTAACTTACTCAAGGTCCCATGG + Intergenic
1191978329 X:66898209-66898231 GTGATCCAACCAAGATCACAGGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192710921 X:73586659-73586681 GTGACTTTCTCAGAATCACATGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193246054 X:79231678-79231700 GTGTCTTATTCAAGACCACAAGG - Intergenic
1193420517 X:81277765-81277787 ATGATTTATTCCACATCACATGG - Intronic
1193495762 X:82210446-82210468 ATGATTAAATCAATATCACATGG - Intergenic
1193952168 X:87813179-87813201 CTACTTAACTCAAGATCACAAGG + Intergenic
1194550079 X:95286852-95286874 GTAATTTGCTCAAAGTCACATGG + Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1195075399 X:101322685-101322707 GTGATTTGCCCAAAATCATATGG - Intergenic
1195085080 X:101406235-101406257 GTAATTTACCCAATGTCACAGGG + Intronic
1195460662 X:105120024-105120046 GTGACTTATCCAAGGTCACATGG + Intronic
1195767353 X:108310306-108310328 GTGATAGACTCAAGAGAACAAGG - Intronic
1195981798 X:110586485-110586507 GTAACTTACTCGAGGTCACATGG - Intergenic
1196481002 X:116148116-116148138 GTGATTTAGTCAAAATGTCATGG - Intergenic
1196735476 X:118977603-118977625 GGCATTTTCTCAAGGTCACACGG - Intronic
1196803033 X:119560598-119560620 GTGATTTGCCAAAGATCACCAGG - Intronic
1197958366 X:131977474-131977496 TTGATTTGCTCAAGATCACATGG + Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199200288 X:145079527-145079549 GTGCTTTGTTCAAGGTCACATGG - Intergenic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic