ID: 966038294

View in Genome Browser
Species Human (GRCh38)
Location 3:175447702-175447724
Sequence GCTATCCACTGAATCTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966038294_966038298 -8 Left 966038294 3:175447702-175447724 CCTGCCAAGATTCAGTGGATAGC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 966038298 3:175447717-175447739 TGGATAGCAGGCAACTATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 79
966038294_966038297 -9 Left 966038294 3:175447702-175447724 CCTGCCAAGATTCAGTGGATAGC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 966038297 3:175447716-175447738 GTGGATAGCAGGCAACTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 65
966038294_966038299 -7 Left 966038294 3:175447702-175447724 CCTGCCAAGATTCAGTGGATAGC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 966038299 3:175447718-175447740 GGATAGCAGGCAACTATCTGGGG 0: 1
1: 0
2: 1
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966038294 Original CRISPR GCTATCCACTGAATCTTGGC AGG (reversed) Intronic
903890807 1:26569248-26569270 GCCATCCACTGCACCTCGGCGGG - Intronic
908260875 1:62338643-62338665 GCTATTCCTTGAATCATGGCAGG - Intergenic
910147819 1:84103227-84103249 TCATTCCACTGAATCTGGGCTGG + Intronic
910823196 1:91373869-91373891 GCTTACCACTCAATCTTAGCAGG - Intronic
912690555 1:111801593-111801615 GCTAAGCACTGAATCTGGCCTGG - Intronic
913001028 1:114580991-114581013 GCTGTAGAGTGAATCTTGGCAGG + Intronic
915071325 1:153271847-153271869 TCTATCCACAGATTCTGGGCAGG + Intergenic
916562379 1:165944177-165944199 CCCATCCACTGAGTCTTGGTGGG + Intergenic
918819968 1:189240551-189240573 GGTCTCCACTGAAATTTGGCAGG - Intergenic
919659858 1:200233907-200233929 GCCATTCAGTGAATCTGGGCAGG - Intergenic
1064218058 10:13417084-13417106 GCTATCCAGTGACACTAGGCAGG + Intergenic
1065022983 10:21516434-21516456 GCTCTGCACTGACACTTGGCTGG + Exonic
1065742592 10:28810817-28810839 GGTCTCCACTGAACCTAGGCTGG + Intergenic
1073838618 10:107472558-107472580 GCTATGCACTAAATATTGGCAGG + Intergenic
1073861265 10:107744377-107744399 GCTCTCCACTCAGTCTTTGCTGG - Intergenic
1074149588 10:110746298-110746320 CCTATCCTTTGAATCTGGGCTGG - Intronic
1076644453 10:131942969-131942991 GCTCTCAACTGAGTCTTGTCTGG - Intronic
1078421195 11:11214428-11214450 TCTGTCCCCTGAGTCTTGGCAGG - Intergenic
1079580995 11:22064623-22064645 CCTATCCAGTGATTCTTTGCAGG - Intergenic
1079680060 11:23284769-23284791 GCAATACTCTGAATCTTGGATGG + Intergenic
1080444516 11:32325573-32325595 GCTAACCAGTGATTCCTGGCAGG - Intergenic
1083297074 11:61720579-61720601 TCCTTCCACTGAATCTGGGCTGG + Intronic
1085791930 11:79503914-79503936 GCCATCTGCTGACTCTTGGCAGG + Intergenic
1086934035 11:92724409-92724431 CCTATCCTCTGAATCTGGGATGG - Intronic
1087733568 11:101806384-101806406 TCTTTCCCCTGAATCTTGGATGG + Intronic
1106110583 13:26773101-26773123 GCTTTACTCTGAATCCTGGCAGG + Intergenic
1107937802 13:45359728-45359750 TCTAAGAACTGAATCTTGGCTGG - Intergenic
1108503663 13:51090237-51090259 TTCATCCATTGAATCTTGGCTGG + Intergenic
1112218556 13:97462370-97462392 GCTATACAGAGAAGCTTGGCAGG - Intronic
1115972342 14:38959772-38959794 GCTGTGCACTGAGACTTGGCAGG - Intergenic
1116332453 14:43613243-43613265 GTTATCCTCTGAATCTGGGAGGG - Intergenic
1128865558 15:71112591-71112613 GCTATACACAGCATCTTGGAGGG - Intronic
1130167177 15:81473388-81473410 CCTGTCCAATGAATTTTGGCTGG - Intergenic
1141603784 16:85141805-85141827 TCTAGACACTGAAGCTTGGCAGG - Intergenic
1141894411 16:86949485-86949507 GCCATCCACTGAATCCTTCCAGG - Intergenic
1143264688 17:5627528-5627550 GCTATCAACTGGAACTCGGCTGG - Intergenic
1143396582 17:6603889-6603911 GCTCTCCACTCAGTCTTTGCTGG - Intronic
1143596715 17:7918716-7918738 TCTATCCCTTGAATCTGGGCTGG + Intergenic
1144535016 17:16079994-16080016 GCTCTCCACTGAAATTTTGCTGG + Exonic
1148323911 17:46772373-46772395 GCTTTCCCCTGGCTCTTGGCCGG + Intronic
927517229 2:23679527-23679549 CCTACCCTTTGAATCTTGGCTGG - Intronic
928251530 2:29685525-29685547 GGTATCCAATGAATTCTGGCTGG - Intronic
932061270 2:68500888-68500910 GCTGTCCTCTGGCTCTTGGCAGG - Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
938422365 2:131155324-131155346 GCTTTCCACTGAAACGTGGCAGG - Intronic
943268114 2:185763602-185763624 GCTATACCCTGAATCTTTGCTGG - Intronic
948066464 2:235084462-235084484 GGGATCCACTGACTCTTGGTTGG - Intergenic
1169610074 20:7368928-7368950 TCTATGCACTGGATCTTGGAAGG - Intergenic
1175767020 20:61598858-61598880 GCCATCCAGGGAAGCTTGGCGGG - Intronic
1185052235 22:48559891-48559913 GCCGTGCACTGAATCTTTGCGGG + Intronic
950327678 3:12127559-12127581 ACTAACAACTGAATTTTGGCAGG - Intronic
951046700 3:18047393-18047415 CCCATCCAATGAATCTGGGCTGG - Intronic
952217492 3:31292238-31292260 ACTATGCATTGAATCATGGCTGG - Intergenic
955608499 3:60732270-60732292 TCCAACCACTGAGTCTTGGCAGG + Intronic
956037228 3:65107205-65107227 CCTCTCCACTGAATTTTAGCTGG - Intergenic
960169550 3:114442737-114442759 GCTATCCACTGAAACCTTGAAGG + Intronic
962113513 3:132475819-132475841 GCTGACCACTAAATGTTGGCTGG + Intronic
962715671 3:138124173-138124195 GATCTCCACTGTCTCTTGGCGGG - Exonic
964132476 3:153305547-153305569 GGTATCCTCTAAAGCTTGGCAGG - Intergenic
964805121 3:160600929-160600951 GATATTCACTGAATATTTGCTGG - Intergenic
965351711 3:167620267-167620289 GCTATCCCTTGAATACTGGCAGG - Intronic
966038294 3:175447702-175447724 GCTATCCACTGAATCTTGGCAGG - Intronic
972838921 4:42908376-42908398 GCTATCTCCTGCATCTTGCCTGG + Intronic
975995306 4:80307208-80307230 TGTATCAACTGAATCTTGACAGG - Intronic
977437339 4:97015110-97015132 TCTATCCTCTGCATCTTGGTGGG + Intergenic
978983026 4:114974509-114974531 GCTACCCACTGTATTTTGCCAGG - Intronic
981326942 4:143460387-143460409 GCTATGCACTGAATCTGGTCGGG - Exonic
982397208 4:154925564-154925586 GCTGTCCATAGAACCTTGGCTGG + Intergenic
989978391 5:50612343-50612365 GCTATCCCCTGAGTCTTGAGAGG + Intergenic
990209391 5:53466128-53466150 GCTAGACCCTGAATGTTGGCAGG + Intergenic
990280441 5:54245228-54245250 AGTAACCACTGAATCTTAGCAGG + Intronic
991106747 5:62852009-62852031 GCTCCTCACTGAATCTTTGCTGG + Intergenic
998059093 5:139105077-139105099 GCCATCCAGTAAATTTTGGCAGG - Intronic
998913779 5:146992810-146992832 GCTCTCCACTCAGCCTTGGCTGG + Intronic
1003211001 6:4066601-4066623 GCTCACCACTGTATCCTGGCAGG - Intronic
1005190323 6:23214199-23214221 GCCACCAACTGAATCTGGGCTGG - Intergenic
1015029739 6:128580499-128580521 GTTATCCTCTGCTTCTTGGCCGG + Intergenic
1019229362 6:170545581-170545603 GCTATCAACTGAAGCTGGTCAGG + Intronic
1020727123 7:11830215-11830237 GCTGTACAGTGAATGTTGGCTGG + Intronic
1028845615 7:95476279-95476301 GCTATCCGATGACTCTGGGCTGG - Intergenic
1040601015 8:48883849-48883871 GTTTTCCACTGGAGCTTGGCTGG + Intergenic
1047325467 8:123831534-123831556 GCTATTCACTAACTCTTGGAAGG - Intergenic
1047331083 8:123887411-123887433 GCTGCCCATTTAATCTTGGCTGG + Intronic
1051182462 9:14425632-14425654 GCTATCCACTGAAGCTTAGATGG + Intergenic
1052023005 9:23545937-23545959 GCTATACACTAAAACTTGACCGG + Intergenic
1056107594 9:83362633-83362655 GCTCTCCACTTAATCCTGGCTGG - Intronic
1057646193 9:96877374-96877396 CCTGACCTCTGAATCTTGGCGGG + Intergenic
1058939494 9:109799853-109799875 GCTTTCCACTGAAGCTGGGGAGG - Intronic
1061971865 9:134049459-134049481 GCTATCCACAAACACTTGGCAGG + Intronic
1186288828 X:8074364-8074386 GCTTTCCACTGGCTTTTGGCTGG + Intergenic
1188644937 X:32553992-32554014 TCTATCCATTGAATCCTGGGTGG - Intronic
1190998464 X:55635886-55635908 GATATCCAGTGACTCTTGCCAGG - Intergenic
1194342631 X:92723349-92723371 GATATTCATTCAATCTTGGCAGG - Intergenic
1199692887 X:150322065-150322087 GCTTTCCACTCAGTCTTTGCTGG - Intergenic
1200650995 Y:5840032-5840054 GATATTCATTCAATCTTGGCAGG - Intergenic